Диетический стол 5п: Страница не найдена

Содержание

как составить правильное меню на неделю

Под термином «панкреатит» принято понимать воспалительный процесс, поражающий слизистые ткани поджелудочной железы, и нередко приводящий к их некротическим изменениям. На фоне развития патологии орган частично утрачивает способность к естественному выводу ферментов, что приводит не только к разрушению самой железы, но и значительным нарушениям функций всего тракта пищеварения.

Чтобы не допустить развития осложнений на поджелудочной железе при панкреатите, необходимо подобрать правильную диету

Правильное питание при заболеваниях такого рода — один из наиболее важных факторов, способствующих процессу выздоровления. Так, для различных форм и стадий недуга было разработано несколько основных видов диет, каждая из которых предполагает составление определенного меню. Диетический стол под номером 5п предназначен для лечения заболевания в период после наступления 3-4 суток от начала обострения.

Первый вариант диеты 5п

Диета 5п при панкреатите существует в двух основных вариантах.

Первый подразумевает существенное ограничение потребляемых больным в течение суток калорий, то есть, она менее насыщенна энергетически. Такого рода диетический стол предписывается больным в стадии как обострения хронического панкреатита, так и на фоне острого воспалительного процесса.

Правильное питание, в соответствии с указанной вариацией диеты номер 5п, подразумевает следование определенным рекомендациям:

  • Основу меню больного составляют исключительно блюда, приготовленные посредством применения обработки паром и варки. Жареные, запеченные продукты исключаются в полной мере.

Снять симптоматику панкреатита поможет питание небольшими порциями и употребление приготовленной на пару еды

  • Питание должно быть только дробным. То есть, в качестве разового приема пищи допускается лишь небольшая порция, есть при этом следует не менее 5-6 раз в день.
  • Все приготовленные продукты необходимо подвергнуть предварительной обработке, например, измельчить, перетереть. Рекомендуется есть супы и жидкую пищу.

Разрешенные продукты

Список блюд, составляющих основу диеты номер 5п, достаточно обширен. Диетический стол включает все виды продуктов, необходимых для поддержания жизнедеятельности. Также посредством их употребления исключается негативное воздействие на тракт пищеварения, значительно снижается нагрузка на поджелудочную железу. Перечень блюд, допустимых к употреблению, выглядит следующим образом:

  • Из напитков разрешены лишь следующие: вода, отвары из некоторых видов растений и сухофруктов. Запивать пищу категорически не рекомендуется. Употреблять жидкость следует примерно через час после основных трапез.
  • Блюда, приготовленные из овощей, прошедших термическую обработку. Это могут быть различные вариации рагу, так называемых горячих салатов, пюре. При этом необходимо исключить те виды, которые содержат большое количество клетчатки, требующей значительных усилий организма при переваривании.
  • Небольшое количество творога исключительно в виде пудингов, запеканок, либо иных блюд.

Полезными во время диеты будут различные каши, что улучшат работу кишечника

  • Паровые блюда, приготовленные посредством использования мяса нежирных сортов. Рекомендуется предварительно тщательно измельчать такого рода пищу, например, при помощи блендера.
  • Все виды злаковых, на основе которых можно приготовить как различные каши, так и супы. Следует, однако, полностью исключить пшено ввиду большого содержания клетчатки.
  • Диетическое меню допускает употребление небольшого количества фруктов, прошедших предварительную термическую обработку. Принимать их в пищу в свежем виде не следует.

Запрещенные продукты

Диетический стол больного воспалительными заболеваниями тракта пищеварения подразумевает наложение ограничений на употребление множества различных продуктов. Так, из меню следует обязательно исключить:

  • Все жирные виды мясной продукции, в том числе, рыбу и птицу.
  • Овощи и фрукты без обработки, то есть, в свежем виде.

Мясо жирных сортов находится под запретом, если соблюдается диета 5п

  • Молочную продукцию в цельном виде.
  • Овощи и фрукты, содержащие большое количество клетчатки.
  • Жирную, сладкую, острую пищу.

Второй вариант диеты 5п

Меню, рекомендованное в качестве второго варианта диет номер 5п, гораздо более многообразно, и содержит лишь некоторые ограничения. Диетический стол данной категории рекомендован лицам, которые страдают хроническим панкреатитом преимущественно в стадии ремиссии.

Правильное питание в данном случае подразумевает значительное ограничение по количеству в день, либо полное исключение продукции, содержащей быстрые углеводы. Общие рекомендации, касающиеся основных правил потребления пищи, в данном случае аналогичны требованиям первого варианта диеты номер 5п.

Разрешенные продукты

Диетический стол второго варианта диеты 5п достаточно многообразен, и позволяет в полной мере удовлетворить не только потребности организма в полезных и питательных веществах, но и вкусовые потребности больного.

Во время диеты полезным будет регулярное употребление овощных супов

В числе продуктов, которые допустимо включить в меню на каждый день, называются:

  • Омлеты, приготовленные исключительно из свежих яиц. Общее их количество следует ограничить — не более пяти в неделю.
  • Основа лечебного меню — различные супы и жидкие каши, приготовленные посредством использования как овощного, так и слабонасыщенного мясного бульонов. Лучше, если ингредиенты, входящие в их состав, будут мелко нарезанными, либо натертыми.
  • Различные молочные и кисломолочные продукты. Необходимо отметить, что следует значительно ограничить потребление свежего и тем более концентрированного молока в неделю. Подобные запреты не распространяются на кисломолочную продукцию, напротив, она способствует улучшению пищеварения в целом и перистальтики.
  • В меню разрешено включить даже небольшое количество сладостей, приготовленных с использованием натуральных ягод и меда в домашних условиях. Кондитерские изделия, произведенные в промышленных условиях, требуется исключить.
  • Овощи, фрукты, непосредственно после термической обработки. Свежие плоды также можно есть, но в очень небольшом количестве. Так, количество употребляемых свежих фруктов в неделю не должно превышать 200 граммов.

Допускается включать в диету молочную продукцию в ограниченном количестве

  • Диетическое питание также включает употребление злаков и макаронных изделий. Однако все указанные варианты продуктов должны быть исключительно высокого качества и отвечать принятым нормам.

Запрещенные продукты

При хроническом панкреатите следует неукоснительно соблюдать определенные правила питания. Так, из привычного меню, в соответствии со вторым вариантом диеты 5п, следует полностью исключить:

  • Напитки и продукты, содержащие в любом количестве алкоголь.
  • Жирную пищу, острую, сладкую, специи и пряности.
  • Все виды консервации, маринадов, солений.
  • Шоколад, либо иные продукты, приготовленные посредством использования жиров и какао.

Примерное меню

При составлении меню больного воспалительными заболеваниями на неделю или день следует учитывать индивидуальные физиологические особенности, текущее состояние, а также, что немаловажно, вкусовые пристрастия.

Приготовленные на пару котлеты можно употреблять на завтрак людям с панкреатитом

Рацион должен в полной мере содержать продукты, обеспечивающие организм достаточным количеством полезных веществ и витаминов.

Как уже было сказано выше, таблица разрешенных продуктов при панкреатите достаточно многообразна, что позволяет составить полноценный и насыщенный рацион. Примерное меню на неделю выглядит следующим образом:

  • Завтрак. Паровые котлеты, приготовленные посредством использования свежей рыбы. Легкий омлет из белков. Каша, приготовленная на воде, либо с добавлением небольшого количества молока. В качестве напитков в утренние часы чаще всего предлагается отвар из плодов обыкновенного шиповника, который способствует восстановлению иммунной защиты организма.
  • Второй завтрак. Небольшое количество творога, если разрешено — с добавлением фруктов. Кусочек черствого хлеба. Небольшая порция овощного пудинга. Из напитков — кисель.
  • Обед. Суп, приготовленный на основе слабо насыщенного мясного, либо овощного бульона, в который можно добавить как овощи, так и немного постного мяса. Рагу, либо горячий салат из овощей. Допускается маленький кусочек черствого хлеба. Напиток — слабый чай.

В утренние часы допустимо употребление творога, к примеру, с ягодами

  • Полдник. В этот период лучше всего есть кисломолочную продукцию. Если она запрещена, например, в острой фазе панкреатита, то допускается маленькая порция пудинга из постного мяса.
  • Ужин. В это время идеальным вариантом блюда считается небольшое количество приготовленного на пару мяса в сочетании с тушеными овощами.
  • Перед сном допускается выпить кефир, йогурт, либо иной, предусмотренный диетическими предписаниями, напиток.

Указанные варианты блюд допустимо варьировать в течение недели в соответствии с вкусовыми потребностями. При приеме пищи не следует также забывать о том, что правильное питание предполагает тщательное пережевывание и размеренную трапезу.

Какие продукты разрешены при панкреатите — об этом пойдет речь в видео:

Рецепты диеты 5п на каждый день


Содержание:

Диета номер 9 при диабете 2 типа: меню и рекомендации
Особенности лечебного питания после удаления желчного пузыря
диета номер 56
Диета при панкреатите
Диета при панкреатите: меню на каждый день
Диета Номер 5 Рецепты На Неделю

Диета номер 9 при диабете 2 типа: меню и рекомендации

Лук нарезать кольцами, морковь натереть. Баклажаны почистить и порезать на маленькие кубики, засыпать солью, оставить на 10 минут, промыть. В сковороду налить ложку масла, две столовые ложки воды и поставить тушить лук, морковь и баклажаны. Перец почистить и поставить в форму для запекания, начинить овощами. Томатную пасту развести водой и залить нею дно формы и по две ложки жидкости влить в каждый перец. Запекать 35 минут при 180 градусах, посыпать тертым сыром и зеленью и еще готовить 10 минут.

Овсяные хлопья перемолоть на кофемолке до состояния муки, смешать с яйцом и простоквашей. Замесить тесто, распределить его по форме для выпечки так, чтобы получились бортики примерно 2-3 см. поставить форму в холодильник на полчаса, затем выпекать при температуре 200 градусов в уже разогретой духовке 15 минут. Затем выложить начинку и допекать еще 30 минут при 180 градусах. Начинка для пирога готовится таким образом:


Если организм голодает больше 11 часов, он вырабатывает ферменты, которые всю последующую пищу переводят в жиры для накопления запаса в период голодания. Поэтому при диабете необходимо дробное питание с перерывами не более 4 часов. Не обязательно строго следовать диетам из различных изданий, вполне возможно самим составлять подобные меню, ориентируясь на ХЕ и гликемический индекс.

Количество соли должно быть минимальным (не свыше 3 г в сутки). Ведь она задерживает воду в организме. Это приводит не только к отекам, но и повышению давления, а это одна из причин возникновения данного заболевания (замкнутый круг). И помните, это довольно коварный момент. Соль в небольших количествах содержится в пище даже если вы блюдо вообще не солили;

Существует ошибочное мнение, что диета при сахарном диабете 2 типа исключающая углеводы из рациона питания, поможет уменьшить уровень сахара в крови. Однако не получая углеводов из пищи печень в ответ на углеводное голодание начинает производить сахар из своего запаса (гликогена) и далее из белков и жиров, которые поступают к ней по кровотоку.

Соблюдение сбалансированной диеты является нормой питания при диабете 2 типа, поскольку это является залогом долгой полноценной жизни. В основе новых разработок диетологов и ученых эндокринологов лежит не ограничение, а сбалансированность продуктов в меню на каждый день.

Особенности лечебного питания после удаления желчного пузыря

В первые дни после операции больной остается под наблюдением медицинских специалистов. Сколько по времени продлится пребывание в стационаре, зависит от способа операционного вмешательства. На практике предпочтение отдается лапароскопической холецистэктомии, стационарное лечение после которой не превышает 2-3 дня. При наличии противопоказаний, желчный пузырь удаляют открытым (полостным) способом, что автоматически увеличивает ранний послеоперационный период до 10 суток.

Послеоперационная диета исключает употребление бобовых культур. Горох, фасоль, чечевица, соя усиливают газообразование, способствуют процессам брожения. Нельзя пить газированные воды, черный кофе, крепкий чай, концентрированные кислые соки, под строгим запретом – алкогольные напитки. Не стоит увлекаться щелочными минеральными водами. Они относятся к группе гидрохолеретиков, активирующих образование и выведение желчи, что после холецистэктомии нежелательно.


С помощью диеты после удаления желчного пузыря можно создать максимальный покой билиарной системе, свести риск развития неприятных последствий операции к минимуму. Только организовав частые приемы пищи через одинаковые временные промежутки, можно постепенно добиться рефлекса выработки желчи в нужное время в оптимальном объеме. Бесконтрольный режим питания, вернее его отсутствие, обильные порции, ничего, кроме возобновления неприятных ощущений, не принесет.

Ранний адаптационный период предполагает соблюдение диеты для обеспечения щадящей нагрузки для пищеварительной системы. В течение месяца после операции налаживаются процессы переваривания пищи, метаболические реакции, от нормального течения которых зависит самочувствие и состояние здоровья человека. Скорость и качество обменных процессов зависит от постоянного присутствия достаточного количества жидкости, а также витаминов и минералов.

правильное питание рф официальный
правильное похудение в домашних отзывы
прайм фитнес ростов на дону
препараты для похудения отзывы цена
прием мкц для похудения
пример меню диеты 5
примерный день правильного питания
про план ветеринарная диета для кошек отзывы
программа питания для похудения форум
программа тренировок в зале для роста мышц
программа убрать живот на фото
продукты жиросжигатели самые эффективные
проект на тему здоровое питание залог крепкого здоровья
Через полгода после операции диетический стол остается прежним, небольшие послабления допускаются спустя 1,5-2 года после операции. Под строгим контролем должно оставаться количество потребляемых жиров, быстрых углеводов (сахара), яиц, молочных продуктов. Но экспериментов с отклонением от правильного режима питания быть не должно. Чтобы пищеварительная система работала как часы – больные едят несколько раз в день в одно и то же время.

После удаления желчного пузыря можно много пить, жидкость разжижает желчь и является катализатором обменных процессов. Немалую опасность представляет употребление продуктов с холестерином, они заставляют перенапрягаться печень и поджелудочную железу, увеличивают вязкость секрета. Не стоит забывать и о профилактических походах к врачу-гастроэнтнрологу, особенно если беспокоят неприятные симптомы после еды.

диета номер 56

Диетический стол n 5 С 56 до 53 кг за 2 недели Одна диета При панкреатите без неё никак номер Лонго В Лонгевита Революционная долголетия 978 04

Лечебная диета СТОЛ №4 Острые и хронические заболевания кишечника

Официальные гомеопатическое диета падение плана 2 унций (примерно

Худеем за неделю средиземноморская диета для снижения веса кейс

Бесплатное изображение: кухонный стол салат бар кухня Кафетерий

Стол №8 Диета при ожирении ( меню на неделю рецепты рекомендации)

Диета при панкреатите

Исключаются все копчёные, солёные, жареные и острые блюда, а также свежие хлебобулочные изделия, просо, кукуруза, перловка с маргарином, бобовые. Не рекомендуются жирная рыба (форель, сом, горбуша), жирное или копчёное мясо, маринады и сливки. Кроме того, нельзя употреблять кислые ягоды, инжир, газированную воду, виноград, алкоголь, какао и шоколад.

Диета при панкреатите является основным методом лечения, так как только специальное поддерживающее питание может дать облегчение поджелудочной железе. Поддержание здоровой массы тела также очень важно, поскольку ожирение может увеличить риск развития панкреатита, усугубить тяжесть его симптомов, и усилить осложнения.


На третий день диеты можно включать в рацион несладкий чай, а также бульоны и жидкое пюре. С пятого дня добавляют морковное и картофельное пюре. Можно употреблять предварительно измельчённую речную рыбу, взятую не из готовых продуктов. Также разрешается включать в рацион молоко и творожные продукты.

Признаки и симптомы воспаления поджелудочной железы включают боль в верхней части живота, тошноту и рвоту. Что касаемо осложнений болезни, то они могут обернуться кровотечениями, образованием желчных камней, развитием сахарного диабета и другими проблемами, связанными с внутренними органами.

рецепты диетических блюд диета 5
рецепты диеты 4в
рецепты диеты 5 после удаления желчного пузыря
рецепты диеты 5 стол
рецепты диеты 5 стола
рецепты диеты 5 стола на каждый
рецепты диеты 5 форум
Очень важно избегать продуктов, содержащих сахар в случаях высокого уровня глюкозы в крови, а также чрезмерного употребления алкогольных напитков и табака, так как это повышает риск развития панкреатита и вероятность острых приступов в случаях хронической формы болезни.

Разрешаются варёные и нежирные сорта говядины, кролик, рыба. Допускаются некислый творог, паровой омлет, вчерашний хлеб, масло растительное и сливочное, из фруктов — печёные яблоки, из соусов — только на основе молока. Рисовая и манная каши — на молоке с добавлением воды.

Диета при панкреатите: меню на каждый день

Поджелудочной железой синтезируются неактивные предшественники ферментов. Они становятся активными в 12-перстной кишке, куда попадают по желчным протокам. При воздействии разных патогенных факторов в протоках затрудняется отток секрета. В результате он преждевременно активируется в железе и начинает вместо еды переваривать клетки органа. Возникает острый воспалительный процесс. При хроническом панкреатите происходит постепенное замещение здоровых тканей на соединительную, вызывая экзокринную и эндокринную недостаточность.

Панкреатит — это воспаление поджелудочной железы, рассказывает WebMD. С этим заболеванием сталкивается не каждый. Оно возникает при долгом употреблении в пищу вредных продуктов, повреждениях брюшной области, интоксикациях и проблемах с функционированием печени. Обычно, как пишут авторы авторитетного издания British Medical Journal Джо Хайнс и Стивен Дж. Пандол, недуг развивается медленно в результате регулярного поступления в желудок жирного и жареного, в особенности фастфуда. Не менее ощутимый вред организму наносят пагубные зависимости.


В первое время обострения хронического панкреатита рекомендована диета №5п. Однако в некоторых случаях допускаются индивидуальные отклонения, но блюда в меню должны всегда иметь предписанную диетологами суточную калорийность, рекомендуемое количество белков, углеводов, жиров и полезных микроэлементов. Дефицит этих веществ может спровоцировать ухудшение состояния пациента.

Диета при панкреатите оказывает благотворное влияние на организм человека. Проблемы, которые возникают из-за заболевания поджелудочной железы, выражаются острыми болезненными ощущениями в теле. Такие симптомы мешают вести привычный образ жизни. Давайте разбираться, как исправить ситуацию, что можно добавить в рацион, а от чего стоит отказаться при панкреатите.

Хронический панкреатит (диета №5п весьма эффективна при данной болезни) в стадии обострения лечится не только медикаментами, но и соответствующим питанием. Медики советуют отнестись к диете №5п со всей ответственностью. Не увлекаться без назначения врача сладким, так как употребление сахара в количестве более 60 г способно вызвать обострение панкреатита.

После выписки из больницы ограничивать себя в еде рекомендуется ещё в течение 8-12 месяцев. Но это не значит, что затем диету можно не соблюдать. Даже по истечении этого срока необходимо ограничивать себя в продуктах питания. Диета должна стать для вас своеобразной культурой питания, которая прочно и надолго войдёт в вашу повседневную жизнь.

Диета Номер 5 Рецепты На Неделю

Бесплатный сервис WeekMenu .by составил меню на неделю для семей, которые хотят питаться вкусно и разнообразно, но при этом не готовы тратить на еду большую часть своего семейного бюджета: Ориентировочная стоимость меню в расчете на семью из двоих человек составила . . .

Ниже предлагаем вам 7 рецептов лучших вегетарианских завтраков на каждый день недели! Если вы вегетарианец, который стремится употреблять  Ниже описаны невероятно простые в приготовлении и богатые питательными веществами рецепты завтраков, которые станут . . . 


FMD диета, имитирующая голодание, для здоровья и долголетия от профессора Вальтера  Примерное меню с подбором рекомендуемых продуктов на 5 дней, рецепты .  Да и переносится диета 5 :2 намного труднее, ведь ограничивать свой рацион приходится каждую неделю на 2 . . . 

Особенно тщательно и регулярно следует контролировать уровень холестерина людям с лишним весом, с болезнями сердца, гипертонией, мужчинам и женщинам после 40 лет . Поддерживать нормальный уровень липидов можно с помощью диеты и активного образа жизни . 

Диета стол 3 для облегчения состояния при лечении желудка с рецептами и фото! Разнообразное, вкусное меню на неделю и рецепты по диете  Особое место в диете Стол Номер 3 уделяется жидкости . Кроме жидкости в меню, нужно выпивать минимум полтора литра . 

Диета при заболеваниях печени и желчевыводящих путей должна способствовать восстановлению функционального состояния самой печени, нормализации процессов желчеобразования и желчевыделения, а также восстановлению нарушенного обмена веществ . . . 

sitemap

Примерное меню диеты № 5п (панкреатической) – протертый вариант

Примерное меню диеты № 5п (панкреатической) – протертый вариант

1-й завтрак: мясные паровые котлеты, каша овсяная (гречневая) на воде, протертая, чай с молоком.

2-й завтрак: творог, кисель.

Обед: овощной суп (без капусты) протертый, мясное суфле с картофельным пюре, компот из свежих протертых яблок.

Полдник: отвар шиповника, сухари.

Ужин: белковый паровой омлет, манная каша, некрепкий чай.

На ночь: минеральная вода боржоми (1/2 стакана).

Примерное меню диеты № 5п – непротертый вариант

1-й завтрак: винегрет, отварное мясо, гречневая рассыпчатая каша.

2-й завтрак: сухие фрукты (чернослив, курага), некрепкий чай с несдобным печеньем.

Обед: салат, овощной суп, отварная курица с отварным картофелем, яблоко.

Полдник: творог, компот из сухих фруктов.

Ужин: отварная рыба с отварной вермишелью, некрепкий чай.

На ночь: чай с молоком, сухарик.

При обострении хронического панкреатита лечебное питание направлено на максимальное механическое и химическое щажение поджелудочной железы и всей системы пищеварения.

Пользуйтесь, но не злоупотребляйте – таково правило мудрости. Ни воздержание, ни излишества не дают счастья.

Ф. ВОЛЬТЕР (1694–1778), французский писатель, философ

В первые (1-й – 2-й) дни обострения заболевания показан полный покой (постельный режим). Разрешается употреблять минеральную воду типа «боржоми», «славяновская» (1 – 1,5 л в день). Вода должна быть комнатной температуры или слегка подогретой, без углекислого газа. Возможно также употребление отвара шиповника (не очень насыщенного), некрепкого и несладкого чая (с минимальным количеством сахара).

По мере улучшения самочувствия (обычно это бывает на 3-й день с начала обострения) назначают щадящую диету:

• слизистые супы,

• протертые жидкие каши, овощные пюре, молочные и фруктовые кисели.

Все блюда должны быть жидкими или полужидкими, вареными или приготовленными на пару, протертыми.

Данный текст является ознакомительным фрагментом.

Продолжение на ЛитРес

диетический стол №5п и онлайн помощник конструктор персональной диеты

• диеты при повышенном уровне холестерина
• похудеть во время кормления грудью
• здоровье диеты еда
• диета виктории бекхэм после родов
• новые статусы про диету
• эффективные диеты похудния раз и навсегда
• как выбрать себе правильную диету
• диет анджелины джоли
• aллен рр лёгкий способ похудеть
• диете похудела
диетический стол №5п и онлайн помощник конструктор персональной диеты
• диеты срочно за 2 месяца результат?
• диеты для похудания рецепты
• как вызвать месячные после диеты
• диета при протезировании клапанов сердца
• похудение при помощи диет
• диета пари мочекаменной болезни
• диетическая еда доставка
• как похудеть в животена тренажерах
• диеты для похудения на 20кг
• диета питание по 1 группе крови какие можно фрукты
• похудеть на 6 кг за 3 дня
• диета три яблока
• рецепты блюда для похудания диета
По сути, диетический стол №5п и онлайн помощник конструктор персональной диеты трудно назвать диетой.
Это способствует потере жировой ткани при сохранении и даже наращивании мышечной. Диета Кима Протасова предписывает потреблять большое

Плюсы диетический стол №5п и онлайн помощник конструктор персональной диеты
Похудение по диетический стол №5п и онлайн помощник конструктор персональной диеты
Раз в 3 месяца где-то повторяю эту диету с соком.. Тут почитала форум ( конечно, не истина в последней инстанции): DE BIO-HCG+ OVERGEWICHTTHERAPIE Там.. я похудела только на килограмм от грейпфрутов с яйцами.

Программа похудения по диетический стол №5п и онлайн помощник конструктор персональной диеты рассчитана на три этапа.
Похудеть на четыре килограмма за одну неделю вам поможет диета по гликемическому индексу.Это одна из немногих диет которая не навредит

Основное правило диетический стол №5п и онлайн помощник конструктор персональной диеты
8 июл 2010 Самая безобидная и эффективная для нашего организма диета – это После завтрака, через часа 2,3 нужно съесть рыбное блюдо с

Первый этап диетический стол №5п и онлайн помощник конструктор персональной диеты:7 янв 2012 Безуглеводная диета для бодибилдеров, диета для улучшения кожи лица.
Необычайной популярностью пользуются суповые диеты. Потребуется шесть крупных луковиц, 300 г корня сельдерея, 300 г моркови. Все это можно

Второй этап диетический стол №5п и онлайн помощник конструктор персональной диеты:13 мар 2012 Диета для похудения для мужчин, форум таблетки для похудения.

Третий этап диетический стол №5п и онлайн помощник конструктор персональной диеты:Семь дней придется усиленно кушать огурцы – они являются основой диеты. Причем огурцы необходимо есть только в свежем виде, без соленых

диетический стол №5п и онлайн помощник конструктор персональной диеты, отзывы:8 июн 2010 Диета на гречке (гречневая диета) рассчитана на одну – две недели, повторять ее можно не ранее, чем через месяц после окончания

диетический стол №5п и онлайн помощник конструктор персональной диеты

Памятка по диете 5-п

Памятку по диете №5 вы можете прочитать здесь.


Disclaimer: Эта шпаргалка, как и многие другие на этом сайте, предназначена для меня самого или для моих друзей. Информация полностью неофициальна. Рекомендую не читать и не использовать. Претензии не принимаются.


ПАМЯТКА


(Диета 5-п. Назначается преимущественно при хроническом панкреатите)

РАЗРЕШАЕТСЯ:

  1. Хлеб и хлебные изделия : хлеб пшеничный 1 и 2 сорта, выпечки предыдущего дня или подсушенный, а также в виде сухарей 200 — 300 r в день.

  2. Супы: овощные (кроме белокочанной капусты), с небольшим количеством овощей; крупяные (манная, овсяная и др. кроме пшена), с вермишелью. В период обострения болезни — лучше протертые или слизистые. Суп — 1/2 тарелки. Для вкуса можно добавить немного масла или сметаны (вне периода обострения болезни).

  3. Блюда из мяса и птицы: мясо нежирных сортов (говядина, телятина, курица и др.), лучше свежее, свободное от сухожилий и жира. Приготавливается в отварном или паровом виде (котлеты кнели, фрикадельки, пюре, рулет и др. ). В периоды ремиссии — нежесткое и нежирное мясо разрешается в отварном виде куском.

  4. Блюда из рыбы: различные нежирные сорта рыбы, лучше речной, в отварном, паровом, рубленном виде и куском.

  5. Блюда и гарниры из овощей кроме белокочанной капусты, репы, редиски, щавеля, шпината, лука, редьки, брюквы; применять в вареном, в протертом виде.

  6. Блюда и гарниры из круп и макаронных изделий: крупа — манная, гречневая, овсяная; макароны, домашняя лапша, вермишель, каши протертые (из молотых круп), суфле, пудинги; каши, вареные в воде или пополам с молоком; макароны мелкорубленые; в период обострения — полужидкие каши.

  7. Фрукты: яблоки некислые в запеченном виде, компоты полусладкие, в период ремиссии (отсутствия обострения) можно другие некислые, не очень сладкие, спелые фрукты и ягоды (в зависимости от переносимости).

  8. Творог: некислый, лучше домашнего приготовления (из молока, кефира). Способ приготовления – в цельном виде или в виде паровых пудингов.

  9. Яйца: только белок в виде белкового омлета.

  10. Соусы; не острые соусы на овощном бульоне или молочные соусы.

  11. Напитки: чай некрепкий, полусладкий: отвар шиповника полусладкий, фруктово-ягодные не очень сладкие соки (если не вызывают изжогу).

  12. Жиры: масло сливочное, несоленое, добавлять в блюда для вкуса (не жарить).

ПРИМЕРНЫЙ НАБОР ПРОДУКТОВ НА ДЕНЬ:

(вес брутто. т. е. с отходами)

масло 40-45 г яйца (только белки) 3 шт.
молоко 400-500 мл картофель 300 г
крупы 60 г морковь (свекла) 300 г
мука 25 г зелень прочая 20 г
творог 200 г яблоки 90 г
мясо 350 г чернослив 50 г
рыба 200 г хлеб белый 200 г
сметана 30г сахар 50г

Рыба заменяется мясом в соотношении 1,5 к 1 и обратно. Набор продуктов может быть изменен, но с учетом содержания в них углеводов, жира и белка с тем, чтобы в дневном рационе содержалось 140-150 г белков, 70-80 г. жиров, 300-400 г углеводов. Приведенное в памятке количество продуктов содержит 149 r белков, 74 r жиров, 360 г углеводов. Калораж диеты 2770 кап. Пищу принимать 5-6 раз в день.

ПРИМЕРНОЕ МЕНЮ:

Завтрак:

2 завтрак.

Обед:

  • Суп картофельный вегетарианский (полпорции)

  • Котлеты мясные, запеченные в сметане с морковным пюре

Полдник

Ужин:

На ночь:

На весь день:

ЗАПРЕЩАЕТСЯ:

  1. Консервы, мясные бульоны, крепкий чай и кофе, различные копчености, содержащие много экстрактивных веществ.

  2. Алкогольные напитки в любом виде.

  3. Газированные напитки, пряные, острые, кислые блюда и продукты, кислые и соленые или очень сладкие овощи и фрукты.

  4. Грибы, бобовые.

  5. Масло употреблять в блюда (не в чистом виде, не на хлеб), для вкуса лучше сливочное, свежее. Соль — нормальное количество (не ограничивать).

ДОПОЛНИТЕЛЬНЫЕ СОВЕТЫ:

  1. Вне обострения диету можно расширять: вводить овощи, фрукты, соки, которые лучше употреблять на 3 блюда. Переход на вновь вводимые блюда должен быть осторожным, постепенным.

  2. Пища, как количественно, так и качественно не должна быть нагрузочной: не переедать. Лучше есть понемногу, но чаще.

  3. Режим питания не менее важен, чем диета. Питание должно быть 5-6 разовым.

  4. При обострении болезни нужно ограничивать количество пищи вплоть до полного прекращения. Но голодание не должно быть дольше 1-2 дней, с приемом жидкости.

  5. При значительном улучшении состояния здоровья, при кажущемся благополучии не следует допускать резких нарушений, ни со стороны содержания диеты, ни со стороны режима.

  6. Противопоказаниями к диете с повышенным содержанием белка являются перенесенный инфаркт, тромбофлебит.

  7. Различные препараты йода и брома, а также слабительные — противопоказаны.

  8. Регулировать стул при запоре следует при помощи клизм. Противопоказана также при обострении горячая грелка, тепловые процедуры.

Источник: какая-то медицинская методичка без исходных данных.

Скан данной методички:

диета стол 5 какой хлеб лучше кушать

диета стол 5 какой хлеб лучше кушать

диета стол 5 какой хлеб лучше кушать

>>>ПЕРЕЙТИ НА ОФИЦИАЛЬНЫЙ САЙТ >>>

Что такое диета стол 5 какой хлеб лучше кушать?

Подписавшись на KetoPlan вы получаете индивидуальный план питания на 28 дней, простые рецепты для приготовления вкусных и сытных блюд, советы, как следовать диете и не сорваться.

Эффект от применения диета стол 5 какой хлеб лучше кушать

Диета КЕТОПЛАН мне понравилась, и я непременно к ней еще вернусь. Сейчас пришлось немного от нее отойти, потому что отпуск и решила побаловать себя немного вкусняшками на море. За два месяца, что прошли с момента, как я подписалась на КЕТОПЛАН, я похудела на 12 кг, это достаточно много, но меня еще столько лишних килограмм. Чувствую я себя прекрасно, легко. Сейчас стала по немного ходить в спорт зал. С КЕТОПЛАН худеть легко. Всем советую.

Мнение специалиста

Многие диетологи используют Кето диету для похудания людей, некоторые из них сами пользуются такими диетами, одна молодая девушка врач, сидит на такой диете и много публикует видео, где дает рекомендации и отвечает на вопросы зрителей, выкладывает фото своего рациона и выглядит очень хорошо. Я заинтересовалась и очень захотела стать стройной как этот диетолог. Она посоветовала подписку КЕТО-План, подписка платная, но 49 ру4блей – эт о полная ерунда в современном мире. После заполнения общих вопросов открывается доступ в личный кабинет, где все подробно расписано, согласно тем данным, которые я ввела. Сейчас говорят, что такая диета популярна во многих странах. Суть Кето-диеты заключается в употреблении большего количества жира по отношению к белку и неограниченном количестве клетчатки из зелени и овощей с низким гликемическим индексом. То есть нельзя есть помидоры и другие овощи не имеющим зеленой окраски. Огурцов можно есть неограниченное количество, а вот морковь нельзя. И естественно нельзя кушать каши, даже такие вроде бы полезные и не вызывающие ожирения гречневую кашу, на которой многие теряли вес.

Как заказать

Для того чтобы оформить заказ диета стол 5 какой хлеб лучше кушать необходимо оставить свои контактные данные на сайте. В течение 15 минут оператор свяжется с вами. Уточнит у вас все детали и мы отправим ваш заказ. Через 3-10 дней вы получите посылку и оплатите её при получении.

Отзывы покупателей:

Ника

Подписавшись на KetoPlan вы получаете индивидуальный план питания на 28 дней, простые рецепты для приготовления вкусных и сытных блюд, советы, как следовать диете и не сорваться.

София

Дневная диета от опытных диетологов разработана национальной медицинской ассоциацией Европы вместе с российскими учеными. В основе этой диеты лежат животные жиры и липиды. Благодаря такому питанию человек моментально сбрасывает до 1 килограмма за 1 неделю без физических нагрузок и диеты. Дополнительно улучшается работа пищеварительного тракта и снижается уровень сахара в крови.

Главным преимуществом диеты КЕТОПЛАН является универсальность и невысокая стоимость. Позаботиться о своем здоровье можно уже сегодня, а получить еду на каждый день легко всего за пару мгновений. Кетоплан – это здоровый подход к похудению и возможность быстро восстановить нормальную работу внутренних органов. Где купить диета стол 5 какой хлеб лучше кушать? Многие диетологи используют Кето диету для похудания людей, некоторые из них сами пользуются такими диетами, одна молодая девушка врач, сидит на такой диете и много публикует видео, где дает рекомендации и отвечает на вопросы зрителей, выкладывает фото своего рациона и выглядит очень хорошо. Я заинтересовалась и очень захотела стать стройной как этот диетолог. Она посоветовала подписку КЕТО-План, подписка платная, но 49 ру4блей – эт о полная ерунда в современном мире. После заполнения общих вопросов открывается доступ в личный кабинет, где все подробно расписано, согласно тем данным, которые я ввела. Сейчас говорят, что такая диета популярна во многих странах. Суть Кето-диеты заключается в употреблении большего количества жира по отношению к белку и неограниченном количестве клетчатки из зелени и овощей с низким гликемическим индексом. То есть нельзя есть помидоры и другие овощи не имеющим зеленой окраски. Огурцов можно есть неограниченное количество, а вот морковь нельзя. И естественно нельзя кушать каши, даже такие вроде бы полезные и не вызывающие ожирения гречневую кашу, на которой многие теряли вес.
Меню лечебной диеты №5 на неделю: рецепты приготовления диетических блюд. Таблица продуктов: что можно, а что нельзя. Рацион питания столов номер 5а, 5б и 5п.  . Пятый стол – система питания, которая состоит из списка блюд, режима, правил обработки продуктов. Может использоваться как у взрослых, так у детей. Основная его цель направлена на улучшение и восстановление работы печени и желчевыводящих путей. . Все хорошо взбить и выпекать в смазанной маслом форме до готовности. Ланч: сухой бисквит, фруктовый компот. Обед: суп с рисом и овощами, отдельно вареная курица. Диетический стол №5 по Певзнеру при острых и хронических заболеваниях печени, желчного пузыря и желчевыводящих путей: общие принципы, что можно и что нельзя есть, все дополнительные вариации лечебной диеты №5. . Диета №5: таблица продуктов, меню, принципы диеты. Диета 5 стол – это одна из специализированных методик лечебного питания, созданных доктором М. И. Певзнером. Она отлично подходит для людей, которые страдают от патологий печени, желчного пузыря и желчевыводящих путей вне стадии обострения. . Человек начинает чувствовать себя гораздо лучше, уже начиная с первых дней перехода на стол №5ГА. Добиться максимальных результатов можно при совместной работе с аллергологом. Диета 5 стол — это специальная лечебная диета, разработанная советским диетологом М. И. Певзнером. Считается одной из лучших диет для людей, страдающих от заболеваний печени, желчевыводящих путей и желчного пузыря. Показания к применению: острые гепатиты и холециститы в стадии выздоровления . Хлеб и мучные изделия. Хлеб пшеничный из муки 1-го и 2-го сорта, ржаной из сеяной и обдирной муки вчерашней выпечки. Выпечные несдобные изделия с вареным мясом и рыбой, творогом, яблоками. Печенье затяжное, сухой бисквит. Очень свежий хлеб, слоёное и сдобное тесто, жареные пирожки. Супы. Диета стол №5 рекомендована для питания как людей с заболеваниями печени и желчного пузыря, так и для общего оздоровления. По отзывам диетологов, она также дает эффект щадящего плавного похудения, принося устойчивые результаты. Меню на неделю поможет начать правильно питаться. ЛИДИЯ ЗАХАРОВА. Журналист КП. ДИЛАРА АХМЕТОВА. Диетолог-консультант, тренер по питанию. Что нужно знать о диете стол № 5. Что можно. Что нельзя. Хлебобулочные изделия. вчерашний хлеб; печенье (только галетное). блины и сегодняшний хлеб; слоеное и дрожжевое тесто. Сладости. . Стол номер 5а. Диета 5а является переходным моментом после диеты №4. Благодаря правильно подобранному рациону удается значительно уменьшить нагрузку на печень и максимально восстановить функциональность органа. Основное ее отличие заключается в особом приготовлении блюд. . Хотя они приносят такое же количество клетчатки, лучше не усложнять работу кишечника. Наиболее рекомендуемые овощи: цветная, белокочанная капуст Стол №5. Показания к применению. Лечебная диета №5 по Певзнеру рекомендуется людям в период выздоровления после острых гепатитов и холециститов, вне обострения хронического гепатита, при циррозе печени без её недостаточности, при хроническом холецистите и желчнокаменной болезни, когда нет обострения. Придерживаться этой диеты рекомендуется, если нет выраженных заболеваний кишечника и желудка. Диетический Стол номер 5А по Певзнеру назначается в остром периоде гепатита, холецистита и при обострении. . На пятый день вводят галетное печенье и подсушенный пшеничный хлеб. Через неделю с момента операции добавляют перетертые каши (гречневую, овсяную), отварное прокрученное мясо, творог, кисломолочные продукты и овощное пюре. С третьей недели больной переводится на Стол № 5А. . Растительное масло допускается при хорошей переносимости также в готовые блюда. Напитки: некрепкий чай с лимоном и молоком, некрепкий кофе с молоком, сладкие соки, настой шиповника, столовая вода без газа. Таблица разрешенных продуктов. Диетический стол № 5: меню и продукты. Специальные диеты. Рецепты Стола 5. . перепелок лучше есть в отварном виде. При удалении желчного пузыря диета Стол №5 показана пожизненно. Но понятно, что в определенные дни Вы можете давать себе послабление, но это при условии хорошего самочувствия и анализов. Даша Меньшикова. . Здравствуйте, скажите пожалуйста, не совсем понятно на счет хлеба, в списке указано что хлеб можно, но ведь его делают с дрожжами, везде в хлебе они в составе указаны, получается такой хлеб нельзя кушать? Остается только искать альтернативу в виде хлебцов, либо печь самим без дрожжевой хлеб? Арина. Диета №5 П является подтипом диеты №5 и предназначена для лиц, страдающих хроническим панкреатитом без осложнений или на стадии выздоровления. С какой целью назначается данная диета? . Также при хорошей переносимости супы приправляют небольшим количеством сметаны, укропа или петрушки. Исключают: супы, приготовленные на наваристых мясных, рыбных или грибных бульонах, зелёные щи, окрошку. . Мучные изделия: белый или ржаной хлеб вчерашней выпечки, сухой бисквит, несдобное печенье, макаронные изделия в отварном или запечённом виде, сухари без масла и специй. Также разрешается употребление выпечки из несдобного теста с добавлением мяса, рыбы, творога или яблок. Подобные изделия входят в перечень запрещенных при диете №5. Кто желает освежить в памяти список ненужных нашему организму продуктов, тому сюда. Мы возьмем либо подсушенный, либо вчерашний хлеб. Сухарики, хлебцы, слайсы, особенно, с добавлением цельнозерновых компонентов, тоже прекрасная база для будущего бутерброда. . суть диеты №5 здесь. Следующий ингредиент практически любого бутерброда – это масло. . Подавляющее большинство людей кушает не тогда, когда голодны, а когда приходит усталость, тревожность, за компанию, поднять себе настроение и так далее. Мир разнообразен и очень интересен не только вкусами еды! Все алкогольные напитки, свежие хлебобулочные изделия, изделия из сдобного теста (торты, блины, оладьи, жареные пирожки и т.д.), супы на мясных, рыбных, грибных бульонах, жирные сорта говядины, баранины, свинины, гуся, утку, жирные сорта рыбы (севрюга, осетрина, белуга, сом), грибы, шпинат, щавель, редис, редьку, лук зеленый, маринованные овощи, консервы, копчености, икру, мороженое, изделия с кремом, шоколад, бобовые, горчицу, перец, хрен, черный кофе, какао, холодные напитки, кулинарные жиры, сало, клюкву, кислые фрукты и ягоды, яйца вкрутую и жареные. Скачать и распечатать: Диета №5. Записаться на прием. Не занимайтесь самолечением. Разбираемся, что такое Диетический стол № 5, и делимся полезными рецептами. Зачем и для кого. Стол № 5 для людей, страдающих от заболеваний печени, желчевыводящих путей и желчного пузыря, разработал доктор М. И. Певзнер. . Цель пятой диеты – щадящее питание, помогающее восстанавливаться печени, желчному пузырю и желчевыводящим путям. О рационе. . Затем отвар сцедить. Белый хлеб подсушить в духовке, измельчить через мясорубку. Муку подсушить на сковороде без масла до желтоватого оттенка, развести овощным отваром, прокипятить пять минут на слабом огне, добавить сметану, довести до кипения и снять с огня. Филе трески положить на смазанный маслом противень, посыпать измельченными гренками. Кому рекомендована лечебная диета Стол номер 5, какие блюда можно есть, а какие под запретом — узнаете из этой статьи. . Считается одной из лучших диет для людей, страдающих от заболеваний печени, желчевыводящих путей и желчного пузыря. В статье разберем основные принципы рациона диеты №5 и рассмотрим примерное меню данной диеты. Общими принципами лечебных диет, в том числе и диеты номер 5, являются: баланс основных пищевых веществ (белков, жиров и углеводов), дробный режим питания, уменьшение количества поваренной соли и тугоплавких жиров, обильное потребление жидкости и щадящие способы приготовления пищи — отваривание, варка на пару, запекание. Диета № 5 отличается повышенным содержанием белка и большим количеством паровых блюд. Поэтому, если в семье есть больной панкреатитом, то лучше приобрести пароварку. Кстати, на ней можно готовить вкусные и полезные для здоровья блюда для всех членов семьи. В период приступа болезни рекомендуется впервые дни вообще отказаться от еды и ограничиться лишь питьём воды и слабого отвара шиповника.
http://gtstv.ru/images/userfiles/pokhudenie_pitanie_fizicheskie_nagruzki2114.xml
http://minhnguyenvn.com/uploads/userfiles/plan_pitaniia_26634.xml
https://www.scientia.org.pl/fotki/fotki/file/plan_pitaniia_na_1500_kalorii4670.xml
http://www.dailitara.lt/bites/uploads/chistoe_pitanie_dlia_pokhudeniia_spisok_produktov_tablitsa6397.xml
http://amgad-hendy.com/userfiles/samaia_luchshaia_effektivnaia_dieta_bez_sporta3218.xml
Диета КЕТОПЛАН мне понравилась, и я непременно к ней еще вернусь. Сейчас пришлось немного от нее отойти, потому что отпуск и решила побаловать себя немного вкусняшками на море. За два месяца, что прошли с момента, как я подписалась на КЕТОПЛАН, я похудела на 12 кг, это достаточно много, но меня еще столько лишних килограмм. Чувствую я себя прекрасно, легко. Сейчас стала по немного ходить в спорт зал. С КЕТОПЛАН худеть легко. Всем советую.
диета стол 5 какой хлеб лучше кушать
Подписавшись на KetoPlan вы получаете индивидуальный план питания на 28 дней, простые рецепты для приготовления вкусных и сытных блюд, советы, как следовать диете и не сорваться.
Диеты для похудения – самая популярная разновидность существующих диет. В современном мире эталоном красоты является стройность, добиться которой возможно далеко не при любом рационе питания. Мода на стройность диктует большую востребованность различных диет для похудения. В разное время популярными становились низкоуглеводные, белковые, кефирные, луковые, японские, французские, кремлевские, китайские и многие другие диеты. Какая диета подходит именно для вас? Какой можно пользоваться постоянно, а какую использовать только как экстренную, скорую помощь для того, чтобы похудеть на 3-4 кг за пару дней? Какие противопоказания есть у каждой диеты? Самая эффективная диета для быстрого похудения: подборка лучших систем и методик с описанием, правилами, достоинствами, возможными трудностями и противопоказаниями. Самая эффективная диета для похудения в домашних условиях. Решив похудеть, женщины пересматривают свой рацион. . Мы собрали самые популярные режимы питания, помогающие избавиться от 5-10 избыточных килограммов. Но соблюдайте разумную осторожность! У резкого ограничения рациона могут быть побочные эффекты. ТОП-5 самых эффективных диет. Наиболее простой и быстрый способ сбросить несколько килограммов в домашних условиях – это монодиеты. Диета для похудения должна быть сбалансированной и содержать необходимое количество белков, жиров и углеводов. . Прежде, чем выбрать диету для похудения следует обратиться к врачу для того, чтобы проверить свое здоровье, сдать все необходимые анализы и исключить наличие каких-либо противопоказаний. При наличии хронических заболеваний, например, гастрита, колита, панкреатиты и других диета может вызвать их обострение. 10 наиболее эффективных диет для быстрого похудения. Лучшие диеты для быстрого похудения. Диет для похудения существует множество, но далеко не все из них помогают не только быстро сбросить вес, но и сделать это без вреда для организма. Диетологи выделяют 10 эффективных диет для быстрого похудения, имеющие разные принципы: на 10 дней; на луковом супе Но очень низкокалорийная диета хорошо работает краткосрочно, в начале похудения и не имеет никаких преимуществ в долгосрочном похудении (от года и более). Как долго можно находиться на этой диете? В клинической практике врачи используют 8-12 недель, что обычно приводит к потере 1.5-2.5 кг в неделю. Суть медицинских диет. Виды диет для снижения веса. 12 отличных диет для похудения. Еще 12 популярных в мире диет. . Лучше всего проявлять индивидуальный подход, когда высчитывают норму потребления калорий (и, конечно, жиров, белков и углеводов) в сутки. Кроме того, важно принимать во внимание, насколько активный образ жизни ведет человек, как меняется его вес в процессе диеты (и соответственно корректировать калорийность рациона), включать в меню все важные для здоровья нутриенты. . За месяц позволяет сбросить 10–20 кг. Два самых эффективных варианта данного типа диет — творожная и яичная. Выбирайте сами, что вам по вкусу или приемлемее по состоянию здоровья. Белковые диеты. Самая известная диета этой группы – это, несомненно, диета доктора Пьера Дюкана. Решая, какую диету выбрать для похудения, многие наши женщины отдают предпочтение именно ей. И не случайно, ведь она даёт реальные результаты. . Думаете, какую диету выбрать для похудения, и точно знаете, что монодиеты не для вас? Диета Протасова подойдёт всем, кто стремится к здоровому образу жизни и готов поработать над этим. Яичная диета. . Какую диету лучше выбрать, если необходимо убрать лишь пару лишних килограммов? Лучше выбрать программу с недельным или двухнедельным курсом. Только не используйте быстрые диеты за три дня. Самый простой и эффективный способ адекватно оценить свой обычный рацион – ведение пищевого дневника в течении 2 недель. В нём должны быть отражены: время приёма пищи . Ходьба ежедневно в течение 30 мин. Одним из лучших видов активности для похудения является интервальная ходьба — 2-3 мин. в привычном темпе, затем 2- 3 мин. ускорения после чего темп замедлить и перейти на обычный темп (2-3 мин.). Или бег в течение 15 мин. Спортивные игры в течение 45 мин. (волейбол, баскетбол, футбол и др.) Пять раз в неделю в течение 1-1,5 часов – плавание, шейпинг, аэробика, теннис и др. Занятия в тренажёрном зале с отягощениями, для наращивания мышечной массы. Постоянно сидеть на диетах, периодически устраивая праздники живота, невозможно. Несоблюдение принципов правильного пищевого поведения приводит к проблемам со здоровьем. . Средства для похудения в домашних условиях. Массажеры для похудения. Пояса для похудения. . Созвездие красоты»Созвездие Красоты» – это сеть магазинов в лучших торговых центрах России.

Диета 5П — диета

0,7к —

при хроническом панкреатите в стадии выздоровления (вне обострения или после него) назначается диета 5П. Как этот план еды?

Цель диеты

Лечебное питание способствует восстановлению функций поджелудочной железы. Диета защищает от механического и химического раздражения стенок желудочно-кишечного тракта, предотвращает жировую инфильтрацию, способствует нормализации деятельности желчного пузыря.

Характеристики диеты

Данная диета характеризуется повышенным выделением белка при снижении доли эфирных масел, жиров (преимущественно тугоплавких), углеводов, пуринов, экстрактивных веществ, холестерина и сырой клетчатки.

Изделия запеченные (корочки не должно быть), приготовленные на пару или отварные. Еду подают предварительно нарезанной или обтертой. Все жареное, холодное и горячее исключает. Больные должны есть 5-6 раз в день.

распределение по химическому составу следующее:
• расход жидкости – 1.5 литров в сутки (без учета первых блюд)
• норма соли — 10 г в сутки
• норма углеводов — 300-350 г (30-40 г сахара)
• норма жиров — 70-80 г (из них 75 -80% — животного происхождения)
• Норма белка 100-120 г (из них 60-65 % — животного происхождения)
• Оптимальная калорийность — 2500-2600 ккал

Диетическое питание

Мука
• Рекомендовано: крекеры, вчерашний или подсушенный пшеничный хлеб, несладкие бисквиты.
• Запрещены: торты из сдобного и слоеного теста, свежий хлеб и хлеб из ржаной муки.

Супы
• Рекомендуются: вегетарианские супы с морковью, картофелем, тыквой, кабачками, овсянкой, манной и гречневой кашей, вермишелью, рисом (в каждую порцию можно добавить 10 г нежирной сметаны или 5 г масла).
• запрещены: супы, молочно-рыбные, грибные, мясные бульоны, а также супы с пшеном, борщи, холодные супы, ухи.

Мясо
• Рекомендуется: говядина, кролик, телятина, курица и индейка.
• Запрещено: утка и гусь, жирное мясо.Исключаются колбаса, копчености, консервы, мозги, печень, почки.

Рыба
• Рекомендовано: рыба с низким содержанием жира (подается куском, отварная или в виде котлет). Можно приготовить холодец из рыбы, предварительно его отварив.
• табу: рыба жареная, копченая, тушеная, соленая, рыба жирная, а также рыбные консервы и икра.

Молоко
• Рекомендуются: свежий кислый творог, обезжиренный кальцинированный творог в натуральном виде, запеченный и паровой чизкейк с зеленым чаем. Молоко вводят в рацион для нормальной переносимости.Допустимый и нежирный мягкий сыр, молочные напитки, сметана и сливки (небольшое количество).
• Запрещены: молочные продукты повышенной жирности, подслащенные молочные продукты.

Яйца
• Рекомендовано: не более чем в 2 раза больше белка и половины желтка в день (белковые омлеты, приготовленные или добавленные в блюда).
• Запрещены: блюда с добавлением целых яиц, яиц, сваренных вкрутую или жареных на жире.

Крупы
• Рекомендуются: половецкие протертые каши из овсяной, гречневой, манной и рисовой муки (варятся на воде или разбавленном молоке).Допустимо готовить крупяные пудинги, суфле, запеканки.
• Запрещено: хрустящие хлопья (не рекомендуется есть перловку, перловку, кукурузу и просо).

Овощи
• Рекомендуются: запеченные, вареные, протертые овощи (морковь, картофель, свекла, цветная капуста, тыква, кабачки, зеленый горошек).
• Запрещены: репа, баклажаны, капуста, редис, редька, чеснок, лук, шпинат, щавель, перец сладкий, грибы.

Соусы
• Рекомендуются: полусладкие молочные, фруктово-ягодные подливы, соусы на слабом овощном бульоне.
• Запрещены: соусы к рыбным, грибным, мясным бульонам, соусы с томатами и специями.

Напитки
• Рекомендуются: сладкий некрепкий чай с долькой лимона или нежирным молоком, отвар шиповника, ягодные и несладкие фруктовые соки, разбавленные водой.
• запрещены: какао, кофе, виноградный сок, холодные и газированные напитки.

Жиры
• Рекомендуются: сливочное масло (около 30 г в день) и рафинированное растительное масло (около 15 г в день).
• запрещены: любые другие жиры.

отзывов

Диета 5П – план лечебного питания.Судя по отзывам, отсутствие грубой, жирной и мучной пищи обеспечивает стойкое улучшение состояния больного.

МикроРНК-410-5p усугубляет эндокринное ремоделирование сердца у мышей, вызванное диетой с высоким содержанием жиров

Животные Центр животных Куньминского медицинского университета (город Куньмин, Юньнань, Китай).

Этих животных содержали при постоянной температуре 20–22 °C с 12-часовым циклом свет/темнота.Все процедуры с животными соответствуют Руководству по уходу и использованию лабораторных животных, опубликованному Национальным институтом здравоохранения США (публикация NIH № 8523, пересмотренная в 1985 г.). Исследование было одобрено Комитетом по уходу и использованию животных Анженьской больницы Столичного медицинского университета. Весь экспериментальный протокол, включая любые соответствующие детали, был одобрен Комитетом по уходу и использованию животных больницы Аньчжэнь Столичного медицинского университета. Методы проводились в соответствии с утвержденными методическими рекомендациями.

Крыс случайным образом разделили на две группы по 15 крыс в каждой. Группа А служила контрольной группой и содержалась на обычном рационе крысиного корма (степень защиты SPF-03; Keaoxieli Food Company, Пекин, Китай) на протяжении всего эксперимента (24 недели). Нормальная диета в нашем исследовании состояла из 26% белков, 57% углеводов и 5% жиров. Крыс в группах B кормили HFD, содержащим 60% основного рациона, 20% свиного жира, 15% рафинированного сахара, 1,5% холестерина, 0,1% холата натрия, 3,4% арахиса на протяжении всего эксперимента (24 недели).Диета состояла из 15,6% белков, 49,2% углеводов и 24,5% жиров.

Крысы были умерщвлены в конце эксперимента. Собирали сыворотку и органы, включая сердце, печень, почки, жировую ткань и мышцы. Часть тканей, в том числе сердце, быстро замораживали при -80 °С для дальнейшего использования. Оставшуюся часть сердца использовали для гистологического исследования.

Гистопатологическое исследование

Были взяты свежие образцы сердца. Все образцы фиксировали в 4% параформальдегиде, заливали в парафин, окрашивали гематоксилином и эозином (ГЭ) или трихромом Массона.Срезы исследовали под световым микроскопом и фотографировали цифровым фотоаппаратом (Olympus). Кроме того, использовалась система анализа цветных изображений (ImageJ) для расчета отношения площади фиброза ко всей площади.

Измерение биохимических показателей сыворотки

Уровни АЛТ, АСТ, ХОЛ, ФХОЛ, ЛПНП-ЛПВП и ТГ в сыворотке определяли на автоматизированном биохимическом анализаторе (Hitachi 7060, Япония).

Выделение экзосом

Экзосомы из сыворотки выделяли и очищали с помощью ExoQuick™-TC Exosome Precipitation Solution (SBI, Mountain View, CA) в соответствии с инструкциями производителя.Вкратце, сыворотку (500 мкл) центрифугировали при 3000×g в течение 15 минут для удаления клеток и клеточного детрита. Супернатант переносили в стерильную пробирку и инкубировали со 126 мкл раствора для осаждения экзосом ExoQuick™ в течение ночи при 4°C. После центрифугирования при 1500×g в течение 30 мин надосадочную жидкость осторожно удаляли аспирацией. Экзосомы появлялись в виде белого шарика на дне пробирки. Осадок экзосом ресуспендировали в 1/10 исходного объема с использованием стерильного PBS.

Количественная ОТ-ПЦР в режиме реального времени (кПЦР)

Для измерения уровней мРНК общую РНК из образцов тканей выделяли с использованием набора RNAprep Pure Tissue (Tiangen, Пекин, Китай) в соответствии с инструкциями производителя. кДНК со случайным праймированием получали путем обратной транскрипции тотальной РНК с помощью TIANScript M-MLV (Tiangen). ПЦР-анализ в реальном времени выполняли с помощью системы обнаружения последовательностей ABI Prism 7000 (Applied Biosystems) с использованием SYBR® Premix-Ex TagTM (Takara, Dalian, Chnia). GAPDH использовали для внутреннего контроля. Последовательности праймеров для этих мРНК перечислены в таблице S2.

Зрелые микроРНК из образцов тканей, сыворотки и экзосом экстрагировали с использованием набора для выделения микроРНК miRcute (Tiangen). Пре-миРНК из образцов тканей экстрагировали с использованием набора RNAprep Pure Tissue (Tiangen).Модификацию поли(А) и синтез первой цепи кДНК проводили с помощью набора для синтеза первой цепи кДНК miRcute miRNA (Tiangen). Анализ qRT-PCR для зрелой микроРНК проводили с использованием набора для обнаружения qRCR miRcute miRNA (Tiangen). Для измерения уровней miRNA или pre-miRNA в образцах тканей в качестве внутреннего контроля использовали 18S рРНК. Уровни миРНК в сыворотке и экзосомах определяли с использованием абсолютной количественной ОТ-ПЦР в реальном времени, описанной ранее 40 . Последовательности праймеров для этих миРНК перечислены в таблице S2.

Вестерн-блоттинг

После гомогенизации тканей в жидком азоте гомогенат лизировали на льду в течение 30 мин в лизирующем буфере (BioTeKe, Пекин, Китай). Лизаты (20–40 мкг) общего белка наносили на лунку и разделяли на 10% SDS-полиакриламидном геле. Первичными антителами были антитела против CTGF (разведение 1:5000, Abcam, Шанхай, Китай), антитела против коллагена-II (разведение 1:5000, Abcam), антитела против коллагена-IV (разведение 1:5000, Abcam), антитела против Smad. 2/3 (разведение 1:1000, Cell Signaling Technology, Бостон, Массачусетс), анти-Smad 7 (разведение 1:1000, Santa Cruz Biotech, Санта-Крус, Калифорния), анти-p-Smad2 (разведение 1:1000, Cell Signaling Technology) и антиактиновые антитела (разведение 1:5000, Santa Cruz Biotech).Вторичное антитело представляло собой связанный с пероксидазой антикозий IgG (GE Healthcare). Мембрану подвергали воздействию ECL Hyperfilm (GE Healthcare), и пленку проявляли. Полосы были количественно оценены денситометрией с использованием ImageJ. Результаты были получены из трех повторных экспериментов.

Функциональная оценка с помощью эхокардиографии

Крысы, получавшие HFD в течение 24 недель, и контрольные крысы того же возраста (n = 6 в каждом эксперименте) подвергались трансторакальной эхокардиографии под анестезией (пентобарбитал натрия, 60 мг/кг внутрибрюшинно) в положении лежа на спине.Процедуру выполнял опытный оператор, слепой к лечебному назначению, на УЗИ-аппарате VisualSonics Samsung accuvix A30 (Bothell, США) с ультразвуковым датчиком Medison A30-1. Конечно-диастолический диаметр левого желудочка (КДРЛЖ) измеряли в стандартном двумерном М-режиме (2DE) длинноосевой парастернальной проекции как расстояние между межжелудочковой перегородкой и задней стенкой ЛЖ в момент ЭДЛЖ (наибольший диаметр). Кроме того, измеряли конечно-систолический диаметр левого желудочка (КСДРЛЖ) как расстояние между межжелудочковой перегородкой (МЖП) и задней стенкой ЛЖ (ЗС) в момент проведения КСЛЖ (наименьший диаметр). Фракция выброса ЛЖ (ФВ) и фракционное укорочение, индексы общей систолической функции, рассчитывались как: ФВ = ((КДОЛЖ - КСО ЛЖ)/КДОЛЖ × 100, где КДОЛЖ — конечно-диастолический объем ЛЖ, а ООКДЛ — конечно-систолический объем ЛЖ. ; и фракционное укорочение = ((LVEDD - LVESD)/LVEDD) × 100. Bio-tech Incorporation (Шанхай, Китай) для микрочипов микроРНК.Вкратце, микроРНК из образцов сердца экстрагировали с использованием мини-набора miRNeasy (QIAGEN, Майнц, Германия). После прохождения измерения количества РНК с помощью NanoDrop 1000 образцы были помечены с помощью комплекта для мечения miRCURY™ Hy3™/Hy5™ Power и гибридизированы на массиве miRCURY™ LNA Array (v.18.0). После этапов промывки предметные стекла сканировали с использованием микрочипового сканера Axon GenePix 4000B (Molecular Devices, Sunnyvale, CA). Затем отсканированные изображения были импортированы в программное обеспечение GenePix Pro 6.0 (Axon) для выравнивания по сетке и извлечения данных.Реплицированные микроРНК были усреднены, и для расчета коэффициента нормализации были выбраны микроРНК с интенсивностью > = 30 во всех образцах. Наборы данных микрочипов представлены в таблице S1. миРНК с двукратным или более кратным изменением и значением P -значение < 0,05 считали дифференциально экспрессированными.

Культура клеток

Клетки H9c2 (подарок доктора Ди Лу, Куньминский медицинский университет) выращивали в модифицированной среде Игла Дульбекко (Hyclone, Logan, UT) с добавлением 10% эмбриональной бычьей сыворотки (FBS, Hyclone).При конфлюэнтности 60–80% клетки трансфицировали с использованием реагента Lipofectamine 2000® (Thermo Fisher Scientific, Waltham, MA) с 0,25 мкг отрицательного контроля или имитаторов rno-miR-410-5p: 5′-Agguugucugugaguucg-3′, меченный с 2′-оме (получен от GenePharma Company, Шанхай, Китай). Клетки собирали через 48 ч после трансфекции, уровни белков фиброзных генов определяли вестерн-блоттингом.

Анализ люциферазы

Для конструирования репортерных векторов, несущих сайты связывания миРНК, последовательность 3′-нетранслируемой области (3’UTR) Smad 7 амплифицировали из геномной ДНК с помощью ПЦР и вставляли во множественные сайты клонирования ниже по течению от ген люциферазы в репортерном векторе экспрессии миРНК люциферазы psiCHECKTM-2 (Promega, Пекин, Китай). Клетки H9c2 культивировали в 24-луночных планшетах и ​​трансфицировали с использованием реагента Lipofectamine 2000® (Thermo Fisher Scientific) с 0,25 мкг вектора, а также миметиков rno-miR-410-5p. Клетки собирали через 48 ч после трансфекции. Активность люциферазы определяли с использованием набора для репортерного анализа Dual-Luciferase (Promega) на флуоресцентном ридере для микропланшетов (Molecular Devices). Результаты были нормализованы относительно контроля люциферазы рениллы.

Конструирование лентивирусных векторов, производство лентивирусов и инъекции

Лентивирусные векторы, экспрессирующие pre-miR-410 и miR-410-5p antimiR, были получены от GenePharma Co.(Шанхай, Китай). Вкратце, пре-миР-410 (5′-ACTTGAGGAGAGGTTGTCTGTGATGAGTTCGCTTT ATTAATGACGAATA TAACACAGATGGCCTGTTTTCAATACC-3′) встраивали в лентивирусный вектор PGLV3/h2/GFP + Puor (PGLV3), в результате чего был получен вектор PGLV3-pre-miR-410. miR-410-5p antimiR (5′-CGAACUCAUCAGAGACAACC-3′) встраивали в лентивирусный вектор PGLV3/h2/GFP + Puor (PGLV3), в результате чего получали вектор PGLV3-miR-410-5p antimiR. В качестве отрицательного контроля фрагмент ДНК (5′-TTCTCCGAACGTGTCACGT-3′) встраивали в вектор PGLV3/h2/GFP + Puor, в результате чего был получен вектор PGLV3-NC.

Крыс заражали частицами лентивируса, содержащими PGLV3-miR-410 или PGLV3-miR-410-5p antimiR, или PGLV3-NC совместно трансфицировали тремя другими хелперными плазмидами (PG-P1-Gag-VSVG, PG-P2- REV и PG-P3-RRE) в эмбриональные почечные клетки 293 Т-клеток. Супернатант собирали через 48 часов после трансфекции и добавляли свежую среду в культуральный флакон. Клетки культивировали еще 24 часа. Затем снова собирали супернатант. Супернатанты, содержащие вирусный вектор, собранные через 48 и 72 часа, смешивали.Смесь центрифугировали при 3000 об/мин в течение 15 мин при 4°С. Затем жидкость фильтровали через фильтрующую мембрану 0,45 мм. Полученный вирус хранили при температуре -80 °C до использования. Титры векторов PGLV3-miR-410 или PGLV3-NC составляли 1 × 10 9 единиц переноса (ТЕ/мл).

Двенадцатинедельных крыс, которых кормили стандартным лабораторным кормом, заражали 1 × 10 8 ТЕ лентивирусных частиц, содержащих пустой вектор PGLV3 или вектор, экспрессирующий pre-miR-410, посредством инъекции в хвостовую вену. Инъекцию этих лентивирусных частиц дважды повторяли крысам в течение следующих двух недель.Крыс умерщвляли на 21-й день после первой инъекции для сбора образцов сердца.

Крысам, получавшим HFD в течение 21 недели, вводили 1 × 10 8 ТЕ лентивирусных частиц, содержащих PGLV3-miR-410-5p antimiR или PGLV3-NC, через инъекцию в хвостовую вену. Инъекцию этих лентивирусных частиц повторяли дважды в течение следующих двух недель крысам, получавшим HFD. Крыс умерщвляли на 21-й день после первой инъекции для сбора образцов сердца.

Конструирование аденовирусных векторов, продукция аденовируса и инъекция

Аденовирусные векторы для специфичной для адипоцитов или почек сверхэкспрессии pre-miR-410 были получены от Cyagen Co.(Гуанчжоу, Гуандун, Китай). Для сверхэкспрессии, специфичной для адипоцитов, пре-миР-410 встраивали в аденовирусный вектор pAV[Exp]-aP2 > EGFP, содержащий промотор специфичного для адипоцитов гена aP2/FABP4, в результате чего был получен вектор pAV[Exp]-aP2 > EGFP: {рмиР-410}. Для почечно-специфической сверхэкспрессии пре-миР-410 встраивали в аденовирусный вектор pAAV[Exp]-NPHS2 > EGFP, содержащий промотор почечно-специфического гена NPHS2/Podocin, в результате чего был получен вектор pAV[Exp]-NPHS2 > EGFP: {rmiR-410}.Подробную информацию об аденовирусных векторах можно найти на https://en.vectorbuilder.com/vector/VB171102-1059rjs.html и https://en.vectorbuilder.com/vector/VB171103-1023hst.html.

Эти челночные плазмиды котрансфицировали в клетки эмбриональной почки человека HEK-293T 293A с плазмидой AAV-DJ/8 (Cell Biolabs Inc., Сан-Диего, Калифорния) и плазмидой pHelper (Cell Biolabs) для упаковки вируса. Клетки и среду собирали после того, как цитопатический эффект стал очевидным. После трех циклов замораживания и оттаивания для высвобождения вируса клеточный дебрис отбрасывали центрифугированием при 3000 g ×10 мин.Вируссодержащий супернатант очищали с помощью центрифугирования в градиенте плотности CsCl с последующим диализом против физиологического раствора. Титрование вируса определяли и доводили до 1 × 10 10  БОЕ/мл.

Крыс, получавших обычный рацион, заражали 5 × 10 8 ТЕ аденовирусных частиц, содержащих пустой вектор или вектор, экспрессирующий пре-миР-410, посредством инъекции в хвостовую вену. Инъекцию этих вирусных частиц повторяли дважды в течение следующих двух недель крысам, получавшим обычную диету. Крыс умерщвляли на 21-й день после первой инъекции для сбора образцов сердца.

Статистический анализ

Данные экспериментов выражены как среднее  ± SD трех независимых экспериментов. Статистические различия между двумя группами анализировали с использованием t-критерия Стьюдента. Значения P  < 0,05 считались статистически значимыми.

Границы | Ингибирование микроРНК-122-5p улучшает повреждение воспаления и окислительного стресса при вызванной диетой неалкогольной жировой болезни печени за счет нацеливания на FOXO3

Введение

Неалкогольная жировая болезнь печени (НАЖБП) считается хроническим прогрессирующим заболеванием печени, которое начинается с простого стеатоза печени и прогрессирует до неалкогольного стеатогепатита, цирроза и даже рака печени (Chiang et al. , 2011). Печень является одним из основных органов действия инсулина, поэтому резистентность к инсулину играет ключевую роль в прогрессировании НАЖБП, что приводит к усилению печеночного липогенеза и последующему накоплению жирных кислот в печени (Ota et al., 2007; Bugianesi et al., 2010; Kitade et al., 2017). Соответственно, стеатоз печени может вызывать воспалительную реакцию и повреждение окислительного стресса, тем самым способствуя патогенезу инсулинорезистентности печени (Gawrieh et al., 2004; Di Nunzio et al., 2010). Таким образом, инсулинорезистентность переплетается с НАЖБП.

Многие неправильно регулируемые микроРНК (миРНК) в печени были идентифицированы у пациентов и моделей мышиного ожирения, вызванного диетой, с тяжелой НАЖБП. Некоторые недавние исследования продемонстрировали потенциальную роль микроРНК в патогенезе НАЖБП и резистентности к инсулину (Cheng et al., 2016; Nie et al., 2017; Zhu et al., 2017). Связывание микроРНК с 3′-нетранслируемой областью (3′-UTR) мРНК, специфичных для мишени, может привести к подавлению трансляции или расщеплению матричной РНК (мРНК) (Shukla et al. , 2011). МиР-122 является одной из наиболее распространенных специфичных для печени миРНК и существует в двух зрелых изоформах: миР-122-3p и миР-122-5p. Подавление миР-122 часто коррелирует с гепатоканцерогенезом, а миР-122 также необходима для пролиферации и репликации вируса гепатита С, поэтому антисмысловые стратегии, нацеленные на миР-122, считаются потенциальным терапевтическим подходом для лечения гепатоцеллюлярной карциномы, гепатита C и, возможно, другие заболевания (Filipowicz and Grosshans, 2011; Thomas and Deiters, 2013).Поскольку наиболее распространенные микроРНК специфически экспрессируются в печени, широко известно, что miR-122-5p участвует в регуляции метаболизма липидов и холестерина, а также в пролиферации и дифференцировке гепатоцитов (Raitoharju et al., 2016). Недавние исследования показали, что пациенты с ожирением и НАЖБП демонстрируют более высокую экспрессию miR-122-5p в печени (Akuta et al., 2016; Latorre et al., 2017). Другое исследование также показало, что уровень циркулирующей миР-122-5p в сыворотке индуцируется у крыс с НАЖБП, индуцированной диетой с высоким содержанием жиров (HFD) (Yamada et al. , 2015). Наше предыдущее исследование показало, что замалчивание miR-122-5p облегчает накопление липидов и воспаление в клетках L02, индуцированное олеиновой кислотой, путем ингибирования сигнального пути p65 TLR4/MyD88/NF-κB (Hu et al., 2019). Однако функция miR-122-5p при НАЖБП неясна.

Являясь ключевым регулятором сигнального пути инсулина/инсулиноподобного фактора роста 1 (IGF1), транскрипционные факторы forkhead box O (FOXO) играют жизненно важную роль в регулировании гомеостаза глюкозы, триглицеридов и холестерина (Dong, 2017) .В недавнем исследовании сообщалось, что миР-122-5p действует как защитный фактор при ишемическом инсульте путем нацеливания на FOXO3 для регуляции HSP-70-опосредованного пути NF-κB in vivo и in vitro (Guo et al., 2018). ). Как одна из многочисленных потенциальных мишеней miR-122-5p, FOXO3, как сообщается, участвует в регуляции метаболизма липидов, воспалительной реакции и фиброза при развитии НАЖБП (Dong, 2017). Таким образом, нацеливание на FOXO3 является потенциальным терапевтическим подходом к НАЖБП.

Мы продемонстрировали, что миР-122-5p является важным медиатором стеатоза печени в культивируемых гепатоцитах и ​​модели НАЖБП у мышей, индуцированной HFD. Наши результаты также продемонстрировали, что ингибирование миР-122-5p в печени ослабляет воспаление, вызванное накоплением липидов в печени, и повреждение окислительного стресса за счет усиления FOXO3.

Материалы и методы

Реагенты

Среда и расходные материалы для культивирования клеток и пальмитиновая кислота (PA) были приобретены у Invitrogen (Шанхай, Китай).Были приобретены миметик miR-122-5p, миметик отрицательного контроля miRNA (миметик NC), а также лентивирус, кодирующий miR-122-специфические антисмысловые ингибиторы miRNA (ингибитор miR-122-5p), ингибитор NC и миРНК FOXO3 (siFOXO3). от Термо Фишер Сайентифик.

Эксперименты на животных

Компания Chengdu Dashuo Experimental Animal Co. Ltd. (Чэнду, Сычуань, Китай; сертификат № SCXK201302) предоставила в общей сложности 48 самцов мышей C57BL/6J в возрасте 8 недель. Все животные содержались при постоянной комнатной температуре с циклом свет-темнота 12:12 ч и имели свободный доступ к воде и пище.Из них 36 мышей кормили HFD (SLAC Animal Laboratories, Шанхай, Китай) в течение 8 недель, обеспечивающим 16% калорий за счет белков, 25% за счет углеводов и 59% за счет жиров, а 12 мышей получали стандартный корм. диета (12% жиров, 29% белков и 59% углеводов). После 8 недель кормления четырех мышей умерщвляли для подтверждения стеатоза печени и уровней миР-122-5p в рационе HFD и чау-чау, соответственно. Затем из оставшихся мышей, получавших HFD, случайным образом отобрали 24 мыши и разделили на три группы (по восемь мышей в каждой группе).Одну группу лечили 50 мкг 1 × 10 10 МЕ/мл контрольного лентивируса (группа HFD + ингибитор NC), а другую группу лечили 50 мкг 1 × 10 10 МЕ/мл miR-122- Антисмысловой лентивирус 5p (группа ингибиторов HFD + miR-122-5p) путем внутривенной инъекции в хвост. Другой группе мышей вводили 50 мкг 1 × 10 10 МЕ/мл антисмыслового лентивируса miR-122-5p и 20 мкл 1 × 10 9 ТЕ/мл siFOXO3, покрытого лентивирусом (HFD + miR-122-5p). ингибитор 5p + группа siFOXO3).Через 4 недели после инъекции лентивируса мышей умерщвляли для проверки эффективности инфекции путем измерения уровней miR-122-5p в печени. Все процедуры на животных проводились с одобрения Комитета по политике и благополучию животных Южного медицинского университета (разрешение № 2019DR00121).

Гистопатология печени

Ткани печени фиксировали в 4% параформальдегиде в течение 24 ч и заливали в парафин. Готовили парафиновые срезы тканей печени (5 мкм) и окрашивали гематоксилином и эозином (H&E), а замороженные срезы ткани печени (8 мкм) окрашивали Oil Red O (Sigma-Aldrich).Предметные стекла монтировали и наблюдали за гистологическими изменениями под световым микроскопом (Olympus, Япония).

Культура клеток

Линия нормальных клеток печени человека HL-7702 (L02) была получена из Китайской академии наук и поддерживалась в среде RPMI-1640 (Thermo Fisher Scientific, Inc.), содержащей 10% эмбриональной бычьей сыворотки (FBS) (Gibco, Unted США) при 37°С во влажной камере с 5% СО 2 . Клетки стимулировали указанными дозами ПА. Планшеты с культурами клеток промывали фосфатно-солевым буфером (PBS) и фиксировали в 10% нейтральном формалине, а затем окрашивали 0.18% раствора Oil Red O (Sigma-Aldrich) в течение 30 мин. Для исследования клеточной культуры эксперименты проводили в двух экземплярах и повторяли три раза. Уровни внутриклеточных триглицеридов (ТГ) и общего холестерина (ОХ) в клетках L02 измеряли и нормализовали к содержанию в них белка с использованием коммерческих наборов для анализа (Applygen Technologies Inc., Китай) в соответствии с инструкциями производителя.

Трансфекция микроРНК и малых интерферирующих РНК

Ингибитор miR-122-5p с его антисмысловой или бессмысленной контрольной лентивирусной плазмидой был сконструирован с использованием синтетического олигонуклеотида, содержащего сайты связывания miR-122-5p или бессмысленную последовательность.Клетки L02 котрансфицировали соответствующими лентивирусными векторными конструкциями и лентивирусной смесью (ингибитор miR-122-5p и контрольный лентивирус, Thermo Scientific). Через 72 ч после трансфекции среду собирали и концентрировали с использованием преципитации полиэтиленгликолем 6000 (Sigma). Титр определяли, используя частоту GFP-положительных клеток L02.

Репортерный анализ люциферазы

Сегменты последовательности с диким типом (WT) и мутантной (Mut) исходной областью FOXO3 были клонированы с использованием плазмиды pGL3-Promoter Vector luciferase (Promega, Мэдисон, Висконсин, США) между сайтами Xho I и Not I. .Клетки L02 трансфицировали 0,16 мкг вектора FOXO3 3′-UTR (WT и Mut) и пустого вектора, а также 50 нмоль/л миметика miR-122-5p и миметика NC. Через 48 часов после трансфекции активность люциферазы измеряли с использованием системы Promega Dual-Luciferase, и относительную активность люциферазы рассчитывали как отношение активности люциферазы светлячка к активности люциферазы Renilla.

Количественная ПЦР в реальном времени

Суммарную РНК экстрагировали из гомогенизированных тканей печени и клеток L02 с использованием TRIZOL (Invitrogen, Карлсбад, Калифорния, США). Как обратную транскрипцию, так и количественную ПЦР (RT-qPCR) проводили с использованием наборов Invitrogen (Invitrogen, Шанхай, Китай) на системе обнаружения последовательностей ABI Prism 7900 (Applied Biosystems, Аламеда, Калифорния, США). Праймеры для фактора некроза опухоли альфа (TNF-α), интерлейкина (IL)-6, IL-8 и FOXO3 синтезировали с использованием Invitrogen (Invitrogen, Шанхай, Китай). Для анализа экспрессии miR-122-5p использовали RT-PCR miRNA на основе TaqMan. Используемые последовательности праймеров перечислены в таблице 1 .Содержание мРНК и микроРНК рассчитывали с использованием метода 2 –ΔΔCt и нормализовали к β-актину и U6 соответственно.

Иммуноферментный анализ

Среду для культивирования клеток и ткани печени собирали для определения концентраций TNF-α и IL-1β. Супернатанты клеточных культур с различными обработками собирали центрифугированием при 4500 g в течение 5 мин. Ткани печени гомогенизировали и центрифугировали. Затем собирали супернатант.Уровни цитокинов TNF-α, IL-6 и IL-8 из супернатантов и тканей печени определяли с использованием соответствующих наборов для твердофазного иммуноферментного анализа (ELISA) человеческих цитокинов (BioLegend, Сан-Диего, Калифорния, США). Определение уровня цитокинов проводили трижды и рассчитывали средние значения. Все анализы проводились в соответствии с протоколами производителя.

Вестерн-иммуноблот

Печень и клетки лизировали в буфере для радиоиммунопреципитации (RIPA), содержащем ингибиторы протеазы и фосфорилазы, в течение 30 мин при 4°C.Концентрацию белка в супернатанте измеряли с использованием набора для количественного анализа белка BCA-100 (Biocolors, Шанхай, Китай). Образцы белка по 10 мкг разделяли с помощью электрофореза в полиакриламидном геле с 10% натриевой солью (SDS-PAGE) и переносили на мембраны PVDF (Millipore). Мембраны PVDF инкубировали с блокирующим буфером [5% обезжиренного сухого молока и 0,1% Tween20 в TBS с Tween-20 (TBST)] в течение 1 ч при комнатной температуре с последующей инкубацией с разведенными первичными антителами в течение ночи при 4°С. C при легком встряхивании.Антитело к FOXO3, антитело к PI3K, антитело к AKT и антитело к p-AKT были получены от Cell Signaling Technology (Беверли, Массачусетс, США). Антитело против млекопитающих, представляющее собой рапамицин (mTOR), антитело против p-mTOR и антитело против β-актина были приобретены у Santa Cruz Biotechnology, Inc. (Даллас, Техас, США). Мембрану PVDF промывали и инкубировали со вторичными антителами, конъюгированными с пероксидазой хрена (HRP) (1:1000, Санта), в течение 1 часа. Белковые полосы визуализировали с помощью реагентов для обнаружения усиленной хемилюминесценции (Millipore Corporation, Массачусетс, США) и анализировали с использованием программного обеспечения Image-ProPlus (Media Cybernetics, Inc., Мэриленд, США).

Статистический анализ

Все данные были суммированы как среднее значение ± стандартное отклонение по меньшей мере из трех независимых повторов. Статистический анализ выполняли с помощью однофакторного ANOVA с последующим анализом наименьшей значимой разницы (LSD) апостериорным анализом или независимыми выборками t -тестом с использованием SPSS версии 20. 0 (SPSS Inc., Чикаго, Иллинойс, США). Значение P < 0,05 считалось статистически значимым.

Результаты

Диета с высоким содержанием жиров или PA способствует экспрессии miR-122-5p

in vivo и in vitro

Предыдущие исследования показали, что у пациентов с ожирением и НАЖБП наблюдается значительно более высокий уровень miR-122-5p в печени (Akuta et al., 2016; Latorre et al., 2017), поэтому мы сначала попытались определить, увеличивает ли HFD уровни миР-122-5p в печени у мышей. Через 8 недель у мышей C57BL/6J, получавших HFD, был заметно избыточный вес (рис. 1А), а вес печени был значительно тяжелее, чем у мышей, которых кормили едой (рис. 1В).

Рисунок 1. Диета с высоким содержанием жиров (HFD) или пальмитиновая кислота (PA) способствует накоплению липидов и экспрессии miR-122-5p in vivo и in vitro . (A) Мониторинг массы тела мышей, которых кормили чау-чау и HFD. (B) Масса печени. (C) Морфологические характеристики печени наблюдали с помощью окрашивания H&E и Oli Red O мышей, получавших HFD, и мышей, получавших пищу. (D) Общий холестерин (ОХ) и триглицерид (ТГ) в печени. (E) Уровень экспрессии miR-122-5p в печени. (F) Репрезентативные микрофотографии накопления липидов, индуцированного PA (0, 150, 300 и 600 мкм) при окрашивании Oil Red O . (G) Содержимое внутриклеточных ОК и ТГ после обработки ПА. (H) Экспрессия miR-122-5p в L02 после обработки PA. Столбики погрешностей указывают SD. * P < 0,05, ** P < 0,01, *** P < 0,001.

Первоначально у мышей, получавших HFD, наблюдались жировая дегенерация печени и накопление липидов (рис. 1C), а также было обнаружено значительное повышение уровней TC и TG в печени (рис. 1D), что позволяет предположить, что HFD-индуцированный стеатоз печени мышей. HFD значительно увеличивал уровни миР-122-5p в печени у мышей по сравнению со стандартными мышами, которых кормили едой (рис. 1E).Кроме того, PA, как токсичный липид, вызывающий накопление липидов в клетках печени (рис. 1F), не только способствовал секреции TC и TG (рис. 1G), но также повышал экспрессию miR-122-5p в зависимости от дозы в культивируемых клетках L02 (рис. 1Н). Эти данные свидетельствуют о том, что экспрессия miR-122-5p может быть связана с патогенезом НАЖБП.

Ингибирование miR-122-5p ослабляет индуцированный PA воспалительный ответ и окислительный стресс в клетках L02

Чтобы изучить биологическую роль miR-122-5p в развитии НАЖБП, клетки L02 трансфицировали ингибитором miR-122-5p или ингибитором NC до PA, чтобы заглушить уровни miR-122-5p в печени (рис. 2A).Ингибирование миР-122-5p значительно снижало индуцированное PA накопление липидов (рис. 2B). Липидная перегрузка гепатоцитов вызывает выраженную воспалительную реакцию и секрецию воспалительных цитокинов (Di Nunzio et al., 2010). PA значительно повышал экспрессию мРНК и уровни секреции TNF-α, IL-6 и IL-8 в клетках L02, но подавление miR-122-5p могло эффективно снижать их экспрессию и секрецию (рис. 2C, D).

Рисунок 2. Ингибирование MiR-122-5p ослабляет PA-индуцированный воспалительный и окислительный стрессовый ответ в клетках L02. (A) Клетки L02 трансфицировали лентивирусом, кодирующим антисмысловую миР-122-5p (ингибитор миР-122-5p) или контрольную смысловую [ингибитор отрицательного контроля (NC)] в течение 48 ч, а также обратную транскрипцию и количественную ПЦР (RT- qPCR) проанализировали уровень экспрессии miR-122-5p. (B) Представитель Окрашивание Oil Red O . (C) RT-qPCR анализировала экспрессию фактора некроза опухоли альфа (TNF-α), интерлейкина (IL)-6 и IL-8. (D) ELISA проанализировал уровень TNF-α, IL-6 и IL-8 в культуральных супернатантах. (E) Активность СОД и GSH-Px, содержание МДА. (F) Вестерн-блоттинг экспрессии PI3K, AKT, p-AKT, mTOR и p-mTOR. Столбики погрешностей указывают SD. * Р < 0,05, ** Р < 0,01, *** Р < 0,001.

Окислительный стресс является потенциальным фактором, способствующим развитию некровоспаления и фиброза печени при развитии НАЖБП (Gawrieh et al. , 2004). Мы обнаружили, что ингибитор miR-122-5p значительно повышал уровни супероксиддисмутазы (СОД) и глутатионпероксидазы (GSH-Px) и снижал содержание малонового диальдегида (МДА) в клетках L02 по сравнению с обработкой ингибитором NC при стимуляции ПА ( Рисунок 2Е).Передача сигналов PI3K/AKT играет критическую роль в опосредовании воспалительной реакции в гепатоцитах (Matsuda et al., 2013). Как основная киназа в нижестоящей передаче сигналов инсулина, AKT способствует синтезу липидов и белков в печени посредством активации mTOR (Vander Haar et al., 2007). Кроме того, мы обнаружили, что PA индуцирует клетки L02 для демонстрации более высоких уровней экспрессии PI3K, активного фосфорилированного AKT (p-AKT) и активного фосфорилированного mTOR (p-mTOR) с более высокими соотношениями p-AKT/AKT и p-mTOR. /mTOR, чем в контрольной группе, несмотря на ингибирование miR-122-5p, ослабляло экспрессию PI3K (рис. 2F).Таким образом, ингибитор miR-122-5p может улучшать воспалительную реакцию, индуцированную PA, и окислительный стресс, но это может не зависеть от пути PI3K/AKT.

Ингибирование миР-122-5p улучшает окислительный стресс, вызванный HFD, при жировой болезни печени

Для изучения физиологической роли миР-122-5p в HFD-индуцированном жировом поражении печени мышам C57BL/6J в возрасте 8 недель, получавшим HFD, вводили в хвостовую вену miR-122-5p или ингибитор NC в течение еще 4 недель. Как показано на дополнительных рисунках 1A, B, ингибитор miR-122-5p значительно снижал массу тела и уровень miR-122-5p в печени у мышей, получавших HFD ( P <0.001). Предыдущие исследования показали, что у мышей, получавших HFD, наблюдались более высокие отложения липидов в тканях печени (Haga et al., 2015). Ингибитор miR-122-5p также снижал массу печени, а также уровни TC и TG в печени мышей, получавших HFD, по сравнению с группой, получавшей ингибитор NC (рис. 3A, B). При гистологическом анализе мы обнаружили, что ингибитор miR-122-5p может эффективно улучшать гистологическую характеристику стеатоза печени, который в основном проявляется избыточным накоплением липидов и инфильтрацией иммунных клеток (рис. 3C).Кроме того, супрессия miR-122-5p также снижала экспрессию мРНК и уровни секреции воспалительных цитокинов (TNF-α, IL-6 и IL-8) (рис. 3D, E) и улучшала способность печени к антиоксидантному стрессу за счет увеличения активности SOD и GSH-Px и снижение содержания MDA (рис. 3F). HFD активировал сигнальный путь PI3K/AKT/mTOR в печени, но молчание миР-122-5p не могло эффективно инактивировать сигнальный путь PI3K/AKT/mTOR in vivo (рис. 3G). В совокупности эти данные свидетельствуют о том, что подавление miR-122-5p играет защитную роль в повреждении от окислительного стресса 90–117 in vitro 90–118 и 90–117 in vivo 90–118.

Рисунок 3. Подавление миР-122-5p улучшает вызванное HFD повреждение окислительного стресса при жировой болезни печени. (A) Мышам, получавшим HFD, вводили лентивирус, кодирующий антисмысловую миР-122-5p (ингибитор миР-122-5p) или нонсенс (ингибитор NC) в течение 4 недель, затем измеряли массу печени. (B) Печень ТС и ТГ. (C) Морфологические характеристики печени наблюдали с помощью окрашивания H&E и Oli Red O после инъекции miR-122-5p или ингибитора NC. (D) RT-qPCR проанализировала экспрессию TNF-α, IL-6 и IL-8. (E) ELISA анализировал уровень TNF-α, IL-6 и IL-8 в ткани печени. (Ж) Активность СОД и GSH-Px, содержание МДА. (G) Вестерн-блоттинг экспрессии PI3K, AKT, p-AKT, mTOR и p-mTOR. Столбики погрешностей указывают SD. * P < 0,05, ** P < 0,01, *** P < 0,001.

МиР-122-5p напрямую ингибирует экспрессию FOXO3 в клетках L02 и тканях печени мышей с ожирением

Для дальнейшего изучения молекулярного механизма миР-122-5p, защищающего от воспалительного и окислительного стрессового повреждения при жировой болезни печени, инструменты анализа мишеней миРНК (miRBase, TargetScan и mirecords.biolead.org/) использовали для предсказания потенциальных мишеней miR-122-5p. В многочисленных потенциальных мишенях FOXO3 был выбран для дальнейшего анализа, так как сообщалось, что он тесно связан с метаболизмом липидов и резистентностью к инсулину при НАЖБП, индуцированной HFD (Zhu et al. , 2017). Как показано на рисунке 4A, поскольку 3′-UTR FOXO3 содержит связывающую последовательность miR-122-5p, мы сконструировали репортеры люциферазы, кодирующие FOXO3 WT и Mut 3′-UTR, которые затем котрансфицировали плазмидой, кодирующей miR-122-5p, в L02. клетки.С помощью репортерного анализа люциферазы мы обнаружили, что miR-122-5p может напрямую связываться с FOXO3 3′-UTR, но не с мутантным FOXO3 3′-UTR. Этот результат продемонстрировал, что FOXO3 был потенциальной мишенью miR-122-5p (рис. 4B). Кроме того, мы отметили, что сверхэкспрессия miR-122-5p значительно ингибировала экспрессию мРНК и белка FOXO3 в клетках L02 (рис. 4C, D).

Рисунок 4. МиР-122-5p напрямую ингибирует экспрессию FOXO3 в клетках L02 и тканях печени у мышей с ожирением. (A) Совпадающая последовательность (красная рамка) со зрелой миР-122-5p и FOXO3 WT. (B) Направленное связывание miR-22-5p и FOXO3 обнаруживали с помощью флуоресцеинового репортера. (C) qRT-PCR анализ экспрессии miR-122-5p и FOXO3 в клетках L02 после трансфекции миметиком miR-122-5p. (D) Вестерн-блот анализ экспрессии FOXO3 после трансфекции миметиком miR-122-5p. (E) Вестерн-блоттинг экспрессии FOXO3 в клетках L02, обработанных различными концентрациями PA. (F) Вестерн-блоттинг экспрессии FOXO3 в клетках L02, обработанных ингибитором miR-122-5p. (G) qRT-PCR анализ экспрессии FOXO3 в печени после инъекции ингибитора miR-122-5p. (H) Вестерн-блоттинг экспрессии FOXO3 в печени после инъекции ингибитора miR-122-5p. Столбики погрешностей указывают SD. * P < 0,05, ** P < 0,01, *** P < 0,001.

Позже мы проанализировали ингибирование miR-122-5p на экспрессию FOXO3 в обработанных PA клетках L02 и тканях печени у мышей с НАЖБП, индуцированной HFD.В отличие от увеличения экспрессии miR-122-5p в культивируемых клетках L02, экспрессия белка FOXO3 снижалась в зависимости от дозы после обработки PA (фиг. 4E). В то время как ингибитор miR-122-5p мог значительно увеличить экспрессию FOXO3 в обработанных PA клетках L02 in vitro (рис. 4F). Кроме того, подавление миР-122-5p также значительно способствовало экспрессии мРНК и белка FOXO3 у мышей с HFD-индуцированной НАЖБП in vivo (рис. 4G, H). В совокупности эти данные свидетельствуют о том, что miR-122-5p ингибирует экспрессию FOXO3 in vitro и in vivo путем связывания с ее 3′-UTR областью.

МиР-122 ингибирует HFD-индуцированную жировую болезнь печени путем нацеливания на FOXO3

Для дальнейшего изучения влияния miR-122 на функцию FOXO3 при повреждении печени, вызванном HFD, мы использовали миРНК FOXO3, чтобы выяснить, может ли блокирование FOXO3 обратить вспять преимущества ингибирования miR-122-5p. Как показано на дополнительных рисунках 1C, D, обработка миРНК FOXO3 снижала экспрессию FOXO3 в печени на уровнях мРНК и белка у мышей с ожирением, которым вводили ингибитор miR-122-5p. По сравнению с преимуществами мышей с ожирением, получавших ингибитор miR-122-5p, si-FOXO3 обратно увеличивал массу печени и уровни TC и TG (рис. 5A, B), усугублял накопление липидов и инфильтрацию иммунных клеток (рис. 5C).Кроме того, siFOXO3 демонстрировал более высокую экспрессию воспалительных цитокинов и более низкие уровни антиоксидантного стресса, чем мыши, получавшие ингибитор miR-122-5p (рис. 5D-F). Поскольку реактивация FOXOs может защищать от фиброза печени посредством ослабления клеточной пролиферации и трансдифференцировки звездчатых клеток печени, нарушение регуляции FOXOs может быть связано с развитием НАЖБП (Dong, 2017). Передача сигналов PI3K/AKT приводит к исключению из ядра фосфорилированных FOXO и, следовательно, снижает транскрипционную активность FOXO для глюконеогенеза в печени (Webb and Brunet, 2014).Другими словами, FOXO3 является непосредственным нижестоящим эффектором передачи сигналов PI3K/AKT. Интересно, что ни ингибирование miR-122, ни молчание FOXO3 не могли активировать сигнальный путь PI3K/AKT и mTOR (рис. 5G). Эти результаты показали, что печеночный защитный эффект ингибирования miR-122-5p зависел от активации FOXO3.

Рисунок 5. Молчание FOXO3 отменяет преимущества ингибирования miR-122-5p в ткани печени. (А) Масса печени. (B) Печень ТС и ТГ. (C) Окрашивание H&E и Oli Red O для определения морфологических характеристик печени. (D) RT-qPCR проанализировала экспрессию TNF-α, IL-6 и IL-8. (E) ELISA анализировал уровень TNF-α, IL-6 и IL-8 в ткани печени. (Ж) Активность СОД и GSH-Px, содержание МДА. (G) Вестерн-блоттинг экспрессии PI3K, AKT, p-AKT, mTOR и p-mTOR. Столбики погрешностей указывают SD. * P < 0.05, ** Р < 0,01, *** Р < 0,001.

Обсуждение

В последние годы роль генной регуляции, опосредованной miRNA, в функции печени и заболеваниях привлекла больше внимания. Сообщалось, что неправильная регуляция микроРНК участвует в патогенезе НАЖБП, например, в воспалительной реакции печени, повреждении окислительным стрессом и накоплении липидов (Castro et al. , 2013; Yamada et al., 2013; Torres et al., 2018). В этом исследовании мы предоставили новые доказательства того, что миР-122-5p, заставляющая молчать печень, отменяет накопление липидов в печени, вызванное HFD, реакцию воспаления и повреждение окислительного стресса за счет прямой активизации транскрипционного фактора FOXO3.

MiR-122-5p в высокой степени экспрессируется в тканях печени, особенно в гепатоцитах, и положительно связана с ожирением печени и связанным с ним метаболизмом липопротеинов (Raitoharju et al., 2016). Предыдущие исследования показали, что у пациентов с ожирением и НАЖБП наблюдается значительно более высокий уровень miR-122-5p в печени (Akuta et al., 2016; Latorre et al., 2017). Тем не менее, нет доказательств, прямо раскрывающих физиологическую функцию миР-122-5p при НАЖБП, индуцированной диетой. В этом исследовании мы обнаружили, что кормление HFD повышало уровень miR-122-5p в печени мышей, а перегрузка PA стимулировала экспрессию miR-122-5p в гепатоцитах. Избыточное потребление энергии при ожирении, вызванном HFD, приводит к эктопическому накоплению липидов, что в значительной степени приписывается отложению липидов в нежировых тканях, включая скелетные мышцы или печень (Farrell and Larter, 2006; Tilg and Moschen, 2010). При перегрузке липидов в гепатоцитах токсичные липиды запускают провоспалительную сигнализацию и активируют транскрипционные факторы NF-κB и AP-1, вызывая секрецию воспалительных цитокинов, таких как TNF-α, IL-6 и IL-8, которые считаются основными провоспалительными медиаторами при НАЖБП (Joshi-Barve et al., 2007; Ди Нунцио и др., 2010 г.; Пал и др., 2012). Более того, сниженный уровень антиоксидантов ускоряет НАЖБП, индуцируя перекисное окисление липидов и способствуя резистентности к инсулину и воспалительной реакции (Ji et al., 2019). В соответствии с нашим предыдущим исследованием клеток L02, обработанных олеиновой кислотой (Hu et al., 2019), мы обнаружили, что ингибирование печеночной миР-122-5p ослабляет накопление липидов и экспрессию воспалительных цитокинов в клетках L02, обработанных PA, и индуцированных HFD. жирная печень. Кроме того, это исследование также показало, что ингибирование miR-122-5p улучшает активность антиоксидантных ферментов SOD и GSH-Px, уменьшая перекисное окисление липидов и образование MDA.Хотя механизм регуляции продукции miR-122-5p все еще неясен, продукция miR-122-5p может способствовать накоплению липидов, воспалительной реакции и окислительному стрессовому повреждению печени при HFD.

Резистентность к инсулину является движущей силой прогрессирования стеатоза печени, а окислительный стресс, вызванный перекисным окислением липидов, может быть потенциальным фактором, способствующим гангренозному воспалению и фиброзу печени (Gawrieh et al., 2004). Инсулин/IGF1 активирует активность тирозинкиназы через рецептор инсулина/рецептор IGF1, вызывая фосфорилирование субстрата рецептора инсулина, что впоследствии стимулирует фосфоинозитид-3-киназу (PI3K) для активации AKT (Arden, 2008; Webb and Brunet, 2014).Как основная киназа, расположенная ниже по течению от передачи сигналов инсулина, AKT способствует синтезу липидов и белков в печени посредством активации mTOR (Vander Haar et al. , 2007). Однако мы обнаружили, что не было различий в гепатоцеллюлярном пути PI3K/AKT между группой ингибиторов NC и группой ингибиторов miR-122-5p in vivo и in vitro . Поэтому было высказано предположение, что улучшение ингибитора miR-122-5p в отношении PA-индуцированного или HFD-индуцированного воспалительного ответа и окислительного стресса может не зависеть от пути PI3K/AKT.

Являясь ключевым нижестоящим регулятором сигнального пути инсулина/ИФР1, транскрипционные факторы FOXO участвуют во многих клеточных функциях, включая опосредование гомеостаза глюкозы, триглицеридов и холестерина (Webb and Brunet, 2014; Dong, 2017). В этом исследовании мы определили, что миР-122-5p непосредственно нацелена на печеночный FOXO3 и ингибирует экспрессию его гена с помощью анализа двойной люциферазы . Следовательно, ингибирование miR-122-5p может подавлять экспрессию FOXO3 in vitro и in vivo .Недавно Ван и соавт. (2019) сообщили, что FOXO3 способствует транскрипционной активности промотора SREBP1c, что приводит к увеличению синтеза TG и накоплению TG в печени в клетках HepG2 с высоким уровнем глюкозы и высоким уровнем PA, а также у мышей с ожирением, страдающих резистентностью к инсулину. При стимуляции инсулином сигнальный путь PI3K/AKT активируется сигнальным каскадом инсулина (Cai et al., 2017), который ингибирует транскрипционную активность FOXO3 путем фосфорилирования (Dong, 2017; Manning and Toker, 2017).Следовательно, в физиологических условиях инактивации FOXO3, индуцированной инсулинзависимым фосфорилированием, синтез липидов, опосредованный путем FOXO3-SREBP1c, будет ингибироваться. Интересно, что в клетках L02, индуцированных PA, и мышах, получавших HFD, мы обнаружили, что экспрессия FOXO3 подавлялась при активации сигнального пути PI3K/AKT. Эти результаты показали, что у мышей с НАЖБП, индуцированных HFD, и клеток L02, индуцированных PA, в нашем исследовании не развилось инсулинорезистентное состояние, поскольку чувствительность к инсулину варьируется среди различных типов клеток и животных.

Примечательно, что нокаут генов FOXO1/3 или FOXO1/3/4 в печени мышей, соответственно, приводил к легкому или умеренному стеатозу печени при стандартной диете чау-чау (Tao et al. , 2011; Pan et al., 2017). При заражении FOXO1/3/4, специфичным для HFD, нокаутные мыши имеют фенотип с очень тяжелым стеатозом печени, а также тяжелым воспалением и фиброзом, особенно в ответ на диету с высоким содержанием жиров и холестерина (Pan et al., 2017). . Трансгенная сверхэкспрессия конститутивно активного FOXO3 снижает уровень триглицеридов в печени, указывая на то, что FOXO3 может обратить вспять стеатоз печени (Pan et al., 2017). Следовательно, FOXO3 может оказывать противоположное регулирующее действие на стеатоз печени при инсулинозависимой и независимой передаче сигналов. Наше дальнейшее исследование показало, что преимущества ингибитора miR-122-5p у мышей с ожирением могут быть устранены за счет подавления FOXO3, включая снижение накопления липидов, что также продемонстрировало, что нацеливание miR-122-5p на FOXO3 играет решающую роль в индуцированном ожирением мышах. жировые болезни печени. Тем не менее нельзя исключать вклад других генов-мишеней miR-122-5p в липогенез, и анализы усиления и потери функции miR-122-5p in vivo и in vitro показали, что miR- 122-5p был способен способствовать развитию НАЖБП за счет ингибирования функции FOXO3. Однако необходимы дальнейшие исследования, чтобы выяснить, связана ли роль miR-122-5p в модуляции синтеза липидов с нацеливанием на FOXO3.

Окислительный стресс является ключевым индуцирующим фактором, способствующим развитию поражения жировой печени до неалкогольного стеатогепатита (Friedman et al., 2018). Дисбаланс активных форм кислорода (АФК) и антиоксидантных молекул в печени вызывает окислительный стресс, который может привести к перекисному окислению липидов и продукции воспалительных цитокинов и даже способствовать повреждению гепатоцеллюлярной ткани и фиброзу, способствуя прогрессированию от простого стеатоза к не- алкогольный стеатогепатит (Peverill et al., 2014). Следовательно, антиоксидантная терапевтическая стратегия обладает потенциалом для лечения стеатоза и воспаления печени. FOXO3 является не только прямым регулятором транскрипции глюконеогенеза, но также необходим для клеточной антиоксидантной защиты при заболеваниях печени. FOXO3 снижает уровень клеточных АФК за счет усиления антиоксидантных ферментов CAT и SOD, что способствует сохранению резервной способности митохондрий и, таким образом, защищает клетки печени от окислительного повреждения (Marinkovic et al. , 2007; Davila and Torres-Aleman, 2008).В этом исследовании мы обнаружили, что ингибирование miR-122-5p повышало экспрессию FOXO3 и улучшало уровни антиоксидантных ферментов SOD и GSH-Px, а также уменьшало образование MDA и воспалительных цитокинов. Однако замалчивание FOXO3 снижало его активность SOD и повышало уровни продукта перекисного окисления липидов MDA и воспалительных цитокинов у мышей с НАЖБП, получавших ингибитор miR-122-5p, что указывает на то, что miR-122-5p может быть важным негативным регулятором для FOXO3- сигнальный путь антиоксидантного стресса.Сообщается, что реактивация FOXO3 может защищать от фиброза печени за счет ослабления клеточной пролиферации и трансдифференцировки звездчатых клеток печени (Dong, 2017). Мыши с дефицитом FOXO3 в печени более восприимчивы к неалкогольному стеатогепатиту, чем контрольные мыши дикого типа (Pan et al., 2017), что предоставило убедительные доказательства того, что FOXO3 защищает от жировой болезни печени, вызванной диетой. Наши результаты подтвердили, что miR-122-5p может способствовать HFD-индуцированному NAFDL посредством , ингибирующего FOXO3-опосредованный путь антиоксидантного стресса, чтобы усугубить воспалительную реакцию. Выяснилось, что генетическая или фармацевтическая модификация miR-122-5p является многообещающим методом противодействия ожирению и связанным с ним метаболическим заболеваниям.

В совокупности наши результаты показали, что миР-122-5p является потенциальным медиатором, вносящим вклад в реакцию печени на воспалительный и окислительный стресс посредством ингибирования FOXO3 при развитии НАЖБП. Следовательно, миР-122-5p/FOXO3 может быть потенциальным терапевтическим средством против НАЖБП, связанной с ожирением.

Заявление о доступности данных

Оригинальные материалы, представленные в исследовании, включены в статью/дополнительный материал, дальнейшие запросы можно направлять соответствующему автору.

Заявление об этике

Исследование на животных было рассмотрено и одобрено, все процедуры на животных были одобрены Комитетом по политике и благополучию животных Южного медицинского университета с номером разрешения (2019DR00121).

Вклад авторов

YH и GD задумали и разработали эксперименты. YZ, ZZ и XL провели эксперименты. YH и XP проанализировали данные и предоставили реагенты и материалы. YH и GD написали рукопись. Все авторы внесли свой вклад в статью и одобрили представленную версию.

Финансирование

Эта работа была финансово поддержана грантами 600011 от Проекта Молодежного Фонда Медицинского Совершенства в Фошане, Гуандун, Китай.

Конфликт интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Примечание издателя

Все претензии, изложенные в этой статье, принадлежат исключительно авторам и не обязательно представляют претензии их дочерних организаций или издателя, редакторов и рецензентов.Любой продукт, который может быть оценен в этой статье, или претензии, которые могут быть сделаны его производителем, не гарантируются и не поддерживаются издателем.

Дополнительный материал

Дополнительный материал к этой статье можно найти в Интернете по адресу: https://www. frontiersin.org/articles/10.3389/fphys.2022.803445/full#supplementary-material

.

Каталожные номера

Акута Н., Кавамура Ю., Судзуки Ф., Сайто С., Арасе Ю. и Фудзияма С. (2016). Анализ связи между циркулирующей миР-122 и гистопатологическими особенностями неалкогольной жировой болезни печени у пациентов без гепатоцеллюлярной карциномы. ВМС Гастроэнтерол. 16:141. doi: 10.1186/s12876-016-0557-6.

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Bugianesi, E., Moscatiello, S., Ciaravella, M.F., and Marchesini, G. (2010). Инсулинорезистентность при неалкогольной жировой болезни печени. Курс. фарм. Дес. 16, 1941–1951.

Академия Google

Cai, C.X., Buddha, H., Castelino-Prabhu, S., Zhang, Z., Britton, R.S., Bacon, B.R., et al. (2017). Активация пути инсулина-PI3K/Akt-p70S6K в звездчатых клетках печени способствует фиброзу при неалкогольном стеатогепатите. Коп. Дис. науч. 62, 968–978. doi: 10. 1007/s10620-017-4470-9

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Castro, R.E., Ferreira, D.M., Afonso, M.B., Borralho, P.M., Machado, M.V., Cortez-Pinto, H., et al. (2013). миР-34a/SIRT1/p53 подавляется урсодезоксихолевой кислотой в печени крыс и активируется в зависимости от тяжести заболевания при неалкогольной жировой болезни печени человека. Ж. Гепатол. 58, 119–125. doi: 10.1016/j.jhep.2012.08.008

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ченг, Ю., Май Дж., Хоу Т. и Пинг Дж. (2016). МикроРНК-421 вызывает дисфункцию митохондрий печени у мышей с неалкогольной жировой болезнью печени путем ингибирования сиртуина 3. Biochem. Биофиз. Рез. коммун. 474, 57–63. doi: 10.1016/j.bbrc.2016.04.065

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Чанг, Д. Дж., Притчард, М. Т., и Надь, Л. Э. (2011). Ожирение, сахарный диабет и фиброз печени. утра. Дж. Физиол. Гастроинтест. Печень. Физиол. 300, G697–G702.

Академия Google

Давила, Д., и Торрес-Алеман, И. (2008). Нейрональная гибель в результате окислительного стресса включает активацию FOXO3 посредством двустороннего пути, который активирует стрессовые киназы и ослабляет передачу сигналов инсулиноподобного фактора роста I. Мол. биол. Ячейка 19, 2014–2025 гг. doi: 10.1091/mbc.e07-08-0811

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ди Нунцио, М., Ван Дерсен, Д., Верховен, А. Дж., и Бордони, А. (2010). n-3 и n-6 полиненасыщенные жирные кислоты подавляют активность белка, связывающего регуляторный элемент стерола, и увеличивают поток неэтерифицированного холестерина в клетках HepG2. Бр. Дж. Нутр. 103, 161–167. дои: 10.1017/S000711450999167X

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Фаррелл, Г.К., и Лартер, Ч.З. (2006). Неалкогольная жировая болезнь печени: от стеатоза к циррозу. Гепатология 43, S99–S112.

Академия Google

Филипович, В., и Гроссханс, Х. (2011). Специфическая для печени микроРНК миР-122: биология и терапевтический потенциал. Прог. Препарат Рез. 67, 221–238.

Реферат PubMed | Академия Google

Фридман, С. Л., Нойшвандер-Тетри, Б. А., Ринелла, М., и Саньял, А. Дж. (2018). Механизмы развития НАЖБП и терапевтические стратегии. Нац. Мед. 24, 908–922. doi: 10.1038/s41591-018-0104-9

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Gawrieh, S., Opara, E.C., and Koch, T.R. (2004). Окислительный стресс при неалкогольной жировой болезни печени: патогенез и антиоксидантная терапия. Дж. Расследование. Мед. 52, 506–514. doi: 10.1136/jim-52-08-22

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Го Д., Ма Дж., Ли Т. и Ян Л. (2018). Повышающая регуляция миР-122 защищает от гибели нейронов при ишемическом инсульте посредством пути NF-kappaB, зависящего от белка теплового шока 70, путем нацеливания на FOXO3. Экспл. Сотовый рез. 369, 34–42. doi: 10.1016/j.yexcr.2018.04.027

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Хага, Ю., Канда Т., Сасаки Р., Накамура М., Накамото С. и Йокосука О. (2015). Неалкогольная жировая болезнь печени и цирроз печени: сравнение со стеатозом, связанным с вирусным гепатитом. Мир Дж. Гастроэнтерол. 21, 12989–12995. дои: 10.3748/wjg.v21.i46.12989

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ху, Ю., Ду, Г., Ли, Г., Пэн, X., и Чжай, Ю. (2019). Ингибирование миР-122 уменьшает накопление липидов и воспаление в модели клеток НАЖБП. Арх. Физиол. Биохим. 127, 385–389. дои: 10.1080/13813455.2019.1640744

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Цзи Ю., Гао Ю., Чен Х., Инь Ю. и Чжан В. (2019). Индол-3-уксусная кислота облегчает неалкогольную жировую болезнь печени у мышей посредством ослабления печеночного липогенеза и окислительного и воспалительного стресса. Питательные вещества 1:2062. дои: 10.3390/nu110

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Джоши-Барве, С., Барве С.С., Аманчерла К., Гобеджишвили Л., Хилл Д., Кейв М. и др. (2007). Пальмитиновая кислота индуцирует продукцию провоспалительного цитокина интерлейкина-8 из гепатоцитов. Гепатология 46, 823–830. doi: 10.1002/hep.21752

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Китаде, Х., Чен, Г., Ни, Ю., и Ота, Т. (2017). Неалкогольная жировая болезнь печени и резистентность к инсулину: новые идеи и потенциальные новые методы лечения. Питательные вещества 9:387.дои: 10.3390/nu87

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Латорре, Дж., Морено-Наваррете, Дж. М., Меркадер, Дж. М., Сабатер, М., Ровира, О., Жиронес, Дж., и соавт. (2017). Снижение метаболизма липидов, но повышенный биосинтез ЖК сочетаются с изменениями в микроРНК печени у пациентов с ожирением и НАЖБП. Междунар. Дж. Обес. 41, 620–630. doi: 10.1038/ijo.2017.21

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Маринкович Д., Zhang, X., Yalcin, S., Luciano, J.P., Brugnara, C., Huber, T., et al. (2007). Foxo3 необходим для регуляции окислительного стресса в эритропоэзе. Дж. Клин. Вкладывать деньги. 117, 2133–2144. дои: 10.1172/JCI31807

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Мацуда С., Кобаяши М. и Китагиши Ю. (2013). Роль пути PI3K/AKT/PTEN в клеточной передаче сигналов неалкогольной жировой болезни печени. ISRN Эндокринол. 2013:472432. дои: 10.1155/2013/472432

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ни Х., Сонг К., Ван Д., Цуй С., Рен Т., Цао З. и др. (2017). Ингибирование микроРНК-194 улучшает вызванную питанием неалкогольную жировую болезнь печени у мышей за счет нацеливания на FXR. Биохим. Биофиз. Акта Мол. Основа Дис. 1863, 3087–3094. doi: 10.1016/j.bbadis.2017.09.020

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ота Т., Такамура Т., Курита С., Мацузава Н., Кита Ю. и Уно М. (2007). Резистентность к инсулину ускоряет диетическую модель неалкогольного стеатогепатита у крыс. Гастроэнтерология 132, 282–293. doi: 10.1053/j.gastro.2006.10.014

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Пал Д., Дасгупта С., Кунду Р., Майтра С., Дас Г. и Мукхопадхьяй С. (2012). Фетуин-А действует как эндогенный лиганд TLR4, способствуя резистентности к инсулину, индуцированной липидами. Нац. Мед. 18, 1279–1285.дои: 10.1038/nm.2851

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Пан, X., Чжан, Ю., Ким, Х.Г., Лиангпунсакул, С., и Донг, X.C. (2017). Факторы транскрипции FOXO защищают от жировой болезни печени, вызванной диетой. науч. Респ. 7:44597. дои: 10.1038/srep44597

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Певерилл, В. , Пауэлл, Л.В., и Скойен, Р. (2014). Эволюция концепций патогенеза НАСГ: помимо стеатоза и воспаления. Междунар. Дж. Мол. науч. 15, 8591–8638. дои: 10.3390/ijms15058591

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Райтохарью Э., Сеппала И., Льютикайнен Л. П., Вийкари Дж., Ала-Корпела М. и Сойнинен П. (2016). Уровни hsa-miR-122-5p и hsa-miR-885-5p в крови связаны с ожирением печени и связанным с ним метаболизмом липопротеинов — исследование молодых финнов. науч. Реп. 6:38262. дои: 10.1038/srep38262

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Шукла, Г.К., Сингх Дж. и Барик С. (2011). МикроРНК: процессинг, созревание, распознавание целей и регуляторные функции. Мол. Клеточная фармакология. 3, 83–92.

Реферат PubMed | Академия Google

Тао, Р., Вэй, Д., Гао, Х., Лю, Ю., Депиньо, Р. А., и Донг, X. С. (2011). Печеночные FoxOs регулируют метаболизм липидов посредством модуляции экспрессии гена никотинамидфосфорибозилтрансферазы. Дж. Биол. хим. 286, 14681–14690. doi: 10.1074/jbc.М110.201061

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Томас, М., и Дейтерс, А. (2013). МикроРНК miR-122 как терапевтическая мишень для олигонуклеотидов и малых молекул. Курс. Мед. хим. 20, 3629–3640. дои: 10.2174/0

73113202

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Тилг, Х., и Мошен, А. Р. (2010). Эволюция воспаления при неалкогольной жировой болезни печени: гипотеза множественных параллельных попаданий. Гепатология 52, 1836–1846. doi: 10.1002/hep.24001

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Торрес, Дж. Л., Ново-Велейро, И., Мансанедо, Л., Алвела-Суарес, Л., Масиас, Р., и Ласо, Ф. Дж. (2018). Роль микроРНК в алкогольных заболеваниях печени и неалкогольной жировой болезни печени. Мир Дж. Гастроэнтерол. 24, 4104–4118. дои: 10.3748/wjg.v24.i36.4104

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Вандер Хаар, Э. , Ли, С.И., Бандхакави, С., Гриффин, Т.Дж., и Ким, Д.Х. (2007). Передача сигналов инсулина к mTOR опосредована субстратом Akt/PKB PRAS40. Нац. Клеточная биол. 9, 316–323. дои: 10.1038/ncb1547

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ван, Л., Чжу, X., Сунь, X., Ян, X., Чанг, X., и Ся, М. (2019). FoxO3 регулирует метаболизм триглицеридов в печени посредством модуляции экспрессии белка 1c, связывающего регуляторный элемент стерола. Здоровье липидов Дис. 18:197. doi: 10.1186/s12944-019-1132-2

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ямада Х., Охаси К., Судзуки К., Мунецуна Э., Андо Ю. и Ямадзаки М. (2015). Продольное исследование циркулирующей миР-122 на крысиной модели неалкогольной жировой болезни печени. клин. Чим. Acta 446, 267–271. doi: 10.1016/j.cca.2015.05.002

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ямада Х. , Судзуки К., Ичино Н., Андо Ю., Савада А. и Осакабе К. (2013). Ассоциации между циркулирующими микроРНК (миР-21, миР-34а, миР-122 и миР-451) и неалкогольной жировой дистрофией печени. клин. Чим. Акта. 424, 99–103. doi: 10.1016/j.cca.2013.05.021

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Чжу М., Хао С., Лю Т., Ян Л., Чжэн П. и Чжан Л. (2017). Отвар лингуижугана улучшает неалкогольную жировую болезнь печени, изменяя гены, связанные с резистентностью к инсулину и метаболизмом липидов: исследование всего транскриптома с помощью RNA-Seq. Онкотарджет 8, 82621–82631. doi: 10.18632/oncotarget.19734

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Улучшение гиперлипидемии с помощью аэробных упражнений у мышей за счет регулирующего действия miR-21a-5p на ее гены-мишени

Аэробные упражнения благотворно влияют на массу тела и профиль липопротеинов плазмы

Гиперлипидемия, вызванная диетой с высоким содержанием жиров/холестерина, мышь Модель использовалась для оценки гиполипидемического эффекта аэробных упражнений. Как видно из рис. 2а, вес мышей группы HH демонстрировал тенденцию к быстрому росту, значительно выше, чем у мышей группы NC в конце эксперимента (P < 0,05). Однако от 6 до 13 недель аэробных упражнений масса тела в группе HHE была значительно меньше, чем в группе HH. Соответственно, масса печени в группе ГГ также была значительно выше и значительно уменьшалась после упражнений, но не было существенной разницы в отношении массы печени к массе тела (рис.С1). Кроме того, после 12 недель диеты с высоким содержанием жиров/холестерина липиды плазмы натощак были значительно повышены у мышей с HH, чем в группе NC, что свидетельствует о заметном накоплении липидов в сыворотке. Хотя уровни липидов в сыворотке мышей группы HH значительно восстановились после выполнения аэробных упражнений в течение 8 недель, это указывает на то, что аэробные упражнения вызывали благоприятные изменения уровня липидов в плазме (рис. 2b).

Рисунок 2

Защитное действие аэробных упражнений на нарушения липидного обмена. ( a ) Тенденция изменения массы тела мышей в каждой группе. ( b ) Липиды сыворотки мышей в каждой группе. ( c ) Визуальное наблюдение за тканью печени мышей. ( d ) Окрашивание HE для определения степени стеатоза печени. *P < 0,05 VS группа NC, # P < 0,05 VS группа HH.

Аэробные упражнения уменьшали стеатоз у мышей, получавших диету с высоким содержанием жира/холестерина

При визуальном осмотре печень группы NC была ярко-красной с гладкой поверхностью и острыми краями, в то время как печень группы HH была желтовато-коричневой с тусклыми краями, мы можем сделать предварительный вывод, что печень была покрыта липидами после диеты с высоким содержанием жиров/холестерола (рис.2с). Гистологический анализ с окрашиванием гематоксилин-эозином показал, что в печени мышей с гиперлипидемией обнаружены серьезные гистопатологические изменения, описанные как многочисленные мелкие цитоплазматические вакуоли, связанные с точечным некрозом клеток печени и инфильтрацией воспалительных клеток. Напротив, мы обнаружили, что после вмешательства с аэробными упражнениями количество капель липидов в печени уменьшилось, и их размер стал меньше, расположение клеток печени было аккуратным. (рис. 2г).

Аэробные упражнения благотворно регулируют экспрессию miR-21a-5p и ее генов-мишеней

Сообщалось, что многочисленные микроРНК участвуют в регуляции липидов.В нашем предыдущем эксперименте мы обнаружили экспрессию miR-33, miR-34a, miR-21a, miR-29a, miR-27a, miR-200c, miR-122, результаты показали, что эти miRNAs имели значительно различную экспрессию в группе HH, и наблюдалось заметное снижение miR-21a-5p (p < 0,01) (рис. 3a), что согласуется с другими исследованиями о снижении экспрессии miR-21a-5p у пациентов с НАЖБП или у мышей, получавших диета с высоким содержанием жиров. Принимая во внимание, что после 8 недель аэробных упражнений уровень миР-21a-5p был значительно повышен (p < 0.05) (рис. 3б). Кроме того, мы обнаружили, что экспрессия Dicer1, фермента для обработки микроРНК, была снижена в группе HH, но сильно повышена в группе HHE (рис. 3c).

Рисунок 3

Влияние аэробных упражнений на экспрессию miR-21a-5p и ее генов-мишеней. ( a ) Относительные уровни микроРНК в печени мышей, получавших диету с высоким содержанием жиров. ( b ) qPCR использовали для обнаружения экспрессии miR-21a-5p в группах NC, HH и HHE. ( c ) Уровни мРНК Dicer1.( d ) Схематическая диаграмма исходной последовательности miR-21a-5p с сайтом связывания 3′-UTR генов-мишеней. ( e ) Уровни мРНК мишеней miR-21a-5p были обнаружены с помощью QPCR. ( f ) Уровни белка мишеней miR-21a-5p определяли с помощью вестерн-блоттинга, исходные гелевые цифры для вестерн-блоттинга представлены в дополнительных данных. *P < 0,05 VS группа NC, # P < 0,05 VS группа HH.

Предыдущие исследования подтвердили, что FABP7, HMGCR, PPARα и PTEN являются прямыми мишенями miR-21a-5p.Кроме того, мы предсказали другие гены-мишени miR-21a-5p с помощью TargetScan и обнаружили, что ACAT1 и OLR1 имеют предполагаемый сайт связывания в своей 3′-нетранслируемой области (UTR) (рис. 3d). Чтобы определить, реагируют ли целевые гены миР-21a-5p на аэробные упражнения, мы измерили уровни их мРНК после аэробных упражнений. Даты показали, что экспрессия PPARα, PTEN снизилась в группе HH, но значительно увеличилась после вмешательства с физической нагрузкой. Напротив, уровни мРНК FABP7, HMGCR, ACAT1 и OLR1 значительно повысились в группе HH, но через 8 недель после вмешательства все они были снижены (P < 0.05) (рис. 3e). И мы также обнаружили уровни белка мишеней miR-21a-5p, которые соответствовали уровням мРНК (рис. 3f).

Среди них FABP7, PPARα и PTEN тесно связаны с метаболизмом жиров, а HMGCR, ACAT1 и OLR1 могут регулировать синтез и метаболизм холестерина. Таким образом, мы полагали, что один из механизмов, с помощью которого аэробные упражнения улучшают гиперлипидемию, может быть вызван влиянием на экспрессию генов, связанных с метаболизмом липидов.

miR-21a-5p регулирует экспрессию генов, участвующих в метаболизме липидов миР-21a-5p в печени мышей с использованием AAV9, кодирующего анти-миР-21a-5p.

Чтобы обнаружить специфический ингибирующий эффект, мы исследовали экспрессию miR-33, miR-34, miR-27, miR-29a и miR-21a-5p и обнаружили, что по сравнению с контрольной группой miR-27, miR -33, миР-34а, миР-29 не претерпела явных изменений, экспрессия миР-21а-5р значительно снизилась (рис. 4а).

Рисунок 4

Нокдаун miR-21a-5p привел к нарушению липидного обмена. ( a ) Экспрессия миР-27, миР-34a, миР-33, миР-29a, миР-21a-5p после инъекции анти-миР-21a-5p AAV через 5 недель.( b ) Масса тела и уровни липидов в сыворотке крови мышей miR-21a-5p KD, получавших корм из чау-чау или рацион с высоким содержанием жиров. ( c ) Уровни мРНК генов-мишеней у мышей miR-21a-5p KD. *P < 0,05 VS Контрольная группа или группа HFD.

Мыши MiR-21a-5p KD, получавшие рацион питания или рацион с высоким содержанием жиров, показали увеличение массы тела и уровня липидов в сыворотке (P < 0,05) (рис. 4a,b), эти результаты показали, что механизмы метаболизма липидов in vivo были нарушены. нарушается, что приводит к накоплению липидов. Затем мы проверили взаимосвязь между экспрессией FABP7, PPARα, HMGCR, PTEN, ACAT1, OLR1 и miR-21a-5p посредством количественной оценки экспрессии этих мишеней у мышей miR-21a-5p KD.Мы видим, что ингибирование miR-21a-5p значительно увеличивало уровни мРНК FABP7, HMGCR, ACAT1 и OLR1, в то время как PPARα, PTEN не претерпели значительных изменений (рис. 4c). Поэтому мы полагали, что miR-21a-5p регулирует метаболизм липидов, главным образом, влияя на экспрессию FABP7, HMGCR, ACAT1 и OLR1.

Спасательный эффект аэробных упражнений на мышей miR-21a-5p KD

Доказано, что аэробные упражнения могут эффективно снижать накопление липидов, и связь между miR-21a-5p и метаболизмом липидов была хорошо установлена, следовательно, Было важно сосредоточиться на том, влияют ли повышенные уровни miR-21a-5p, вызванные аэробными упражнениями, на накопление липидов, мы провели пятинедельное вмешательство аэробных упражнений на мышах miR-21a-5p KD с диетой чау-чау или диетой с высоким содержанием жиров и обнаружили, что экспрессия miR-21a-5p восстанавливалась после аэробных упражнений (фиг. 5а). Более того, мы обнаружили, что уровень липидов в крови и стеатоз печени у мышей miR-21a-5p KD были значительно улучшены (рис. 5b, c), что указывает на то, что аэробные упражнения могут уменьшить накопление липидов, вызванное потерей miR-21a-5p. , эти результаты убедительно подтвердили участие miR-21a-5p в улучшении гиперлипидемии за счет аэробных упражнений. Кроме того, мы обнаружили, что аэробные упражнения могут снижать уровни мРНК FABP7, HMGCR, ACAT1 и OLR1 у мышей miR-21KD (P < 0,05) (рис.5г). Таким образом, мы показали, что одним из механизмов, с помощью которых аэробные упражнения регулируют метаболизм липидов, было усиление экспрессии miR-21a-5p, тем самым подавляя экспрессию генов-мишеней FABP7, HMGCR, ACAT1 и OLR1.

Рисунок 5

Улучшение воздействия аэробных упражнений на мышей miR-21a-5p KD с диетой из чау-чау или диетой с высоким содержанием жиров. ( a ) Экспрессия miR-21a-5p ( b ) Уровни липидов в сыворотке ( c ) Окрашивание H&E для оценки стеатоза печени ( d ) Уровни мРНК генов-мишеней в miR-21a-5p Мыши KD после вмешательства с физической нагрузкой. *P < 0,05 VS Контрольная группа, # P < 0,05 VS группа анти-миР-21a-5p.

ИЖМС | Бесплатный полнотекстовый | МикроРНК-126b-5p усугубляет развитие жировой ткани и ожирение, вызванное диетой

Вклад авторов

Conceptualization, L.S., J.H., and L.Z.; методология, Л.С. и Дж. Х.; программное обеспечение, JH; валидация, Ю.Дж., Г.Т. и XL; формальный анализ, X.H. и Л.Б.; расследование, Ю. З., Л. К. и Л. Н.; ресурсы, Ю.З., Л.К. и Л.Н.; курирование данных, Л.С. и Дж. Х.; написание — первоначальная черновая подготовка, Л.С. и Дж. Х.; написание-обзор и редактирование, С.З. и Л.З.; надзор, С.З. и Л.З. Все авторы прочитали и согласились с опубликованной версией рукописи.

Рис. 1. миР-126b-5p положительно коррелировала с адипогенезом. Экспрессия миР-126b-5p в различных тканях 8-недельных мышей ( A ), паховой жировой ткани мышей с ожирением, вызванным диетой (HFD), и нормальных мышей (NCW) ( B ), паховой жировой ткани ткань 1–6-недельных мышей ( C ) и стадия дифференцировки преадипоцитов 3T3-L1 ( D ). Данные представлены как среднее ± SEM (n = 3).

Рис. 1. миР-126b-5p положительно коррелировала с адипогенезом. Экспрессия миР-126b-5p в различных тканях 8-недельных мышей ( A ), паховой жировой ткани мышей с ожирением, вызванным диетой (HFD), и нормальных мышей (NCW) ( B ), паховой жировой ткани ткань 1–6-недельных мышей ( C ) и стадия дифференцировки преадипоцитов 3T3-L1 ( D ). Данные представлены как среднее ± SEM (n = 3).

Рис. 2. миР-126b-5p способствовала пролиферации преадипоцитов 3T3-L1. ( A ) Экспрессия miR-126b-5p после трансфекции миметиков miR-126b-5p, миметиков NC, ингибиторов NC и ингибиторов miR-126b-5p через 48 часов. Анализ EdU ( B ), количественный анализ EdU положительных клеток ( C ) и анализ CCK8 ( D ) использовали для оценки пролиферации преадипоцитов 3T3-L1. ( E ) Экспрессия Cycling D1, Cycling E1, CDK2, CDK4, p21 и p53 через 48 ч после трансфекции миметиков miR-126b-5p, миметиков NC, ингибиторов NC и ингибиторов miR-126b-5p (шкала , 200 мкм). Данные представлены как среднее значение ± SEM (n = 3) (NS — недостоверно, p > 0,05, * p < 0,05, ** p < 0,01, *** p < 0,001).

Рис. 2. миР-126b-5p способствовала пролиферации преадипоцитов 3T3-L1. ( A ) Экспрессия miR-126b-5p после трансфекции миметиков miR-126b-5p, миметиков NC, ингибиторов NC и ингибиторов miR-126b-5p через 48 часов. Анализ EdU ( B ), количественный анализ EdU положительных клеток ( C ) и анализ CCK8 ( D ) использовали для оценки пролиферации преадипоцитов 3T3-L1.( E ) Экспрессия Cycling D1, Cycling E1, CDK2, CDK4, p21 и p53 через 48 ч после трансфекции миметиков miR-126b-5p, миметиков NC, ингибиторов NC и ингибиторов miR-126b-5p (шкала , 200 мкм). Данные представлены как среднее значение ± SEM (n = 3) (NS — недостоверно, p > 0,05, * p < 0,05, ** p < 0,01, *** p < 0,001).

Рис. 3. миР-126b-5p усиливала отложение липидов в преадипоцитах 3T3-L1. ( A ) Экспрессия миР-126b-5p после трансфекции миметиков миР-126b-5p, миметиков NC, ингибиторов NC и ингибиторов миР-126b-5p через восемь дней после дифференцировки 3T3-L1. ( B E ) Окрашивание Oil Red O ( B ), количественная оценка положительной области окрашивания Oil Red O ( C ), содержание TAG ( D ) и TC ( E ) использовали для оценки дифференцировки преадипоцитов 3T3-L1. ( F ) Экспрессия FABP4, C/EBPα, FAS, adipor2, LPL и PPARγ после трансфекции миметиков miR-126b-5p, миметиков NC, ингибиторов NC и ингибиторов miR-126b-5p через восемь дней после 3T3-L1 дифференциация (масштабные линейки, 200 мкм).Данные представлены как среднее ± SEM (n = 3) (* p < 0,05, ** p < 0,01, *** p < 0,001).

Рис. 3. миР-126b-5p усиливала отложение липидов в преадипоцитах 3T3-L1. ( A ) Экспрессия миР-126b-5p после трансфекции миметиков миР-126b-5p, миметиков NC, ингибиторов NC и ингибиторов миР-126b-5p через восемь дней после дифференцировки 3T3-L1. ( B E ) Окрашивание Oil Red O ( B ), количественная оценка положительной области окрашивания Oil Red O ( C ), содержание TAG ( D ) и TC ( E ) использовали для оценки дифференцировки преадипоцитов 3T3-L1. ( F ) Экспрессия FABP4, C/EBPα, FAS, adipor2, LPL и PPARγ после трансфекции миметиков miR-126b-5p, миметиков NC, ингибиторов NC и ингибиторов miR-126b-5p через восемь дней после 3T3-L1 дифференциация (масштабные линейки, 200 мкм). Данные представлены как среднее ± SEM (n = 3) (* p < 0,05, ** p < 0,01, *** p < 0,001).

Рис. 4. Adipor2 и ACADL являются прямыми генами-мишенями miR-126b-5p, измеренными в клетках HEK-293T. ( A , B ). Репрессивный эффект miR-126b-5p на активность Adipor2 и ACADL 3’UTR измеряли с помощью анализа люциферазы.Данные представлены как среднее ± SEM (n = 3) (* p < 0,05, ** p < 0,01, *** p < 0,001).

Рис. 4. Adipor2 и ACADL являются прямыми генами-мишенями miR-126b-5p, измеренными в клетках HEK-293T. ( A , B ). Репрессивный эффект miR-126b-5p на активность Adipor2 и ACADL 3’UTR измеряли с помощью анализа люциферазы. Данные представлены как среднее ± SEM (n = 3) (* p < 0,05, ** p < 0,01, *** p < 0,001).

Рис. 5. миР-126b-5p усугубляла ожирение мышей, вызванное диетой с высоким содержанием жиров. ( A ) Экспрессия miR-126b-5p в паховой жировой ткани постоянно повышалась в течение восьми недель. Масса тела ( B ), увеличение массы тела ( C ), масса пахового жира ( D ), масса окологонадного жира ( E ) и масса печени ( F ) в четырех группах. ( G ) Окрашивание H&E паховой жировой ткани в четырех группах. ( H ) Количественное определение размера клеток и количества перигонадного жира в группах H-126 и H-NC.Окрашивание печени масляным красным O ( I ) и статистика частоты положительных результатов окрашивания масляным красным O ( J ) в печени. Концентрация ТАГ ( К ) и ТС ( л ) в сыворотке крови. Концентрация ТАГ ( М ) и ТС ( N ) в паховой жировой ткани, перигонадной жировой ткани и печени. Тест на толерантность к глюкозе, GTT ( O ) и тест на толерантность к инсулину, ITT ( P ). ( Q ) Экспрессия FABP4, SCD-1, FAS, ELOVL6, LPL, PPARα, ACADL и ACOX2 в паховой жировой ткани.Все результаты были представлены как среднее значение ± стандартная ошибка среднего (n = 4–6, масштабные линейки, 100 мкм) (NS — незначимо, p > 0,05, * p < 0,05, ** p < 0,01, *** p < 0,001) .

Рис. 5. миР-126b-5p усугубляла ожирение мышей, вызванное диетой с высоким содержанием жиров. ( A ) Экспрессия miR-126b-5p в паховой жировой ткани постоянно повышалась в течение восьми недель. Масса тела ( B ), увеличение массы тела ( C ), масса пахового жира ( D ), масса окологонадного жира ( E ) и масса печени ( F ) в четырех группах.( G ) Окрашивание H&E паховой жировой ткани в четырех группах. ( H ) Количественное определение размера клеток и количества перигонадного жира в группах H-126 и H-NC. Окрашивание печени масляным красным O ( I ) и статистика частоты положительных результатов окрашивания масляным красным O ( J ) в печени. Концентрация ТАГ ( К ) и ТС ( л ) в сыворотке крови. Концентрация ТАГ ( М ) и ТС ( N ) в паховой жировой ткани, перигонадной жировой ткани и печени.Тест на толерантность к глюкозе, GTT ( O ) и тест на толерантность к инсулину, ITT ( P ). ( Q ) Экспрессия FABP4, SCD-1, FAS, ELOVL6, LPL, PPARα, ACADL и ACOX2 в паховой жировой ткани. Все результаты были представлены как среднее значение ± стандартная ошибка среднего (n = 4–6, масштабные линейки, 100 мкм) (NS — незначимо, p > 0,05, * p < 0,05, ** p < 0,01, *** p < 0,001) .

Таблица 1. миР-126b-5p влияла на состав жирных кислот в преадипоцитах 3T3-L1.

Таблица 1. миР-126b-5p влияла на состав жирных кислот в преадипоцитах 3T3-L1.

***
Жирная кислота Концентрация (мкг / мл) UP / down
MIMICS NC MIM-126B-5P MIMICS
C6: 0 0 0 —-
C8:0 0 0 —-
C10:0 0 0,03501 ± 0,0004 UP
C11: 0 0 0 —-
C12: 0
C12: 0 0 0,02 ± 0. 002 UP
C13: 0 0.01 ± 0.00 0,02 ± 0.001 UP ***
C14: 0 0,54 ± 0,05 1,23 ± 0,04 UP ***
C14: 1 0 0 —-
C15:0 0.46 ± 0.05 1,01 ± 0,02 UP ***
C15: 1
C15: 1 0 0 —-
C16: 0
8. 29 ± 0.38 18.16 ± 0.13 UP ***
C16: 1 C16: 1 457 ± 0,44 11.01 ± 0.55 UP ***
C17: 0
0,42 ± 0.04 0,77 ± 0,02 UP **
С17:1 0,54 ± 0.05 1.10 ± 0,09 UP ***
C18: 0 3.60 ± 0.76 5,02 ± 0,03 UP *
C18: 1N9T 0 0
C18: 1N9C 5. 20 ± 0.71 10.02 ± 0.56
C18: 2N6T 0 0 —-
C18: 2n6c 0,52 ± 0,04 0,55 ± 0.02 UP 6 UP NS
C18: 3N6 0,25 ± 0,26 ± 0,01 UP *
C18: 3N3 0 0 —-
C20: 0 0. 20 ± 0.02 0,21 ± 0,01 до NS
C20: 1 0 0 —-
C20: 2 0.68 ± 0,0005 0,66 ± 0.05 down NS
C21: 0 0 0 —-
C20: 3N6 0,484 ± 0,03 0,485 ± 0,02 UP NS
C20: 4n6 1. 61 ± 0.23 1,65 ± 0.11 до NS
C20: 3N3 0 0 —-
C20: 5n3 0,53 ± 0,05 0.55 ± 0,04 UP 6 UP NS
C22: 0 0.168 ± 0,005 0.174 ± 0,003 до NS
C22: 1N9 0 0 — —
C22: 2N6 0 0 —-
C23: 0 0 0 —-
C24: 0 0,25 ± 0. 01 0.26 ± 0.005 UP NS
C24: 1 0 0 —-
C22: 6 0.846 ± 0,05 0,853 ± 0,03 до Н. С.
общая 29,17 ± 2,60 54,02 ± 0,97 до
SFA 13,94 ± 1,09 26,88 ± 0,02 UP ***
MUFA 10,3 ± 1. 15 22.13 ± 1,20
PUFA 4,92 ± 0.40 5.01 ± 0.25 UP NS
C16:0/C16:1 1.82 ± 0.090 1,65 ± 0,094 down NS
C16: 0 / C18: 0 2.37 ± 0 2,37 ± 0 3.62 ± 0,044 UP *
C18: 0 / C18: 1 0.69 ± 0.057 0. 50 ± 0,026 Down **
C16: 1 / C18: 1 0,89 ± 0,074 1.10 ± 0,0070 UP **
SFA / всего 0,48 ± 0,0065 0,50 ± 0,0091 Вверх *
МНЖК/всего 0.35 ± 0,0081 0,41 ± 0,015 UP ** UP **
PUFA / всего 0,17 ± 0,093 ± 0,0061 0,093 ± 0,0061 down ***

Таблица 2. миР-126b-5p регулировала состав жирных кислот в паховой жировой ткани.

Таблица 2. миР-126b-5p регулировала состав жирных кислот в паховой жировой ткани.

** Н. С. Н.С. Н. С. ** Н.С. ** Н.С. —- —- Н. С. Н.С. ** Н.С.
Жирная кислота Концентрация (мкг / г) вверх / вниз
H-NC H-126
C6: 0 27.84 ± 2,75 28,85 ± 0,66 NS
С8: 0 9,84 ± 0,19 11,82 ± 0,80 до *
С10: 0 49,24 ± 2,76 68,67 ± 3,51 до
С11: 0 1,04 ± 0,14 1,19 ± 0,02
С12: 0 299,48 ± 25,58 335,03 ± 35,38
С13: 0 6.11 ± 0,74 6,86 ± 0,02 NS
С14: 0 6586,37 ± 365,78 7352,71 ± 133,51 до *
С14: 1 320,40 ± 29,42 342,04 ± 5,08 Н.С.
С15: 0 341,88 ± 11,10 333,69 ± 5,41
С15: 1 0,75 ± 0,27 2,01 ± 0,13 до
С16: 0 67 993.57 ± 1538,06 64,103.13 ± 3242,12
С16: 1 21,977.17 ± 844,14 25,118.60 ± 333,46 до
С17: 0 622,01 ± 26,90 636,70 ± 2.65 NS
C17: 1 836,88 ± 6,36 835,63 ± 17,52 NS
С18: 0 20,838. 49 ± 9,99 26,268.43 ± 227,55 Up ***
C18:1n9t 0 0 —-
C18:1n9c 118 554.11 ± 1652,67 117,502.15 ± 3730,93
С18: 2n6t 0 0
С18: 2n6c 60,435.67 ± 402,57 58,232.17 ± 2572.42 Н.С.
С18: 3n6 0 0
С18: 3n3 4034,85 ± 94,16 4145,20 ± 39,24
С20: 0 576.07 ± 29,08 646,11 ± 6,99 до *
С20: 1 3601,34 ± 35,07 3583,60 ± 19,50 NS
С20: 2 1420,30 ± 12,40 1459,13 ± 4,35 down **
C21: 0 0 0 —-
C20: 3N6 536.93 ± 22.31 556. 34 ± 1.11 NS
C20: 4n6 685.24 ± 10,66 821,83 ± 46,59 Up **
C20: 3n3 200,46 ± 5,48 201,28 ± 1,71 NS
C20: 5n3 182,35 ± 13,88 154,11 ± 1,73 Вниз *
C22: 0 95,49 ± 3,51 103,27 ± 1,26 до *
C22: 1N9 170,41 ± 0,57 171,81 ± 3,16 до NS
C22:2n6 8. 83 ± 0.33 10.2036 10.20 ± 0.19 UP **
C23: 0 15.42 ± 1.45 19.39 ± 1,356 UP *
C24: 0 C24: 0 34.29 ± 8.86 64.93 ± 4,91 Up **
C24: 1 107,11 ± 4,00 106,56 ± 0,61 NS
C22: 6 905,71 ± 80,71 876,80 ± 49,26 NS
всего 311 475. 65 ± 4127,86 314,100.24 ± 2094,52 NS
SFA 97,497.15 ± 1739,71 99,980.78 ± 3565,31 NS
MUFA 145,568.17 ± 2210,44 147,662.40 ± 4110,32 NS
ПНЖК 68,410.34 ± 519,11 66,457.06 ± 2638,75
С16: 0 / С16: 1 3,10 ± 0,10 2,55 ± 0,16 Вниз **
С16: 0 / С18 :0 3. 26 ± 0.073 2,44 ± 0.10 down ***
C18: 0 / C18: 1 0.18 ± 0,22 ± 0,0090 0,22 ± 0,0090 UP ***
C16: 1 / C18 : 1 0,19 ± 0,0063 0,21 ± 0,0040 до
SFA / всего 0,31 ± 0,0016 0,32 ± 0,0092
MUFA / всего 0,47 ± 0,0023 0,47 ± 0,016 NS
ПНЖК/всего 0. 22 ± 0,0024 0,21 ± 0,0070 НС

Таблица 3. Последовательности праймеров для qRT-PCR и температура отжига.

Таблица 3. Последовательности праймеров для qRT-PCR и температура отжига.

91 027 Генная 91 027 Последовательности праймеров (5 ‘→ 3’) 91 027 ТМ (° С) + циклин D1 9102
β-актина F: GTGACGTTGACATCCGTAAAGA 60
Р: GCCGGACTCATCGTACTCC +
U6 F: CTCGCTTCGGCAGCACA 60
Р: AACGCTTCACGAATTTGCGT
С / EBPα F: GCGGGAACGCAACAACATC 62
Р: GTCACTGGTCAACTCCAGCAC
CDK4 F: GTCAGTTTCTAAGCGGCCTG 60
Р: CACGGGTGTTGCGTATGTAG
FABP4 F: AAGGTGAAGAGCATCATAACCCT 52
Р: TCACGCCTTTCATAACACATTCC
SCD-1 F: TTCTTGCGATACACTCTGGTGC 63. 3
Р: CGGGATTGAATGTTCTTGTCGT
ACADL F: TGCCCTATATTGCGAATTACGG 63,3
Р: CTATGGCACCGATACACTTGC
ACOX2 F: CATCCAACGTGACCCAGTGTT 63,3
Р: AAATGCGTTCAGGACCGTCTT
CDK2 F: GCGACCTCCTCCCAATATCG 6109
R: GTCTGATCTTTTTTCCCCACTCTCT
LPL F: GGTTGCGCGTagagaggatg 59. 6
Р: CTCACGCTCTGACATGCCTTC
PPAR, F: TACTGCCGTTTTCACAAGTGC 62
Р: AGGTCGTGTTCACAGGTAAGA
Adipor2 F: TGTTCCTCTTAATCCTGCCCA 52,8
Р: CCAACCTGCACAAGTTCCCTT
ФАС F: AGGTGGACTGGATACACAGAC 62
Р: TCTCCTGCCCAAACTCTTTGC
циклин Е1 F: CTCCGACCTTTCAGTCCGC 60
Р: CACAGTCTTGTCAATCTTGGCA
р21 F: GATGGCTTCGACACCATTCC 60
Р: AGACGACACAGGTGAGGAAG
F: CTCCGTATCTTACTTCAAGTGCG 60
Р: CTTCTCGGCAGTCAAGGGAA
р53 F: CTCTCCCCCGCAAAAGAAAAA 60
R: CGGAACATCTCGAAGCGTTTA
MMU-MIR-126B-5P ATTATTATTCACCACGGGTACGAGTT 60

Дополнение нефти подсолнечника влияет на экспрессию MIR-20A-5P и MIR-142-5P в корпусную носку молочной железы

Abstract

Добавление масла в рационы молочного скота используется для модулирования состава молочного жира, а также экспрессии липогенных генов молочной железы, регулирование которых остается неясным. MiRNAs представляют собой небольшие некодирующие РНК, рассматриваемые как важные регуляторы экспрессии генов, предлагающие ключи к объяснению механизма, лежащего в основе нутрирегуляции генов. Настоящее исследование было разработано для выявления микроРНК, экспрессия которых в молочной железе коровы модулируется добавлением подсолнечного масла. MiRNomes были получены с использованием технологии RNAseq из молочной железы лактирующих коров, получавших рацион с низким содержанием фуража, с добавлением или без добавления 4% подсолнечного масла. Среди 272 охарактеризованных микроРНК восемь были отобраны для валидации RT-qPCR, демонстрируя значительное подавление miR-142-5p и miR-20a-5p при добавлении подсолнечника.Предполагается, что эти две микроРНК нацелены на гены, экспрессия которых, как сообщается, дифференциально экспрессируется при употреблении добавок подсолнечника. Среди их предполагаемых мишеней изучен ген ELOVL6 , участвующий в метаболизме липидов. Тем не менее, первый анализ не показал его значительного подавления в ответ на сверхэкспрессию miR-142-5p , miR-20a-5p или обоих в эпителиальной клеточной линии молочной железы крупного рогатого скота. Тем не менее, более четкое понимание экспрессии микроРНК при добавлении липидов поможет расшифровать регуляцию молочной железы лактирующей коровы в ответ на питание.

Образец цитирования: Mobuchon L, Le Guillou S, Marthey S, Laubier J, Laloë D, Bes S, et al. (2017)Добавка подсолнечного масла влияет на экспрессию miR-20a-5p и miR-142-5p в молочной железе лактирующего быка. ПЛОС ОДИН 12(12): е0185511. https://doi.org/10.1371/journal.pone.0185511

Редактор: Хуан Дж. Лоор, Иллинойский университет, США

Поступила в редакцию: 27 апреля 2017 г.; Принято: 14 сентября 2017 г.; Опубликовано: 27 декабря 2017 г.

Эта статья находится в открытом доступе, свободна от каких-либо авторских прав и может свободно воспроизводиться, распространяться, передаваться, изменяться, дополняться или иным образом использоваться любым лицом в любых законных целях. Работа доступна в качестве общественного достояния Creative Commons CC0.

Доступность данных: Все последовательности, описанные в этой статье, можно загрузить. Данные РНК-секвенирования с секвенатора Hiseq2000 отправлены в репозиторий GEO. Им присвоен номер доступа GSE81616.5.

Финансирование: Эта работа получила поддержку от INRA, ApisGène (http://www.apis-gene.com/, гранты в рамках проекта NutriMirMa для LM) и AIP BioRessources.

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Введение

Питательная ценность молока зависит от его состава и, в частности, от доли жирных кислот. Изменение состава коровьего молока имеет большое значение, поскольку оно может оказывать влияние на здоровье потребителей. Было показано, что некоторые жирные кислоты, такие как насыщенные жирные кислоты, могут оказывать потенциально негативное воздействие на здоровье потребителей при употреблении в избытке, в то время как другие (например,грамм. олеиновая кислота, конъюгированная линолевая кислота) оказывают положительное действие [1]. Жирные кислоты молока жвачных животных могут значительно меняться в зависимости от диеты [2]. Поэтому стратегии питания были разработаны с помощью пищевых добавок с растительными маслами или семенами для повышения пищевой ценности молока [2]. В синтез и секрецию молочного жира вовлечены многочисленные гены, экспрессия которых может регулироваться питанием [3–7]. Известно, что микроРНК (миРНК) — малые некодирующие РНК длиной 18–25 нуклеотидов — участвуют во многих и различных клеточных процессах [8–10].Они регулируют экспрессию генов на посттранскрипционном уровне, связываясь со своей мРНК-мишенью посредством взаимодействия спаривания оснований, в основном вызывая репрессию трансляции или деградацию мРНК [11]. Регуляция и функция miRNAs в молочной железе остаются плохо документированными, поэтому для более четкого понимания их экспрессии в этом органе и их функции были разработаны профили с использованием высокопроизводительного секвенирования. Несколько авторов установили референсные списки микроРНК, экспрессируемых в молочной железе различных видов, таких как человек [12], мышь [13], крыса [14], свинья [15], корова [13, 16, 17] или коза. 18–21].Недавно в исследованиях in vitro сообщалось, что некоторые микроРНК, такие как miR-101a [22] и miR-126-3p [23], регулируют пролиферацию эпителиальных клеток молочной железы или, например, miR-206 . [24], влияют на развитие этого органа. Кроме того, сообщалось, что некоторые микроРНК участвуют в функции лактации, такие как miR-15a , чья сверхэкспрессия в эпителиальных клетках бычьей молочной железы, как было показано, ингибирует экспрессию бета-казеина ( CSN2 ), который кодирует основной молочный белок [25].Более того, было доказано, что микроРНК являются ключевыми регуляторами синтеза липидов в различных клеточных линиях [26] и тканях [27-29]. В синтезе липидов молока несколько исследований указали на их роль [30–32]. Сверхэкспрессия miR-27a или miR-103 в эпителиальных клетках молочной железы козы приводила к изменению жировых капель и накоплению триглицеридов, снижала соотношение ненасыщенных/насыщенных жирных кислот и заметно влияла на экспрессию генов, связанных с липидами. метаболизм [33, 34]. В контексте in vivo исследования показали, что сверхэкспрессия miR-30b в молочной железе мыши влияет на образование липидных капель [35]. Взятые вместе, эти находки предполагают, что miRNA может играть важную роль в физиологии и функции молочных желез, а также в синтезе и секреции компонентов молока.

Недавние данные свидетельствуют о том, что биоактивные компоненты пищи (микро- и макроэлементы) влияют на профиль экспрессии или функцию микроРНК [36-40]. Например, в забрюшинной жировой ткани мышей обработка конъюгированной линолевой кислотой модифицировала экспрессию miR-103 , miR-107 , miR-143 , miR-221 и miR-282 ,

8 их экспрессия коррелирует с генами, которые сильно экспрессируются в адипоцитах и ​​связаны с метаболизмом липидов [41].У жвачных несколько исследований изучали влияние питания на экспрессию микроРНК. Romao и коллеги показали, что на экспрессию восьми miRNAs в хребте и околопочечном жире бычков сильно влияет диета с высоким содержанием жиров [42]. Совсем недавно сообщалось, что на экспрессию 11 микроРНК в подкожной и висцеральной жировой ткани ягнят влияет замена льняного масла на муку из водорослей [43]. Доступно очень мало данных о питательной регуляции экспрессии микроРНК в молочной железе.Первоначальное исследование нутригеномики сообщило об изменении экспрессии 30 miRNAs при ограничении питания у лактирующих коз [44]. Совсем недавно Ли и его коллеги [45] показали, что на экспрессию 14 и 22 микроРНК в молочной железе лактирующих коров влияет обработка льняным семенем и сафлором соответственно.

Таким образом, чтобы получить более четкое представление о том, как экспрессия генов в молочной железе регулируется в ответ на диету, настоящее исследование было направлено на выявление микроРНК, на экспрессию которых влияло добавление подсолнечного масла у лактирующих коров в связи с транскриптомными данными.Таким образом, мы ранее разработали эксперимент для определения влияния добавления целых и интактных семян рапса в рацион с высоким содержанием фуража, а также добавления подсолнечного масла в рацион с низким содержанием фуража [46]. Только добавление подсолнечника вызывало изменение экспрессии генов в молочной железе коров, связанное с увеличением производства молока и снижением содержания белка и жира, а также с большей амплитудой ответов состава молока по сравнению с добавлением рапса [46]. Поэтому эта диета была выбрана для того, чтобы получить представление о пищевом регулировании биосинтеза компонентов молока путем исследования экспрессии микроРНК.Предполагается, что две микроРНК, подавляемые добавкой подсолнечного масла, нацелены на гены с дифференциальной экспрессией, ранее идентифицированные в том же исследовании. Среди их предполагаемых мишеней был изучен ген ELOVL6 , участвующий в метаболизме липидов. Однако, когда эти микроРНК трансфицировали для сверхэкспрессии в эпителиальную клеточную линию бычьей молочной железы in vitro , не было никакого эффекта на уровни мРНК ELOVL6 .

Материалы и методы

Заявление об этике и животные

Для этого исследования мы использовали образцы из экспериментов на животных, проведенных в экспериментальном отделении Исследовательского центра INRA в Тейксе. Во время экспериментов на животных мы не требовали представления каждого следа животных комитету по этике, мы строго следовали собственным суровым рекомендациям института по уходу за животными, а также комитету по этике экспериментов на животных региона Оверни ( CEMEAA номер 02). Все биопсии молочной железы, которые были единственным хирургическим вмешательством, проводились в соответствии с национальным законодательством и аккредитованным лицом (номер сертификата: 63–20). Все собранные образцы были описаны ранее [13, 46].Настоящее исследование было разработано для выявления микроРНК, экспрессия которых в молочной железе коровы модулируется добавлением подсолнечного масла с использованием высокопроизводительной технологии. Одиннадцати здоровым (стандартный удой (20,7 ± 1,6 кг в сутки) и без признаков мастита) многоплодным коровам голштинской породы на пике лактации (116,3 ± 8,3 дня после отела в начале опыта) было предложено два экспериментальных рациона. Коровы были разделены на 2 группы по однородности удоя, возрасту (1111 ± 55 дней) и паритету (1,111 ± 55 дней). 1±0,3). Одиннадцать коров, получающих два рациона (LF и LF-SO), позволяют каждой корове быть ее контролем. Коров содержали в стойлах со свободным доступом к воде. Каждый период кормления длился 28 дней, разделенных на первые 7 дней для адаптации к лечению и последние 21 день, когда коров кормили одним из экспериментальных рационов. Рационы представляли собой: (1) рацион на основе натурального травяного сена плюс смесь концентратов для получения приблизительного соотношения корма к концентрату 46:54, называемого «низким кормом» (LF), и (2) та же диета LF плюс 4 г/100 г сухого вещества подсолнечного масла (Huilerie de Lapalisse, Lapalisse, France) вместо зерна кукурузы (LF-SO).Подсолнечное масло смешивали и распределяли с кормом. Ранее было описано влияние добавки подсолнечного масла на молочный продукт и его состав [46]. Образцы тканей молочной железы брали у коров в конце экспериментального периода путем биопсии верхней трети задней области одного вымени с использованием метода, разработанного Farr et al . [47]. Приблизительно 500 мг ткани молочной железы удаляли, затем промывали в 0,9% стерильном физиологическом растворе, проверяли на гомогенность ткани и быстро замораживали в жидком азоте.

Трансфекция клеток

клетки BME-UV1 из линии эпителиальных клеток молочной железы были первоначально выделены из молочной железы лактирующей голштинской коровы Zavizion et al. . [48]. Клетки выращивали при 37°C в атмосфере 5% CO2 в монослое на пластиковых культуральных колбах и в ростовой среде, описанной Zavizion et al. . [48]. Среду меняли каждые 48 часов. Для достижения трансфекции конфлюэнтные клетки, выращенные в монослое, трипсинизировали трипсином-0,25% этилендиаминтетрауксусной кислотой (ЭДТА) и высевали в 24-луночный планшет со скоростью 50000 клеток на лунку.На следующий день 10 пмоль миметика mirVana™ ( hsa-miR-20a-5p , анализ ID MC10057 и bta-miR-142-5p , анализ ID MC10404) трансфицировали в трех экземплярах в течение 24 часов в BME- Клетки UV1 с использованием реагента Lipofectamine® RNAiMAX (ThermoFisher) в соответствии с инструкциями производителя. Миметик миРНК mirVana™ miR-1-3p (Ambion™) использовали в качестве положительного контроля, и его мишень TWF1 определяли количественно, чтобы определить, был ли миметик активен в клетках. Для оценки скорости трансфекции на том же планшете использовали красный флуоресцентный контроль BLOCK-iT™ Alexa Fluor® (Ambion™).Клетки культивировали на покровных стеклах и одновременно проводили трансфекцию. Клетки на покровных стеклах фиксировали 3% параформальдегидом (свежеприготовленным в фосфатно-солевом буфере (PBS) из 32% маточного раствора, EMS Hatfield) в течение 20 мин. и выдерживали при 4°C в PBS, пока их не поместили на предметные стекла с использованием VectaShield (Vector), содержащего DAPI. Изображения были получены с использованием конфокального микроскопа Leica, и были подсчитаны клетки из трех изображений трех разных покровных стекол. Эксперименты по трансфекции повторяли четыре раза.

Выделение РНК

образца РНК получали из 50 мг ткани молочной железы с использованием набора для выделения микроРНК Nucleospin® (Machery-Nagel, Inc. ), как сообщалось Le Guillou et al. . [13]. РНК осаждали с использованием 3М ацетата натрия, 96% этанола и 5 мг/мл гликогена. Для образцов РНК, приготовленных из клеточных культур, клетки промывали PBS, а затем РНК экстрагировали с использованием набора RNA Now (Ozyme) в соответствии с инструкциями производителя и включая осаждение в течение ночи, чтобы гарантировать максимальный выход микроРНК.Концентрацию и чистоту РНК оценивали спектрофотометрически (NanodropTH, ND-1000).

Подготовка библиотеки, секвенирование и обработка данных

Высокопроизводительное секвенирование было выполнено на двух библиотеках LF и двух библиотеках LF-SO. РНК от двух коров объединяли для создания каждой библиотеки. Пулы были получены с использованием равных количеств (10 мкг) РНК, выделенной из тканей молочной железы двух коров, выбранных случайным образом. Методы подготовки библиотеки и секвенирования описаны в Le Guillou et al. .[13]. Вкратце, библиотеки готовили с использованием набора малых РНК Illumina с РНК, выделенной из молочной железы, с последующим секвенированием на Illumina HiSeq 2000 биотехнологической компанией GATC (Next Gen Lab) в соответствии с методом секвенирования Solexa. Затем данные секвенирования РНК анализировали в основном с использованием программного обеспечения miRDeep2 [49] и описали в Le Guillou et al . [13].

Обратная транскрипция и количественная ПЦР

Обратная транскрипция микроРНК была выполнена на восьми микроРНК, выбранных в соответствии с их распространенностью в данных высокопроизводительного секвенирования, их внутригрупповой стабильностью и их кратностью (таблица S1): miR-15a-5p (TaqMan® ID 005892_mat, Applied Biosystems), miR-17-5p (TaqMan® ID 002308), miR-20a-5p (TaqMan® ID 00580), miR-33a-3p (TaqMan® ID Custom Assay), miR-126 -3p (TaqMan® ID 008451_mat), miR-142-5p (TaqMan® ID 000465), miR-181a-5p (TaqMan® ID 000480), miR-223-3p (TaqMan® 002225) .Обратную транскрипцию и количественную ПЦР (кПЦР) проводили с использованием анализов обратной транскрипции TaqMan® MicroRNA и TaqMan® Small RNA Assays (Applied Biosystems), соответственно, как описано в Mobuchon et al. . [21].

Для анализа генов из клеточных культур обратную транскрипцию проводили на 500 нг тотальной РНК с использованием набора для синтеза кДНК SuperScript® VILO в соответствии с инструкциями производителя (Invitrogen) и при следующих условиях: 42°C в течение 60 мин и 85°C. в течение 5 мин.Количественные ПЦР проводили с использованием смеси ABsolute Blue QPCR Mix, SYBR Green® (Thermo Scientific™) в соответствии с инструкциями производителя на системе Mastercycler Ep Realplex (Eppendorf) при следующих условиях: 95°C в течение 15 мин, 45 циклов 95°С в течение 15 с и 60°С в течение 1 мин и кривая плавления. Получены пороговые циклы для ELOVL6 (F 5′-CAATATTTCCCAGGGTTCTCC-3′ и R 5′-AGCTGCCCCTTTCAAGAGTTG-3′) и TWF1 (F 5′-GGCATCCAAGCAAGTGAAGA-3′ и R 5′-GCTTCCTACACGACCCAATCA-3′) нормализовали значениями GAPDH (глицеральдегид-3-фосфатдегидрогеназа F 5′-ATGGTGAAGGTCGGAGTGAA-3′ и R 5′-ACGATGTCCACTTTGCCAGA-3′), а результаты выражали в виде кратных изменений значений порогового цикла (Ct) относительно контроля методом 2-ΔΔCt [50].

Статистический анализ

Статистический анализ для сравнения miRNome был выполнен с использованием R версии 3.0.1 (R Development Core Team, 2013) с пакетом Bioconductor DESeq2 [51], как описано Le Guillou et al . [13]. Данные были отфильтрованы с использованием пакета Bioconductor HTSFilter [47]. Этот метод направлен на определение порога, который максимизирует сходство фильтрации между биологическими репликами, или, другими словами, когда большинство генов имеет тенденцию иметь нормализованные значения ниже или равные точке отсечки во всех образцах (т.е. отфильтрованные гены) или выше точки отсечения по крайней мере в одном образце (т. е. неотфильтрованные гены). Было обнаружено, что это пороговое значение равно 199. Значения p были скорректированы для множественного тестирования с использованием метода Бенджамини-Хохберга [52], и те, у которых скорректированное значение p <0,1, считались значимыми.

Количественные данные ПЦР были проанализированы с использованием модели ANOVA с использованием R для анализов miRNA TaqMan®. Модель включала влияние диеты и случайные эффекты животных. Для анализа генов данные были проанализированы с помощью теста Манна-Уитни с использованием R версии 3.0,1. Значимость также была заявлена ​​при p-значении p<0,1.

пути-мишени микроРНК

Поскольку семенные участки miR-20a-5p и miR-142-5p консервативны у человека и крупного рогатого скота, предполагаемые мишени для этих miRNA были предсказаны с высокой степенью точности на основе DIANA-microT-CDS v5.0. [53].

Доступность данных

Все данные о производстве и составе молока уже опубликованы и поэтому доступны в Leroux et al. (2016) [46].Все последовательности, описанные в этой статье, можно скачать. Данные РНК-секвенирования с секвенатора Hiseq2000 отправлены в репозиторий GEO. Им присвоен номер доступа GSE81616.5.

Результаты

Создание микрономов молочной железы крупного рогатого скота

Четыре библиотеки были сконструированы с использованием РНК, выделенной из молочных желез лактирующих коров, получавших либо рацион с низким содержанием фуража (LF) (библиотеки LF1 и LF2), либо такой же рацион с добавлением 4% подсолнечного масла (LF-SO, библиотеки LF-SO1 и LF-SO2) и секвенировали с использованием технологии секвенирования следующего поколения (NGS) (таблица 1). Для каждой библиотеки было получено более 10 миллионов необработанных чтений. После очистки прочтений (удаление поли-А-растяжек и адаптеров) в каждой библиотеке сохранялось от 77% до 94% необработанных прочтений (таблица 1). В среднем 10 175 799 и 8 578 397 отфильтрованных по размеру прочтений (17–28 нуклеотидов) были картированы в геноме коровы (UMD3.1.71) в образцах LF и LF-SO соответственно. Затем в образцах LF и LF-SO было получено в среднем 104 286 и 86 752 уникальных последовательности, которые были обработаны с помощью miRDeep2, что позволило идентифицировать 1562 микроРНК.

Пакет

HTSFilter [54] был применен для удаления микроРНК, которая, по-видимому, генерировала неинформативный сигнал, путем определения порога фильтрации, который максимизирует так называемое сходство фильтрации между репликами. После этого фильтра количество микроРНК сократилось до 272 (дополнительная таблица S1). Среди них 18 были предсказаны miRNAs, которые не были идентифицированы ни у одного вида и, таким образом, могут рассматриваться как потенциальные новые miRNA [13].

Изменения в miRNome молочной железы крупного рогатого скота в зависимости от добавки подсолнечного масла

Этот анализ позволил ранжировать микроРНК по уровню их экспрессии и, таким образом, ранжировать их распространенность в двух диетических условиях.Восемь микроРНК ( miR-15a-5p , miR-17-5p , miR-20a-5p , miR-33a-3p , miR-126-3p , 818192a miR , miR-142-5p и miR-223-3p ; дополнительная таблица S1) были выбраны для дальнейшего изучения на основе их ранжирования и их функции, отмеченной в литературе. Их экспрессию анализировали с помощью количественной ПЦР на образцах РНК, используемых для анализа секвенирования. Профили, полученные с использованием подходов NGS и qPCR, согласовались для всех протестированных микроРНК (рис. 1), несмотря на разные амплитудные ответы.Однако при использовании обоих методов ранжирование экспрессии восьми выбранных miRNAs сохранялось (данные не показаны). Например, miR-126-3p наиболее часто выявлялась как при NGS, так и при qPCR, в то время как экспрессия miR-33a-3p была ниже при использовании обоих методов по сравнению с другими выбранными miRNA. После анализа пулов РНК экспрессия восьми микроРНК, выбранных выше, была подтверждена на большем количестве (n = 11) животных из того же испытания с питанием с помощью RT-qPCR на каждом человеке (рис. 2).Среди восьми изученных микроРНК проверки RT-qPCR подтвердили, что miR-20a-5p (p = 0,08) и miR-142-5p (p = 0,03) значительно подавлялись добавлением подсолнечного масла.

Рис. 1. Сравнение экспрессии восьми микроРНК в молочной железе на 2 пулах.

Анализы проводились на 2 пулах РНК от 2 коров, получавших рацион LF или LF-SO, полученных с помощью подходов qPCR и NGS. Коровы получали малофуражный рацион (НФ) или такой же рацион с добавлением 4% подсолнечного масла (НФ-СО), n = 2.

https://doi.org/10.1371/journal.pone.0185511.g001

Рис. 2. Индивидуальный анализ экспрессии восьми микроРНК в молочной железе.

Анализы RT-qPCR были выполнены у 11 коров, получавших рацион LF или LF-SO. Коровы получали малофуражный рацион (НФ) или такой же рацион с добавлением 4% подсолнечного масла (НФ-СО). **0,01

https://doi.org/10.1371/journal.pone.0185511.g002

Предполагается, что

miR-20a-5p и miR-142-5p нацелены на гены, дифференциально экспрессируемые подсолнечным маслом

Чтобы исследовать функциональную роль miR-20a-5p и miR-142-5p , вычислительные приложения использовались для прогнозирования их целей.Среди сотен потенциальных мишеней некоторые гены были вовлечены в метаболизм липидов (таблица 2) и в общие регуляторные пути (рис. 3).

Рис. 3. Возможные регуляции посредством miR-20a-5p метаболизма молочного жира.

ABCA1: АТФ-связывающая кассета подсемейства A (ABC1), член 1, BTN1A1: подсемейство 1 BuTyrophilin, член A1, LPIN1: LiPIN1, PPARγ: гамма-рецептор, активируемый пролифератором пероксисом, PPARGC1B: коактиватор гамма-активатора, активируемого пролифератором пероксисом, 1 бета, SCD : стероил-КоА-десатураза, VLDLR: рецептор липопротеинлипазы очень низкой плотности.

https://doi.org/10.1371/journal.pone.0185511.g003

Гены различной экспрессии (DEG) в тех же образцах ранее были обнаружены с помощью транскриптомного анализа [46]. Классификация DEG по функциональным категориям (в соответствии с аннотацией Gene Ontology) выявила три класса генов, участвующих в метаболизме, содержащих 30% DEG, что подчеркивает влияние подсолнечного масла на метаболизм молочной железы, включая метаболизм липидов. Были исследованы предполагаемые мишени miR-20-5p и miR-142-5p среди этих DEG.Среди предполагаемых мишеней, демонстрирующих обратную реакцию на лечение по сравнению с данными miRNA, были выделены девять DEG (таблица 3). Было обнаружено, что экспрессия miR-20a-5p потенциально нацелена на восемь активированных DEG ( ELK4 (фактор транскрипции ETS), ELOVL6 (элонгаза жирных кислот 6), ETV1 (вариант 1 ETS), KDM6B (лизиндеметилаза 6B), KIAA1524 , LONP2 (лонпептидаза 2, пероксисомальная), M6PR (маннозо-6-фосфатный рецептор, катион-зависимый), USP12 )) (убиквитин1-специфическая пептидаза LF) Было обнаружено, что коровы -SO и miR-142-5p потенциально нацеливаются на четыре активированных DEG ( ELK4 , ELOVL6 , ETV1 , PIK3CD (фосфатидилинозитол-3-киназа полипептид) каталитический). Обе микроРНК потенциально нацелены на ELK4 , ETV1 и, в частности, на ген ELOVL6 , который кодирует элонгазу жирных кислот, фермент, участвующий в метаболизме липидов (Fig 4).

Влияние

miR-20a-5p и miR-142-5p на экспрессию ELOVL6 , гена, участвующего в метаболизме липидов

Чтобы выяснить, могут ли miR-20a-5p и/или miR-142-5p регулировать экспрессию ELOVL6 в эпителиальных клетках молочной железы, микроРНК сверхэкспрессировали по отдельности или вместе с использованием имитаторов микроРНК в культуре бычьего эпителия молочной железы. монослои (BME-UV1).Уровни miR-20a-5p и miR-142-5p были значительно повышены в трансфицированных клетках по сравнению с ложно-трансфицированными клетками (фиг. 5A). Для оценки скорости трансфекции миРНК, меченную красителем Alexa Fluor®, также трансфицировали в клетки BME-UV1 (данные не показаны). Подсчет трансфицированных клеток по сравнению с ложно-трансфицированными клетками позволил определить среднюю степень трансфекции 40%. Чтобы убедиться, что миметики функционируют в клетках и способны регулировать свою мишень, miR-1-3p , микроРНК, которая регулирует уровень мРНК TWF1 (твинфилин-актин-связывающий белок 1), также трансфицировали.Значительное снижение экспрессии TWF1 было обнаружено в клетках BME-UV1, трансфицированных miR-1-3p , по сравнению с ложно-трансфицированными клетками (данные не показаны). miR-20a-5p и miR-142-5p трансфицировали по отдельности или вместе в течение 48 часов в клетки BME-UV1, а экспрессию ELOVL6 определяли количественно с помощью RT-qPCR. Никаких существенных изменений не было получено в клетках, трансфицированных miR-20a-5p и miR-142-5p , как по отдельности, так и вместе (фиг. 5B).Кроме того, три сайта связывания для miR-1-3p также присутствуют в 3’UTR ELOVL6 (рис. 4). Чтобы обеспечить доступность ELOVL6 3’UTR, экспрессию этого гена количественно определяли как в ложно-трансфицированных клетках, так и в клетках, трансфицированных миметиками miR-1-3p . Результаты показали значительное снижение ELOVL6 в клетках, трансфицированных миметиками miR-1-3p , по сравнению с ложно-трансфицированными клетками (рис. 5C).

Рис. 5.Влияние сверхэкспрессии miR-20a-5p и miR-142-5p на экспрессию ELOVL6 в клетках BME-UV1.

(A) Уровни миР-20a-5p и миР-142-5p после трансфекции миметиками миРНК. Данные были получены с помощью RT-qPCR, нормализованы относительно значений U6 и представлены как log10. Экспрессия ELOVL6 после трансфекции miR-20a-5p и miR-142-5p (B) или miR-1-3p (C). Данные были получены с помощью RT-qPCR и нормализованы относительно значений GAPDH. Данные представляют собой среднее значение четырех экспериментов по трансфекции.а, б: р<0,01; **:0,01

https://doi.org/10.1371/journal.pone.0185511.g005

Обсуждение

Чтобы лучше понять механизмы регуляции, лежащие в основе экспрессии генов молочной железы в ответ на диетические факторы, сравнивали miRNomes из молочных желез коров, получавших рацион LF-SO или рацион LF. Сравнение этих микроРНК позволило идентифицировать несколько микроРНК, которые демонстрировали тенденцию к повышению или понижению экспрессии в микроРНК у коров, получавших рационы LF и LF-SO.Среди них восемь miRNAs, выбранные из-за их ранжирования и их функций, были проанализированы с использованием qPCR на тех же пулах РНК. Так же, как и некоторые другие авторы, мы показываем хорошую корреляцию между данными, полученными с использованием двух разных подходов [55, 56], согласие, которое усилило ценность наших результатов.

Затем среди восьми кандидатных микроРНК, выделенных в исследовании секвенирования РНК, было подтверждено с помощью RT-qPCR на образцах от 11 коров (каждая корова получала каждый рацион), что экспрессия miR-20a-5p и miR- 142-5p было снижено за счет добавления подсолнечного масла.Относительно небольшое количество дифференциально экспрессируемых микроРНК в нашем исследовании можно объяснить продолжительностью приема (21 день). Действительно, Карере и др. . осуществили семинедельную провокацию у 12 бабуинов и выявили 28 микроРНК, на которые в печени по-разному воздействовала диета с высоким содержанием жиров и высоким содержанием холестерина [57]. Кроме того, Ромао и др. . охарактеризовали восемь микроРНК, которые по-разному экспрессировались в жировой ткани восьми бычков в ответ на получение диеты с высоким содержанием жиров в течение 3 лет.5 месяцев [42]. Однако более недавнее исследование 28-дневного лечения выявило 36 miRNAs в miRNome молочной железы лактирующей коровы, экспрессия которых была модулирована добавлением 5% льняного семени и 5% сафлорового масла [45], в то время как никаких различий не наблюдалось после 7 дней лечения. Разница в продолжительности между 21 и 28 днями не может быть достаточной, чтобы объяснить разницу в количестве дифференциально экспрессируемых микроРНК, но может быть связана с используемой диетой. Действительно, во время нашего исследования мы использовали две изоэнергетические диеты, тогда как Li и др. .отработанное масло добавляли к контрольным диетам, что приводило к разнице в энергетической ценности, что могло бы объяснить более выраженные изменения в экспрессии микроРНК [45]. Кроме того, мы не можем исключить, что относительно небольшое количество дифференциально экспрессируемых миРНК в нашем исследовании может быть также объяснено индивидуальными вариациями ответа коров, даже если каждая корова была собственным контролем, и что мы сравнили с помощью RT-qPCR одиннадцать голштинских средних животных. -молочные коровы.

MiR-20a-5p , который дифференциально экспрессировался в нашем исследовании, принадлежит к кластеру miR-17/92 , который в основном описан как онкомиР, но также важен для пролиферации клеточного цикла, апоптоза и другие биологические процессы в ряде органов [58].Хотя ответ miR-20a-5p на добавление липидов еще не был описан, изменение экспрессии miR-142-5p , наблюдаемое здесь, соответствует предыдущим сообщениям о жировых тканях. Действительно, в белой жировой ткани мышей, получавших диету с высоким содержанием жиров в течение 5 месяцев, экспрессия miR-142-5p значительно повышалась по сравнению с результатами у контрольных мышей [59]. Кроме того, его экспрессия была в 2,5 и 2,8 раза выше соответственно в подкожном и висцеральном жире ягнят, получавших в течение 140 дней вместо льняного масла и зерна ячменя 3% шрот из водорослей [43].Кроме того, диета с высоким содержанием жиров, которую давали бычкам в виде льняного семени в течение 14 недель, приводила к 185-кратному и 968-кратному увеличению экспрессии miR-142-5p в подкожной и висцеральной жировой ткани соответственно [42]. Как наши результаты, так и результаты, полученные в жировых тканях, предполагают, что на экспрессию miR-142-5p сильно влияют пищевые липиды. Противоположное изменение экспрессии, наблюдаемое в двух тканях, может быть связано с наличием контекста накопления липидов в жировой ткани и контекста секреции липидов в ткани молочной железы.

Функции miR-20a-5p и miR-142-5p никогда не исследовались в молочной железе. Из-за питательного влияния состава молочного жира, чтобы определить влияние добавок подсолнечного масла на метаболизм липидов, который был одним из биологических процессов, измененных добавками подсолнечного масла [46], наше внимание было сосредоточено на предполагаемых мишенях, участвующих в этом пути. . Среди них двадцать три предсказанных мишени для miR-20a-5p и miR-142-5p были идентифицированы с использованием программного обеспечения DIANA, три из которых были нацелены на две микроРНК. MiR-20a-5p может действовать i) на метаболизм липопротеинов (путем нацеливания на APOBEC4 (каталитический полипептид фермента редактирования мРНК аполипопротеина B, подобный 4), LDLR (рецептор липопротеинов низкой плотности) и VLDLR (липопротеидов очень низкой плотности). рецептор)), ii) на десатурацию жирных кислот (путем воздействия на SCD5 (стеароил-КоА-десатураза 5)) и iii) на секрецию липидов (путем воздействия на BTN1A1 (подсемейство 1 бутирофилина, представитель A1), основного компонента оболочки жировых шариков молока). LPIN1 (липин 1) также потенциально является мишенью miR-20a-5p . Этот ген сильно экспрессируется в молочной железе коровы на пике лактации и участвует в накоплении триацилглицеринов в жировой ткани [60]. В молочной железе его роль еще не ясна, но он может участвовать в синтезе молочного жира, особенно потому, что он необходим для активации PPARα (рецептор, активируемый пролифератором пероксисом альфа) [61]. Члены семейства PPAR, такие как PPARα , PPARγ и коактиватор PPARGC1B (рецептор, активируемый пролиферацией пероксисом, гамма, коактиватор 1 бета), известны как факторы транскрипции, участвующие в контроле генов, кодирующих липогенные ферменты, нацелены на miR-142-5p и, по прогнозам, будут нацелены на miR-20a-5p [62].Кроме того, прямое взаимодействие между miR-20a-5p и PPARγ было подтверждено с помощью люциферазного анализа в клетках Cos-7 [63]. PPARγ контролирует большинство генов, участвующих в синтезе молочного жира, таких как FASN (синтаза жирных кислот), ACACA (ацетил-КоА-карбоксилаза альфа), SCD , ABCA1 , 7 BTN1A (рис. 3). В совокупности эти предсказания указывают на потенциальную и решающую роль miR-20a-5p на разных уровнях в синтезе и секреции молочного жира.

В противном случае предполагается, что miR-142-5p нацеливается на две изоформы фермента ACSL (ацил-КоА-синтетаза с длинной цепью) (таблица 2). Было показано, что ACSL1 является основной изоформой молочной железы лактирующих быков [64] и активирует вновь синтезированные жирные кислоты до того, как они смогут метаболизироваться или встроиться в липидные капли [65]. Следовательно, miR-20a-5p и miR-142-5p могут влиять на метаболизм липидов в ответ на добавление масла в зависимости от их предполагаемых мишеней.

Интересно, что среди предсказанных мишеней miR-20a-5p и miR-142-5p девять DEG ранее идентифицированы в тех же образцах с помощью предыдущего транскриптомного анализа [46] (табл. 3). Обе миР-20a-5p и miR-142-5p , как предполагается, нацелены на ELK4 и ETV1 , которые, как известно, участвуют в репликации, транскрипции и трансляции. MiR-20a-5p также потенциально нацелены на KDM6B , деметилазу, иллюстрирующую взаимную регуляцию двух эпигенетических процессов [66].miRNA и метилирование ДНК являются двумя эпигенетическими модификациями, которые появились в последние годы как наиболее важные игроки в регуляции экспрессии генов. Здесь, в ответ на добавление масла, miR-20a-5p сможет регулировать метилирование ДНК, воздействуя на деметилазу.

Среди девяти ДЭГ, потенциально являющихся мишенями, четыре участвуют в метаболизме, одном из биологических процессов, выявленных с помощью транскриптомного анализа и соответствующих изменениям молочной продуктивности и состава молока (содержание белков и липидов). LONP2 и USP12 участвуют в метаболизме белков, тогда как M6PR играют роль в метаболизме углеводов. Интересно, что как miR-20a-5p , так и miR-142-5p потенциально нацелены на ELOVL6 , члена семейства элонгаз жирных кислот [67], которые участвуют в метаболизме липидов и сверхэкспрессируются в наших клетках. Образцы НЧ-СО. Ранее предполагалось, что в ткани молочной железы жвачных отсутствуют элонгазы [68], но данные указывают на присутствие ELOVL6 в молочной железе мышей [69–71], а также в молочной железе лактирующих коз [72].Хотя его функция в молочной железе еще не исследована, так же, как и в липогенных тканях, он может катализировать удлинение насыщенных и мононасыщенных жирных кислот с 12, 14 и 16 атомами углерода [60]. Поэтому необходимы дальнейшие исследования, чтобы расшифровать его роль в тканях молочной железы. Тем не менее, можно предположить, что более слабая экспрессия miR-20a-5p и miR-142-5p могла способствовать повышенной экспрессии ELOVL6 в молочных железах коров, получавших рацион LF-SO.

Чтобы оценить роль miR-20a-5p и miR-142-5p , эти микроРНК были сверхэкспрессированы в эпителиальной клеточной линии молочной железы крупного рогатого скота. Хотя miRNAs (по отдельности или вместе) высоко экспрессировались в трансфицированных клетках, они не приводили к значительному снижению экспрессии ELOVL6 . Однако сверхэкспрессия miR-1-3p , которая имеет три предполагаемые последовательности-мишени в ELOVL6 3’UTR, привела к значительному снижению экспрессии ELOVL6 , предполагая, что 3’UTR этого ген доступен для регуляции микроРНК.Мы можем предположить, что взаимодействие, предсказанное между miR-20a-5p и miR-142-5p в клетках BME-UV1, не происходит или что miRNAs влияет на уровень белка. Однако in vivo понижающая регуляция miR-20a-5p и miR-142-5p и активирующая регуляция ELOVL6 наблюдались в контексте лактации, что не было воспроизведено в культивируемые клетки, где клеточный контекст может влиять на функцию микроРНК [73]. Наконец, in vivo связь между этим геном и этими микроРНК, возможно, непрямая.

Таким образом, наше исследование подтверждает влияние липидных добавок на экспрессию микроРНК в молочной железе жвачных животных, как недавно наблюдали Li et al . [45]. Добавление подсолнечного масла изменило экспрессию miR-20a-5p и miR-142-5p . Эти микроРНК, регулируемые нутри, потенциально нацелены на DEG, который ранее был идентифицирован в тех же образцах. Однако мы также показали, что один из DEG, потенциально являющийся мишенью для этих двух микроРНК, ELOVL6 , не регулируется in vitro .Расшифровка функции этих miRNAs в молочной железе и особенно их влияние на гены, регулируемые нутрицией, будет иметь большое значение для понимания эффектов диеты на регуляцию синтеза и секреции молока. В дальнейших исследованиях регуляция микроРНК и их потенциальных мишеней, выделенных здесь, будет охарактеризована в других нутригеномных экспериментах для оценки их участия в модификации диеты в целом.

Благодарности

Авторы благодарят Л.Bernard, Y. Chilliard и J. Rouel за их помощь в экспериментах на животных и выделении тканей, персоналу отдела экспериментов на животных (UERT) и F. Dessauge за предоставление клеточных линий BME-UV1. Авторы также благодарят D. Durand за выполнение биопсии молочной железы. Особую благодарность они выражают также А. де ла Фойе за помощь в статистическом анализе и Э. Хонво Хоуэто за техническую помощь. Эта работа получила поддержку со стороны INRA, AIP BioRessources и ApisGène.

Каталожные номера

  1. 1.Шингфилд К.Дж., Чиллиард Ю., Тойвонен В., Кайрениус П., Гивенс Д.И. Трансжирные кислоты и биоактивные липиды в молоке жвачных животных. Adv Exp Med Biol. 2008 г.; 606: 3–65. пмид:18183924
  2. 2. Chilliard Y, Ferlay A. Влияние пищевых липидов и кормов на состав жирных кислот коровьего и козьего молока и органолептические свойства. Репрод Нутр Дев. 2004 г.; 44: 467–492. пмид:15636165
  3. 3. Bernard L, Leroux C, Chilliard Y. Экспрессия и пищевая регуляция липогенных генов в молочных железах жвачных животных.Adv Exp Med Biol. 2008 г.; 67–108.
  4. 4. Ollier S, Robert-Granié C, Bernard L, Chilliard Y, Leroux C. Анализ транскриптома молочных желез лактирующих коз, лишенных пищи, выявил гены, участвующие в секреции молока и запрограммированной гибели клеток. Дж Нутр. 2007 г.; 3: 560–567.
  5. 5. Ollier S, Leroux C, de la Foye A, Bernard L, Rouel J, Chilliard Y. Цельные неповрежденные семена рапса или подсолнечное масло в рационах с высоким содержанием фуража или с высоким содержанием концентратов влияют на надои, состав молока и профиль экспрессии генов молочной железы у коз.Дж. Молочная наука. 2009 г.; 92: 5544–5560. пмид:19841217
  6. 6. Мах Н., Ван Баал Дж., Круйт Л., Джейкобс А., Смитс М. Диетические ненасыщенные жирные кислоты влияют на целостность и здоровье молочной железы у лактирующих молочных коров. BMC Proc. 2011 г.; 3: 1753–6561.
  7. 7. Пиантони П., Дэниелс К.М., Эвертс Р.Е., Родригес-Зас С.Л., Левин Х.А., Херли В. и др. Уровень потребления питательных веществ влияет на профили экспрессии генов молочной железы у телок голштинской породы перед отъемом. Дж. Молочная наука. 2012 г.; 95: 2550–2561.пмид:22541482
  8. 8. Амброс В. Функции животных микроРНК. Природа. 2004 г.; 431: 350–355. пмид:15372042
  9. 9. Бушати Н., Коэн С.М. функции микроРНК. Annu Rev Cell Dev Biol. 2007 г.; 23: 175–205. пмид:17506695
  10. 10. Амерес С.Л., Заморе П.Д. Диверсификация последовательности и функции микроРНК. Nat Rev Mol Cell Biol. 2013; 14: 475–488. пмид:23800994
  11. 11. Бартель ДП. МикроРНК: геномика, биогенез, механизм и функция.Клетка. 2004 г.; 116: 281–297. пмид:14744438
  12. 12. Фарази Т.А., Хорлингс Х.М., Тен Хуве Дж.Дж., Михайлович А., Халфверк Х., Морозов П. и др. Анализ последовательности и экспрессии микроРНК в опухолях молочной железы методом глубокого секвенирования. Рак Рез. 2011 г.; 71: 4443–4453. пмид:21586611
  13. 13. Ле Гийу С., Марти С., Лало Д., Лобье Дж., Мобушон Л., Леру С. и др. Характеристика и сравнение микрономов молочных желез кормящих мышей и быков. ПЛОС Один. 2014; 9: e. пмид:24658750
  14. 14.Zhang C, Zhao Y, Wang Y, Wu H, Fang X, Chen H. Глубокое секвенирование РНК показывает, что микроРНК играют ключевую роль в лактации у крыс. Дж Нутр. 2014; 144: 1142–1149. пмид:24899157
  15. 15. Пэн Дж., Чжао Дж. С., Шен Ю. Ф., Мао Х. Г., Сюй Н. Ю. Профилирование экспрессии микроРНК в лактирующей молочной железе у пород свиней с дивергентным фенотипом. Int J Mol Sci. 2015 г.; 16: 1448–1465. пмид:25580536
  16. 16. Li Z, Liu H, Jin X, Lo L, Liu J. Профили экспрессии микроРНК из лактирующих и некормящих коровьих молочных желез и идентификация микроРНК, связанных с лактацией.Геномика BMC. 2012 г.; 13: 731. pmid:23270386
  17. 17. Li R, Zhang CL, Liao XX, Chen D, Wang WQ, Zhu YH и др. Профилирование транскриптомной микроРНК молочных желез крупного рогатого скота, инфицированных Staphylococcus aureus. Int J Mol Sci. 2015 г.; 16: 4997–5013. пмид:25749476
  18. 18. Ji Z, Wang G, Xie Z, Wang J, Zhang C, Dong F и др. Идентификация новых и дифференциально экспрессируемых микроРНК тканей молочной железы молочных коз с использованием секвенирования солекса и биоинформатики.ПЛОС Один. 2012 г.; 7: 14.
  19. 19. Ji Z, Wang G, Xie Z, Zhang C, Wang J. Идентификация и характеристика микроРНК в молочной железе молочной козы (Capra hircus) с помощью технологии глубокого секвенирования Solexa. Мол Биол Реп. 2012; 39: 9361–9371. пмид:22763736
  20. 20. Li Z, Lan X, Guo W, Sun J, Huang Y, Fang X и др. Сравнительное профилирование транскриптома микроРНК молочных коз из тканей молочных желез сухостойного периода и пиковой лактации. ПЛОС Один. 2012 г.; 7: e52388. пмид:23300659
  21. 21.Mobuchon L, Marthey S, Boussaha M, Le Guillou S, Leroux C, Le Provost F. Аннотация генома козы с использованием секвенирования следующего поколения микроРНК, экспрессируемой лактирующей молочной железой: сравнение трех подходов. Геномика BMC. 2015 г.; 16: 285. pmid:25888052
  22. 22. Танака Т., Ханеда С., Имакава К., Сакаи С., Нагаока К. МикроРНК, миР-101а, контролирует развитие молочной железы, регулируя экспрессию циклооксигеназы-2. Дифференциация. 2009 г.; 77: 181–187. пмид:1
  23. 78
  24. 23.Cui W, Li Q, Feng L, Ding W. MiR-126-3p регулирует рецепторы прогестерона и участвует в развитии и лактации молочной железы мыши. Мол Селл Биохим. 2011 г.; 355: 17–25. пмид:21526342
  25. 24. Ли М.Дж., Юн К.С., Чо К.В., Ким К.С., Юнг Х.С. Экспрессия миР-206 во время инициации развития молочной железы. Сотовые Ткани Res. 2013; 353: 425–433. пмид:23733266
  26. 25. Ли ХМ, Ван См, Ли QZ, Гао XJ. Mir-15a снижает жизнеспособность и лактацию эпителиальных клеток молочной железы крупного рогатого скота и регулирует экспрессию рецепторов роста.Молекулы. 2012 г.; 17: 12037–12048. пмид:23085654
  27. 26. Исау С., Канг X, Перальта Э., Хэнсон Э., Маркуссон Э.Г., Равичандран Л.В. и др. МикроРНК-143 регулирует дифференцировку адипоцитов. Дж. Биол. Хим. 2004 г.; 279: 52361–52365. пмид:15504739
  28. 27. Линн ФК. Метарегуляция: регуляция микроРНК метаболизма глюкозы и липидов. Тенденции Эндокринол Метаб. 2009 г.; 20: 452–459. пмид:19800254
  29. 28. Наканиси Н., Накагава Ю., Токусигэ Н., Аоки Н., Мацудзака Т., Исии К. и др.Активация микроРНК-335 связана с метаболизмом липидов в печени и белой жировой ткани мышей с генетическим ожирением. Biochem Biophys Res Commun. 2009 г.; 385: 492–496. пмид:19460359
  30. 29. Aranda JF, Madrigal-Matute J, Rotllan N, Fernandez-Hernando C. Модуляция микроРНК метаболизма липидов и окислительного стресса при кардиометаболических заболеваниях. Свободный Радик Биол Мед. 2013; 16: 00345–00346.
  31. 30. Ван Х., Луо Дж., Чен З., Цао В.Т., Сюй Х.Ф., Гоу Д.М. и др.МикроРНК-24 может контролировать синтез триацилглицерина в эпителиальных клетках молочной железы козы путем нацеливания на ген синтазы жирных кислот. Дж. Молочная наука. 2015 г.; 14: 00741–00749.
  32. 31. Wang H, Luo J, Zhang T, Tian H, Ma Y, XU H и др. МикроРНК-26a/b и их гены-хозяева синергически регулируют синтез триацилглицерина, нацеливая на ген INSIG1. РНК биол. 2016; 13: 500–510. пмид:27002347
  33. 32. Ван Х., Ши Х., Луо Дж., Йи Й., Яо Д., Чжан Х. и др. МиР-145 регулирует липогенез в клетках молочной железы козы посредством нацеливания на INSIG1 и эпигенетической регуляции генов, связанных с липидами.J Cell Physiol. 2017; 232: 1030–1040. пмид:27448180
  34. 33. Lin XZ, Luo J, Zhang LP, Wang W, Shi HB, Zhu JJ. Мир-27а подавляет накопление триглицеридов и влияет на экспрессию мРНК генов, связанных с жировым обменом, в эпителиальных клетках молочной железы молочных коз. Ген. 2013; 521: 15–23. пмид:23537996
  35. 34. Lin X, Luo J, Zhang L, Wang W, Gou D. MiR-103 контролирует накопление молочного жира в молочной железе козы (Capra hircus) во время лактации. ПЛОС Один. 2013; 8: e79258.пмид:24244462
  36. 35. Ле Гийу С., Сдасси Н., Лаубье Дж., Пассет Б., Вилот М., Кастиль Дж. и др. Сверхэкспрессия miR-30b в развивающейся молочной железе мыши вызывает дефект лактации и задерживает инволюцию. ПЛОС Один. 2012 г.; 7: е45727. пмид:23029204
  37. 36. Росс С.А., Дэвис К.Д. МикроРНК, питание и профилактика рака. Ад Нутр. 2011 г.; 2: 472–485. пмид:22332090
  38. 37. Izzotti A, Cartiglia C, Steele VE, De Flora S. МикроРНК как мишени для диетических и фармакологических ингибиторов мутагенеза и канцерогенеза.Мутационные исследования. 2012 г.; 751: 287–203. пмид:22683846
  39. 38. Шах М.С., Дэвидсон Л.А., Чапкин Р.С. Механистическое понимание роли микроРНК в раке: влияние перекрестных помех питательных веществ. Границы в генетике. 2012 г.; 3: 1–14.
  40. 39. Гарсия-Сегура Л., Перес-Андраде М., Миранда-Риос Дж. Новая роль микроРНК в регуляции экспрессии генов питательными веществами. J Нутригенет Нутригеномика. 2013; 6: 16–31. пмид:23445777
  41. 40. Миленкович Д., Джуд Б., Моран С.МикроРНК как молекулярная мишень полифенолов, лежащая в основе их биологических эффектов. Свободный Радик Биол Мед. 2013; 64: 40–51. пмид:23751562
  42. 41. Парра П., Серра Ф., Палу А. Экспрессия жировых микроРНК чувствительна к диетическому лечению конъюгированной линолевой кислоты у мышей. ПЛОС Один. 2010 г.; 5: e13005. пмид:20886002
  43. 42. Ромао Дж.М., Джин В., Хе М., Макаллистер Т., Гуань Л.Л. Измененная экспрессия микроРНК в подкожной и висцеральной жировой ткани крупного рогатого скота при различном питании.ПЛОС Один. 2012 г.; 7: е40605. пмид:22815773
  44. 43. Миле С.Дж., Ромао Дж.М., Хе М.Л., Чавес А.В., Макаллистер Т.А., Гуан Л.Л. Влияние диеты на экспрессию микроРНК в подкожной и висцеральной жировой ткани овец. J Anim Sci. 2014; 92: 3328–3337. пмид:24893997
  45. 44. Mobuchon L, Marthey S, Le Guillou S, Laloe D, Le Provost F, Leroux C. Пищевая депривация влияет на miRNome в молочной железе лактирующей козы. ПЛОС Один. 2015 г.; 10: e0140111. пмид:26473604
  46. 45.Ли Р., Бодуан Ф., Амма А.А., Биссоннетт Н., Бенчаар С., Чжао Х и др. Глубокое секвенирование показывает участие микроРНК в адаптации молочной железы крупного рогатого скота к рациону с добавлением льняного или сафлорового масла. Геномика BMC. 2015 г.; 16: 884. pmid:26519053
  47. 46. Leroux C, Bernard L, Faulconnier Y, Rouel J, de la Foye A, Domagalski J, et al. Нутригеномика молочной железы крупного рогатого скота и изменения в составе молока из-за добавления рапсового или подсолнечного масла в рационы с высоким содержанием фуража или с высоким содержанием концентратов.J Нутригенет Нутригеномика. 2016; 9: 65–82. пмид:27318968
  48. 47. Фарр В.К., Стельваген К., Кейт Л.Р., Моленаар А.Дж., Макфадден Т.Б., Дэвис С.Р. Усовершенствованный метод рутинной биопсии ткани молочной железы крупного рогатого скота. Дж. Молочная наука. 1996 год; 79: 543–549. пмид:8744218
  49. 48. Завизион Б., ван Даффелен М., Шеффер В., Политис И. Создание и характеристика эпителиальной клеточной линии бычьей молочной железы с уникальными свойствами. In Vitro Cell Dev Biol Anim. 1996 год; 32: 138–148. пмид:86
  50. 49.Фридлендер М.Р., Маковяк С.Д., Ли Н., Чен В., Раевски Н. MiRDeep2 точно идентифицирует известные и сотни новых генов микроРНК в семи группах животных. Нуклеиновые Кислоты Res. 2012 г.; 40: 37–52. пмид:215
  51. 50. Ливак К.Дж., Шмитген Т.Д. Анализ данных об относительной экспрессии генов с использованием количественной ПЦР в реальном времени и метода 2(-Delta Delta C(T)). Методы. 2001 25: 402–408. пмид:11846609
  52. 51. Андерс С., Хубер В. Дифференциальный анализ экспрессии для данных подсчета последовательностей.Геном биол. 2010 г.; 11: 2010–2011.
  53. 52. Бенджамини Ю., Хохберг Ю. Контроль частоты ложных открытий: практичный и мощный подход к множественному тестированию. JR Statist Soc B. 1995; 57: 289–300.
  54. 53. Paraskevopoulou MD, Georgakilas G, Kostoulas N, Vlachos IS, Vergoulis T, Reczko M, et al. Веб-сервер DIANA-microT v5.0: интеграция сервиса в рабочие процессы функционального анализа микроРНК. Нуклеиновые Кислоты Res. 2013; 41: 16.
  55. 54. Рау А., Галлопин М., Селё Г., Джафрезич Ф.Фильтрация на основе данных для повторяющихся экспериментов по секвенированию транскриптома с высокой пропускной способностью. Биоинформатика. 2013; 29: 2146–2152. пмид:23821648
  56. 55. Гит А., Двинге Х., Салмон-Дивон М., Осборн М., Каттер С., Хэдфилд Дж. и др. Систематическое сравнение профилирования микрочипов, ПЦР в реальном времени и технологий секвенирования следующего поколения для измерения дифференциальной экспрессии микроРНК. РНК. 2010 г.; 16: 991–1006. пмид:20360395
  57. 56. Там С., де Борха Р., Цао М.С., Макферсон Д.Д.Надежное глобальное профилирование экспрессии микроРНК с использованием технологий секвенирования нового поколения. Лаборатория Инвест. 2014; 94: 350–358. пмид:24445778
  58. 57. Карере Г.М., Гленн Д.П., Вандеберг Д.Л., Кокс Л.А. Дифференциальный ответ микроРНК на диету с высоким содержанием холестерина и жиров в печени павианов с низким и высоким уровнем холестерина ЛПНП. Геномика BMC. 2012 г.; 13: 1471–2164.
  59. 58. Могилянский Э., Ригуцос И. Кластер miR-17/92: всестороннее обновление его геномики, генетики, функций и все более важных и многочисленных ролей в здоровье и болезнях.Смерть клеток 2013; 20: 1603–1614. пмид:24212931
  60. 59. Чартумпекис Д.В., Заравинос А., Зирос П.Г., Искренова Р.П., Псирогианнис А.И., Кириазопулу В.Е. и соавт. Дифференциальная экспрессия микроРНК в жировой ткани после длительного ожирения у мышей, вызванного диетой с высоким содержанием жиров. ПЛОС Один. 2012 7: 4 e34872. пмид:22496873
  61. 60. Фан Дж., Рью К. Липин, ген липодистрофии и ожирения. Клеточный метаб. 2005 г.; 1: 73–83. пмид:16054046
  62. 61. Финк Б.Н., Гроплер М.С., Чен З., Леоне Т.С., Кроче М.А., Харрис Т.Е. и соавт.Липин 1 является индуцируемым усилителем печеночного регуляторного пути PGC-1alpha/PPARalpha. Клеточный метаб. 20106; 4: 199–210. пмид:16950137
  63. 62. Медина-Гомез Г., Грей С., Видал-Пуиг А. Адипогенез и липотоксичность: роль гамма-рецептора, активируемого пролифератором пероксисом (PPARгамма) и PPARгаммакоактиватора-1 (PGC1). Нутр общественного здравоохранения. 2007 г.; 10: 1132–1137. пмид:17

    1

  64. 63. Zhang JF, Fu WM, He ML, Xie WD, Lv Q, Wan G и др. МиРНК-20a способствует остеогенной дифференцировке мезенхимальных стволовых клеток человека путем совместной регуляции передачи сигналов BMP.РНК биол. 2011 г.; 8: 829–838. пмид:21743293
  65. 64. Бионаз М., Лоор Дж.Дж. Генные сети, управляющие синтезом жира коровьего молока во время лактационного цикла. Геномика BMC. 2008 г.; 9: 1471–2164.
  66. 65. Машек Д.Г., Маккензи М.А., Ван Хорн К.Г., Коулман Р.А. Крысиная длинноцепочечная ацил-КоА-синтетаза 5 увеличивает поглощение жирных кислот и их разделение на клеточный триацилглицерин в клетках McArdle-RH7777. Дж. Биол. Хим. 2006 г.; 281: 945–950. пмид:16263710
  67. 66. Ван С, Ву В, Кларет FX.Взаимная регуляция микроРНК и метилирования ДНК при раке человека. Эпигенетика. 2017; 12, 187–197. пмид:28059592
  68. 67. Якобссон А., Вестерберг Р., Якобссон А. Элонгазы жирных кислот у млекопитающих: их регуляция и роль в метаболизме. Прог Липид Рез. 2006 г.; 45: 237–249. пмид:16564093
  69. 68. Мур Дж. Х., Кристи В. В. Липидный обмен в молочной железе жвачных животных.; Метаболизм липидов у жвачных животных Christie e, Press, Оксфорд, Великобритания, изд. 1981.
  70. 69. Padovani M, Lavigne JA, Chandramouli GV, Perkins SN, Barrett JC, Hursting SD, et al. Различное влияние ограничения калорий и физических упражнений на экспрессию генов молочной железы у мышей C57BL/6. Рак Пред. Рез. 2009 г.; 2: 1076–1087.
  71. 70. Родригес-Крус М., Санчес Р., Санчес А.М., Келлехер С.Л., Санчес-Муньос Ф., Мальдонадо Дж. и др. Участие молочной железы в синтезе длинноцепочечных полиненасыщенных жирных кислот при беременности и лактации у крыс. Биохим Биофиз Акта.2011 г.; 4: 284–293.
  72. 71. Дориа М.Л., Рибейро А.С., Ван Дж., Котрим К.З., Домингес П., Уильямс С. и другие. Пути биосинтеза жирных кислот и фосфолипидов регулируются на протяжении всей дифференцировки эпителиальных клеток молочной железы и коррелируют с выживаемостью рака молочной железы. Фасеб Дж. 2014; 28: 4247–4264. пмид:24970396
  73. 72. Торал П.Г., Бернар Л., Делаво С., Груффат Д., Леру С., Шильярд Ю. Влияние рыбьего жира и дополнительного крахмала на профиль жирных кислот в тканях и изобилие мРНК липогенного гена у лактирующих коз, получавших диету, содержащую подсолнечное масло.Животное. 2013; 7: 948–956. пмид:23388097
  74. 73. Эрхард Ф., Хаас Дж., Либер Д., Мальтерер Г., Яскевич Л., Заволан М. и другие. Широко распространенная контекстная зависимость регуляции, опосредованной микроРНК. Геном Res. 2014; 24: 906–919. пмид: 24668909

План здорового питания на 7 дней (8-14 ноября)

опубликовано 5 ноября 2021 г. автором Джина

Этот пост может содержать партнерские ссылки. Прочтите мою политику раскрытия информации.

Бесплатный 7-дневный гибкий план питания для похудения, включающий завтрак, обед и ужин, а также список покупок.Рецепты включают макросы и WW Points.

7-дневный план здорового питания

Будь то День Благодарения или ранняя вечеринка в честь Дня Благодарения, никогда не помешает спланировать заранее! Нужно принести сторону? Попробуйте мои маффины с начинкой. Отвечает за зеленую фасоль? Попробуйте более легкую версию с моей облегченной запеканкой из зеленой фасоли. Заботиться о сладкой стороне? Попробуйте мой соус для тыквенного пирога (подавайте в маленькой тыкве для отличной презентации) или эти забавные шутеры с тыквенным чизкейком.

Почему каждый должен планировать питание?

Планирование питания — отличный способ спланировать питание на неделю вперед. Вы также экономите время и деньги в супермаркете! И, конечно же, планирование наперед поможет вам придерживаться ваших целей! Оцените мой новый планировщик еды Skinnytaste, на который уже можно оформить предварительный заказ!

О плане питания

Если вы новичок в моих планах питания, я делюсь этими бесплатными 7-дневными гибкими планами здорового питания (вы можете увидеть мои предыдущие планы питания здесь), которые предназначены в качестве руководства, с большим пространством для маневра для вас. чтобы добавить больше еды, кофе, напитков, фруктов, закусок, десерта, вина и т. д.или поменять местами рецепты блюд, которые вы предпочитаете, вы можете искать рецепты по курсам в указателе. Вы должны стремиться потреблять около 1500 калорий* в день.

Также есть точный, систематизированный список продуктов, который сделает покупки продуктов намного проще и менее напряженными. Сэкономьте деньги и время. Вы будете реже обедать вне дома, тратить меньше еды, и у вас будет все необходимое под рукой, чтобы не сбиться с пути.

Наконец, если вы зарегистрированы на Facebook, присоединяйтесь к моему сообществу Skinnytaste на Facebook, где все делятся фотографиями рецептов, которые они готовят, вы можете присоединиться здесь.Мне нравятся все идеи, которыми все делятся! Если вы хотите попасть в список рассылки, вы можете подписаться здесь, чтобы никогда не пропустить план питания!

ДЕТАЛИ:

Завтрак и обед с понедельника по пятницу рассчитаны на 1 человека, а ужины и все приемы пищи в субботу и воскресенье рассчитаны на семью из 4 человек. По некоторым рецептам остатков достаточно на два вечера или на обед на следующий день. Хотя мы искренне верим, что не существует единого плана питания, подходящего для всех, мы сделали все возможное, чтобы придумать что-то, что понравится широкому кругу людей.Все подходит для людей, следящих за фигурой, я включил обновленный WW Blue SP для вашего удобства, не стесняйтесь менять любые рецепты, которые вы хотите, или просто используйте это для вдохновения!

Полный список продуктов включает в себя все необходимое для приготовления всех блюд по плану. Я даже включил рекомендации брендов продуктов, которые я люблю и часто использую. Перепроверьте свои шкафы, потому что многие приправы, которые вы заметите, я использую часто, так что у вас их уже может быть много.

И последнее, но не менее важное: этот план питания является гибким и реалистичным.Здесь достаточно места для коктейлей, здоровых закусок, десертов и ужинов вне дома. И при необходимости вы можете переместить некоторые вещи, чтобы они соответствовали вашему расписанию. Пожалуйста, дайте мне знать, если вы используете эти планы, это поможет мне решить, следует ли мне продолжать делиться ими!

ПОНЕДЕЛЬНИК (8.11)
B: Киш без корочки * (5B 6G 5P) с апельсином (0B 0G 0P)
L: Бутерброд с салатом Chicken Club (5B 7G 5P) и яблоком (0B 0G 0P)
D: Грибной бефстроганов (9Б 10Г 9П) с зеленым салатом* (1Б 1Г 1П)

Итого: WW Points 20B 24G 20P, Калории 1023**

ВТОРНИК (9.11)
B: Киш без корочки (5B 6G 5P) с грушей (0B 0G 0P)
L: Салат из нута и тунца (0B 8G 0P) на 2 чашки смешанной зелени (0B 0G 0P)
D: Тако с курицей в медленноварке (7B 10G 7P)

Итого: WW Points 12B 24G 12P, Калории 1,085**

СРЕДА (10.11)
B: Киш без корочки (5B 6G 5P) с апельсином (0B 0G 0P)
L: Бутерброд с салатом Chicken Club (5B 7G 5P) и яблоком (0B 0G 0P)
D: говядина брокколи (7B 7G 7P) с ¾ чашки коричневого риса (5B 5G 0P)

Всего: Очки WW 22B 25G 17P, Калории 1126**

ЧЕТВЕРГ (11.11)
B: Тыквенный пирог с овсянкой на ночь (7B 7G 4P)
L: ОСТАЛОСЬ Салат из нута и тунца (0B 8G 0P) на 2 чашки смешанной зелени (0B 0G 0P)
D: Crock Pot Kid- Friendly Turkey Chili (0B 4G 4P) с 2 столовыми ложками сыра чеддер (2B 2G 2P) и 1 унцией авокадо (1B 1G 1P)

Итого: WW Points 10B 22G 11P, Калории 895**

ПЯТНИЦА (12.11)
B: Овсяные хлопья с тыквенным пирогом (7B 7G 4P)
L: LEFTOVER Crock Pot, подходит для детей с чили из индейки (0B 4G 4P) с 2 столовыми ложками сыра чеддер (2B 2G 2P) и 1 унцией авокадо (1B 1G 1P)
D: Пьяная лапша с креветками (9B 11G 9P)

Всего: Очки WW 19B 25G 20P, Калории 1,084**

СУББОТА (13.11)
B: Запеканка для завтрака Tex Mex (6B 8G 5P) и апельсин (0B 0G 0P)
L: Томатный суп быстрого приготовления с базиликом (5B 5G 5P) с жареным сыром # (7B 7G 7P)
D: ОБЕД

Всего: Очки WW 18B 20G 17P, Калории 725**

ВОСКРЕСЕНЬЕ (14.11)
B: ОСТАВШАЯСЯ запеканка для завтрака Tex Mex (6B 8G 5P) и 1 чашка винограда (0B 0G 0P)
L: Салат с нарезанными кусочками и салатом из курицы по-азиатски (8B 8G 8P)
D: Жареная куркума Курица и сладкий картофель (11B 11G 8P)

Всего: Очки WW 25B 27G 21P, Калории 1200**

*Приготовьте пирог с заварным кремом и беконом для обертывания в воскресенье, если хотите, и заморозьте оставшийся пирог с заварным кремом, который вы/ваша семья не будете есть.
Зеленый салат включает 6 чашек смешанной зелени, 2 зеленого лука, по ½ чашки каждого: помидоры, огурцы, морковь, нут и ¼ чашки легкого винегрета
.

**Это всего лишь ориентир, женщины должны потреблять около 1500 калорий в день. Вот полезный калькулятор для оценки ваших потребностей в калориях. Я оставил вам много места для маневра, чтобы вы могли добавить больше продуктов, таких как кофе, напитки, фрукты, закуски, десерт, вино и т. д.
# Жареный сыр включает 2 тонко нарезанных цельнозерновых хлеба и 1 ломтик (¾ унции) сыр чеддер.

*Документ Google

Распечатать список покупок

Список покупок

Продукция

  • 1 средний банан
  • 1 средняя груша (любой сорт)
  • 2 средних яблока (любого сорта)
  • 6 средних апельсинов
  • 1 средний лимон
  • 3 средних лайма
  • 1 фунт красного или зеленого винограда без косточек
  • 2 средние головки чеснока
  • 2 больших лука-шалота
  • 1 (3-дюймовый) кусочек свежего имбиря
  • 1 средний перец халапеньо
  • 1 маленький красный сладкий перец ПЛЮС 1 средний
  • 1 маленький (5 унций) ПЛЮС 1 средний (6 унций) ПЛЮС 1 большой (7 унций) авокадо Хасс
  • 1 маленький огурец
  • 1 небольшой пучок сельдерея
  • 1 небольшой пучок моркови
  • 1 фунт батата или батата
  • 5 унций нарезанных белых грибов
  • 8 унций нарезанных грибов Cremini или baby Bella
  • 3 ½ унции грибов шиитаке
  • 2 фунта соцветий брокколи
  • 3 больших пучка зеленого лука
  • 1 средний контейнер/пучок свежего тайского базилика (при желании можно заменить итальянским базиликом в «Пьяных креветках»)
  • 1 небольшой контейнер/пучок свежего базилика
  • 1 небольшой контейнер/пучок свежего тимьяна (при желании можно добавить пару щепоток сухого тимьяна в томатно-базиликовый суп)
  • 1 небольшой пучок свежей итальянской петрушки
  • 1 небольшой пучок свежей кинзы
  • 1 (1 фунт) пакет/раскладушка смешанная зелень
  • 1 пакетик (5 унций)/раскладушка для молодого шпината
  • 1 небольшой кочан салата романо
  • 1 средний кочан салата айсберг
  • 1 средний кочан салата бибб (при желании можно добавить листья айсберга в салат с куриным салатом)
  • 1 пакетик (нашинкованный) или кочан краснокочанной капусты
  • 3 средних спелых помидора
  • 1 маленькая красная луковица
  • 1 маленькая ПЛЮС 3 средние желтые луковицы

Мясо, птица и рыба

  • 1 упаковка колбасы из индейки (при желании можно заменить беконом в маленьком пироге с заварным кремом)
  • 1 упаковка бекона посередине
  • 1 маленькая упаковка чоризо
  • 6 унций нарезанной куриной грудки или индейки
  • стейк из пашины весом 1 фунт
  • 1.3 фунта 99% нежирного фарша из индейки
  • 1 ½ фунта куриной грудки без костей и кожи
  • 4 средних куриных голени
  • 4 средних куриных бедра на кости
  • 1 фунт куриного фарша
  • 1 фунт крупных очищенных креветок и креветок

Зерновые*

  • 1 буханка тонко нарезанного цельнозернового хлеба (мне нравится Dave’s Killer Bread)
  • 1 маленькая упаковка неотбеленной муки общего назначения
  • 1 маленькая упаковка овсяных хлопьев быстрого приготовления
  • 1 маленькая упаковка кукурузных лепешек (вам нужно 12 штук)
  • 1 упаковка (8 унций) очень широкой рисовой лапши
  • 1 небольшая упаковка сухого коричневого риса (или 3 чашки предварительно приготовленного)
  • 1 упаковка яичной лапши без желтка

Приправы и специи

  • Оливковое масло первого холодного отжима
  • Масло растительное
  • Кулинарный спрей
  • Спрей с оливковым маслом (или используйте масляный спрей Misto)
  • Кошерная соль (мне нравится Diamond Crystal)
  • Мельница для перца (или свежего перца горошком)
  • Белый перец (при желании можно заменить черным перцем в говядине и брокколи)
  • Майонез
  • Вустерширский соус
  • Тимьян
  • Красный винный уксус
  • Приправа Адобо
  • Чесночный порошок
  • Тмин
  • Соевый соус с обычным или пониженным содержанием натрия*
  • Кунжутное масло
  • Семена кунжута
  • Корица
  • Специя для тыквенного пирога
  • Порошок чили
  • Паприка
  • Лавровый лист
  • Устричный соус
  • Рыбный соус
  • Хойсин
  • Соус Шрирача
  • Рисовый уксус
  • Мед
  • Куркума
  • Молотый имбирь
  • Прованские травы или приправа для птицы
  • Легкая заправка винегрет (или приготовьте ее из ингредиентов, указанных в списке)

Молочные продукты и прочееОхлажденные продукты

  • 2 дюжины крупных яиц
  • 1 пакет (8 унций) тертого сыра чеддер
  • 1 пакет (8 унций) тертого сыра Colby-Monterey Jack
  • 1 упаковка (8 унций) нарезанного сыра чеддер
  • 1 маленькая коробка несоленого сливочного масла
  • 1 маленькая баночка сметаны с пониженным содержанием жира
  • 1 небольшой ломтик сыра пекорино романо
  • 1 литр 2% молока
  • 1 (12 унций) контейнер немолочного молока (можно заменить 1 стаканом 2% молока в овсяных хлопьях, при желании)
  • Взбитые сливки (по желанию, для тыквенного пирога с овсянкой)

Консервы и банки

  • 1 банка (8 унций) для каштанов
  • 1 (14.5 унций) банка нарезанного кубиками картофеля (при желании можно заменить 1 3/4 чашки нарезанного кубиками вареного картофеля)
  • 2 банки (4,5 унции) зеленого чили, нарезанного кубиками
  • 1 средняя банка молочной сальсы с кусочками молока
  • 1 маленькая банка каперсов
  • 1 банка (28 унций) целых помидоров сорта Сан-Марцано
  • 1 банка (10 унций) мягких помидоров RoTel, нарезанных кубиками
  • 1 банка томатного соуса (8 унций)
  • 1 банка (4 унции) или тюбик (4,5 унции) томатной пасты
  • 2 банки (15 унций) нута
  • 1 банка тунца (6 унций) в воде
  • 1 (32 унции) куриный бульон с пониженным содержанием натрия (32 унции)
  • 1 коробка (32 унции) овощного или говяжьего бульона с пониженным содержанием натрия
  • 1 маленькая баночка тыквенного масла (или ингредиенты для собственного приготовления)

Замороженный

РазноеГалантерея

  • 1 маленькая упаковка несоленых орехов кешью (при покупке оптом вам понадобится 2 столовые ложки)
  • 1 маленькая упаковка семян чиа (при покупке оптом вам понадобится 2 чайные ложки)
  • 1 небольшая упаковка орехов пекан, тыквенных семечек или грецких орехов (при покупке оптом вам понадобится 2 столовые ложки)
  • 1 бутылка белого вина
  • 1 маленькая упаковка темно-коричневого сахара
  • Кукурузный крахмал

Непродовольственные товары

Распечатать список покупок

.

Добавить комментарий

Ваш адрес email не будет опубликован.