Что такое флг в медицине расшифровка: Флюорография

Содержание

Флюорография – узнать об услуге, записаться на приём. Клиника МЕДСИ в Волгограде

Показания к диагностике

Сделать флюорографию следует при подозрениях на:

  • плеврит, пневмонию и иные воспалительные процессы в легких и окружающих их органах
  • туберкулез
  • заболевания легких и коронарных сосудов
  • опухолевые образования

С профилактической целью обследование ежегодно проводится:

  • всем лицам до 16 лет
  • пациентам медицинских учреждений при первичном обращении
  • молодым людям, которые призываются на срочную или контрактную военную службу
  • пациентам с подтвержденным ВИЧ-статусом
  • людям, которые проживают с беременной женщиной
  • лицам, которые контактируют с новорожденными детьми

Справка о выполненной флюорографии может потребоваться человеку, который планирует стать «партнером» беременной женщины на родах, пациенту, планирующему оперативное вмешательство, сотруднику вредного производства и др.

Многие ошибочно думают, что диагностика применяется только для выявления туберкулеза на стадии, когда симптомы этого заболевания еще не выражены. На самом деле сфера применения методики является намного более широкой.

Благодаря результатам обследования можно диагностировать и другие заболевания и патологические состояния, в числе которых добро- и злокачественные новообразования, участки воспалительных процессов, кисты, каверны, абсцессы, заполненные жидкостью или газами, а также склеротические изменения и фиброзы.

В обязательном порядке мы советуем сделать флюорографию в нашей клинике в Волгограде всем, кто длительное время страдает от непрекращающегося кашля, одышки, слабости и вялости.

Благодаря обследованию специалисты могут выявить анатомические особенности органов дыхания и сердечно-сосудистой системы, найти инородные предметы, заподозрить рак.

Как проходит процедура?

Флюорография легких и других органов занимает минимум времени. Обычно длительность процедуры составляет не более 5 минут (вместе с одеванием и раздеванием).

Проводится обследование поэтапно.

  • Пациент проходит в специальное помещение и раздевается до пояса
  • Затем он подходит к аппарату и поднимается на небольшой приступок, располагая подбородок в специальном углублении
  • Обследование начинается с задержки дыхания. При этом важно, чтобы пациент не двигался
  • Медсестра запускает аппарат и выполняет снимок

Пациенту можно одеваться.

Результаты обследования обычно выдаются на руки на следующий день или передаются лечащему врачу пациента.

Важно! Расшифровка проводится врачом, который располагает для этого всеми навыками и знаниями. Не следует пытаться самостоятельно поставить себе диагноз, а тем более назначать лечение!

Как подготовиться?

Обследование не требует специальной подготовки. Лишь курящим людям нужно на несколько часов отказаться от вредной привычки. Перед процедурой (если она запланирована на утренние часы) желательно легко позавтракать.

Противопоказания

Флюорография имеет минимальное количество противопоказаний. Она может проводиться практически всем категориям пациентов. Исключение составляют только беременные и кормящие женщины, а также больные тяжелыми формами дыхательной недостаточности. Так как флюорография выполняется стоя, пройти ее не смогут больные, которым необходимо соблюдать строгий постельный режим.

Преимущества диагностики в МЕДСИ

  • Опытный специалист. Он располагает всеми навыками и знаниями для выполнения флюорографии. Специалист выполняет манипуляции в соответствии с действующим протоколом, что позволяет избежать ошибок и неправильной трактовки результатов обследования
  • Современное оборудование. Процедура всегда проводится с использованием современного аппарата. Это обеспечивает точность манипуляций и их комфорт для пациента
  • Помощь московских специалистов. Мы пользуемся ей в сложных клинических случаях, при неоднозначности получаемых результатов. Это позволяет правильно поставить диагноз
  • Комфорт посещения клиники. Мы позаботились об отсутствии очередей и обеспечиваем внимательное отношение к каждому пациенту
  • Возможности для лечения выявленных патологий. При необходимости в клинике проводится и терапия заболеваний, которые обнаружены в рамках диагностики

Чтобы пройти флюорографию в нашей клинике в Волгограде платно, уточнить цену обследования, достаточно позвонить по номеру +7 (8442) 59-51-01. Наш специалист предоставит информацию о диагностике и запишет вас на удобное время.

Флюорография в Киеве: цены, 4392 отзывов

Флюорография (цифровой рентген легких) в Киеве – это метод диагностики легких, основанный на использовании рентгеновских лучей. Исследование дает возможность оценить общее состояние, структуру и объем органов. Проводится по назначению врача с целью постановки и уточнения диагноза, а также в качестве профилактического исследования взрослых с периодичностью 1 раз в год (людям, работающим на вредных производствах, проходить флюорографию рекомендуют 2 раза в год).

Прохождение флюорографии не требует специальной подготовки пациента: достаточно раздеться до пояса и снять металлические украшения. Во время процедуры пациент должен задержать дыхание на вдохе. В современных диагностических кабинетах специалисты используют цифровой или аналоговый аппараты для флюорографии. В большинстве случаев выбор аппарата не влияет на точность и способ проведения диагностики.

Флюорография легких может быть назначена при возникновении хрипов во время дыхания, при жалобах пациента на затрудненные вдохи и выдохи, при болезненных ощущениях в области груди, кровохаркании и других симптомах. В целях профилактики флюорографию проходят для своевременного обнаружения очагов туберкулеза, определения астмы, кист легких, выявления злокачественных и доброкачественных опухолей.

Ищете, где можно пройти или сделать флюорографию в Киеве? Выбрать лучший диагностический центр с флюорографическим кабинетом и записаться на прием можно на сайте Doc. ua.

Флюорография — диагностика с помощью рентгена органов грудной клетки, позволяющее выявить туберкулез, воспаление легких и другие изменения в тканях. С помощью данного метода исследования можно определить поздние стадии воспаления легких, склероз и фиброз, новообразования, патологические изменения (каверна, абсцесс, киста), инородные тела, наличие жидкости или воздуха в органах. Прохождение флюорографии показано каждый год, начиная с 16 лет, детям и взрослым. Это необходимо для предупреждения многих заболеваний. Цифровая флюорография – новый метод диагностики, являющийся наиболее информативным и безопасным. Она не наносит такого вреда, как обычный рентген, его снимки хранятся долгое время. Сделать флюорографию в поликлинике можно как бесплатно, так и платно и срочно. Современные медицинские центры располагают такой техникой. В данном разделе вы можете узнать график работы кабинета флюорографии в Киеве, цены на обследование и записаться на удобное время. Чтобы попасть на консультацию врача, нужно заполнить заявку на сайте.

В диагностическом центре вы можете пройти срочную платную флюорографию, детскую и взрослую. Стоимость обследования в Киеве указана на сайте.

Услуга Цена
Флюорография 120 грн
Флюорографія органів грудної клітини у прямій проекції 120 грн
Флюорография 300 грн
Флюорографія 310 грн
Флюорография цифровая с заключением (без выдачи снимка) 340 грн
Флюорографія цифрова з висновком (без видачі знімка) 340 грн
Флюорографія цифрова з висновком (без видачі знімка) 390 грн
Рентгенографія цифрова органів грудної клітини (одна проекція) 445 грн
Флюорографія цифрова з висновком (без видачі знімка) 450 грн
Флюорографія органів грудної клітини в одній проекції 450 грн

Расшифровка заключения флюорографии на справке — Вопрос пульмонологу

Если вы не нашли нужной информации среди ответов на этот вопрос, или же ваша проблема немного отличается от представленной, попробуйте задать дополнительный вопрос врачу на этой же странице, если он будет по теме основного вопроса. Вы также можете задать новый вопрос, и через некоторое время наши врачи на него ответят. Это бесплатно. Также можете поискать нужную информацию в похожих вопросах на этой странице или через страницу поиска по сайту. Мы будем очень благодарны, если Вы порекомендуете нас своим друзьям в социальных сетях.

Медпортал 03online.com осуществляет медконсультации в режиме переписки с врачами на сайте. Здесь вы получаете ответы от реальных практикующих специалистов в своей области. В настоящий момент на сайте можно получить консультацию по 74 направлениям: специалиста COVID-19, аллерголога, анестезиолога-реаниматолога, венеролога, гастроэнтеролога, гематолога, генетика, гепатолога, гериатра, гинеколога, гинеколога-эндокринолога, гомеопата, дерматолога, детского гастроэнтеролога, детского гинеколога, детского дерматолога, детского инфекциониста, детского кардиолога, детского лора, детского невролога, детского нефролога, детского онколога, детского офтальмолога, детского психолога, детского пульмонолога, детского ревматолога, детского уролога, детского хирурга, детского эндокринолога, дефектолога, диетолога, иммунолога, инфекциониста, кардиолога, клинического психолога, косметолога, липидолога, логопеда, лора, маммолога, медицинского юриста, нарколога, невропатолога, нейрохирурга, неонатолога, нефролога, нутрициолога, онколога, онкоуролога, ортопеда-травматолога, офтальмолога, паразитолога, педиатра, пластического хирурга, подолога, проктолога, психиатра, психолога, пульмонолога, ревматолога, рентгенолога, репродуктолога, сексолога-андролога, стоматолога, трихолога, уролога, фармацевта, физиотерапевта, фитотерапевта, флеболога, фтизиатра, хирурга, эндокринолога.

Мы отвечаем на 97.29% вопросов.

Оставайтесь с нами и будьте здоровы!

Памятка пациенту по плановой диагностической коронарной ангиографии (КАГ)

Плановая диагностическая коронарная ангиография (КАГ) — исследование сосудов сердца под рентгенологическим контролем. Это наиболее точный метод изучения артерий сердца, локализации и степени их сужения. Исследование проводится только в стационаре и в условиях рентгеноперационной.

Противопоказания к проведению КАГ
  • Отказ пациента от дальнейшего хирургического вмешательства
  • Аллергические реакции на контрастное вещество и непереносимость йода
  • Тяжелые заболевания печени и почек
  • Желудочно-кишечные, геммороидальные, маточные или иные кровотечения,
  • Обострение язвенной болезни;
  • Выраженные нарушения свертывания крови, тяжелая анемия;
  • ОНМК (в остром периоде),
  • Злокачественная артериальная гипертония (АГ), не поддающаяся медикаментозному лечению;
  • Декомпенсированная сердечная недостаточность, обострения тяжелого некардиологического хронического заболевания;
  • Лихорадка неизвестной этиологии и острые инфекционные заболевания.
КАГ может вызвать следующие осложнения:
  • Жизнеугрожающие аритмии
  • Остановка сердца
  • Развитие острого инфаркта миокарда (ОИМ) во время проведения исследования
  • Массивные кровотечения в месте артериального доступа
  • Нарушение целостности артерии
  • Анафилактический шок
  • Острая почечная недостаточность

В соответствии со Статьей 21. Выбор врача и медицинской организации Федерального закона от 21.11.2011 N 323-ФЗ (ред. от 03.04.2017) «Об основах охраны здоровья граждан в Российской Федерации» и Приказом Министерства здравоохранения и социального развития РФ от 26 апреля 2012 г. N 406н «Об утверждении Порядка выбора гражданином медицинской организации при оказании ему медицинской помощи в рамках программы государственных гарантий бесплатного оказания гражданам медицинской помощи»

пациент имеет право выбора медицинской организации.

Коронарная ангиография выполняется в условиях двух медицинских организаций Ставропольского края:

  1. ГБУЗ СК «Ставропольская краевая клиническая больница» — запись в Листе ожиданий после консультации и решения специалистов консультативно-диагностической поликлиники (г. Ставрополь, ул. Семашко, 1). Вызов из Листа ожидания проводится только координатором (каб. 217)
  2. ГБУЗ СК «Краевой клинический кардиологический диспансер» — после проведения консультации специалистами консультативно-поликлинического отделения (г. Ставрополь, ул. Пригородная, 224-а)

Данное исследование является дорогостоящим и сроки вызова пациента на плановую КАГ связаны с финансированием в системе обязательного медицинского страхования (ОМС), установлением плановых показателей в рамках Территориальной программы государственных гарантий бесплатного оказания гражданам медицинской помощи на территории Ставропольского края на 2017 год и плановый период 2018 и 2019 годов, наличием расходных материалов для её проведения, загруженностью и исправностью медицинского оборудования.

Важно!

Перед госпитализацией необходимо выполнить ряд обследований и анализов по месту жительства — план обследования выдается на руки во время консультации врачом кардиологом.
Обследование перед выполнением КАГ обязательно и выполняется для безопасности пациента.
Перед подготовкой к коронарной ангиографии пациенту необходимо выполнить фиброгастроскопию (давность исследования не более 2 месяцев).
При выявлении эрозий или язв необходимо провести соответствующее лечение и выполнить контрольную фиброгастроскопию.

Не более 4 месяцев (максимум):

  • Эхокардиография допплер
  • Холтеровское мониторирование ЭКГ
  • Дуплексное сканирование сонных артерий
  • Флюорография 1 год

За 1 месяц (максимум) до госпитализации выполняются:

  • анализ крови на ВИЧ, HbsAg, aHCV
  • при наличии хронического гепатита — справку от инфекциониста об активности гепатита
  • Данные о прививке от кори или определение иммуноглобулина IgG к вирусу кори — до 40 лет.

Не более 21 дня до госпитализации выполняются:

  • Общий анализ крови с подсчетом тромбоцитов, ЭДС
  • Общий анализ мочи, кал на яйца гельминтов
  • Липидограмма
  • Глюкоза крови
  • Креатинин, мочевина
  • Коагулограмма
  • АСТ, АЛТ
  • Электрокардиограмма с лентой ЭКГ

Подробная выписка из истории болезни или амбулаторной карты с данными предшествующего обследования и лечения. Результаты обследования представить только на бланках лаборатории, подлинники.

Результаты анализов не должны превышать допустимые нормы!

Пациенты, не выполнившие план обследования, не госпитализируются!

Важно!

Отмена метформина за 2 дня до предполагаемого исследования, варфарина за 5 дней с определением МНО за 2 дня до госпитализации, эликвис, прадакса, брилинта или ксарелто за 48 часов до предполагаемой даты госпитализации.

При поступлении необходимо иметь с собой:
  • Чистые диски DVD 2 шт.
  • Предметы личной гигиены, одноразовый бритвенный прибор (для подготовки к исследованию)
  • Тапочки, пижаму/халат
  • Копию паспорта, страхового медицинского полиса и СНИЛС

Сделать флюорографию легких в Туле, платно от мед.центра «Добрый доктор Н»

ФЛГ или флюорография – это своего рода рентген грудной клетки, который выводит на флуоресцентный экран продукт прохождения лучей через ткани организма.

Пройти данную процедуру необходимо:
  • для диагностики или исключения туберкулёза, или иных заболеваний лёгочной системы;
  • если есть подозрения на какую-либо лёгочную патологию;
  • при прохождения любых медицинских осмотров, в том числе перед военной службой;
  • при жалобах пациента на дискомфорт в данной области;
  • по назначению врача.

Если вам необходимо сделать ФЛГ в Туле, то мы предлагаем пройти его в многопрофильном центре «Добрый Доктор». У нас только новейшее оборудование и опытные специалисты.
Обратите внимание, что некоторые категории пациентов без показаний врача не смогут пройти данную процедуру. К таким категориям относятся беременные женщины и дети до 16 лет.

А для всех других, хотим напомнить, что все специалисты рекомендуют проходить такое обследование не реже 1 раза в год.

Как проходит процедура и нужно ли к ней готовиться

Флюорография – процедура, которая обычно занимает не более двух минут и не требует никакой особой подготовки. Это совершенно безболезненный метод диагностики.
Перед процедурой вам необходимо будет полностью раздеться выше пояса и снять все аксессуары (крестик, цепочку, кулоны, браслеты иногда серьги).
Результат пациент получает на руки на следующий день. При необходимости его можно показать лечащему врачу, однако, краткая расшифровка будет предоставлена вместе со снимком. Поэтому если всё хорошо, то необходимости в посещении специалиста нет. Разумеется, если у вас отсутствуют жалобы.
Благодаря высокой квалификации всех сотрудников нашего центра и оборудования европейского качества, вы можете быть уверены в том, что результат будет точный и очень информативный.

Ген FLG: MedlinePlus Genetics

Атопический дерматит

Мутации в гене FLG тесно связаны с кожным заболеванием, называемым атопическим дерматитом (также известным как атопическая экзема). Это состояние характеризуется сухой, зудящей кожей и красной сыпью. От 20 до 30 процентов людей с атопическим дерматитом имеют мутацию FLG гена по сравнению с 8-10 процентами населения в целом без атопического дерматита. Наличие мутации в этом гене только увеличивает риск развития атопического дерматита.Не у всех с мутацией гена FLG разовьется это заболевание. Другие гены и факторы окружающей среды способствуют развитию атопического дерматита. Лица с мутацией в обеих копиях гена FLG подвержены большему риску развития атопического дерматита, чем лица с мутацией только в одной копии гена. Состояние обычно более тяжелое у людей с двумя мутировавшими копиями.

В дополнение к мутациям гена FLG количество белков филаггрина, продуцируемых каждой молекулой профилаггрина, связано с развитием атопического дерматита; люди с генетическими инструкциями для производства 10 копий подвергаются большему риску развития расстройства, чем те, у кого есть инструкции для производства 11 или 12 копий.

Приблизительно 40 мутаций в гене FLG были обнаружены у людей с атопическим дерматитом. Эти мутации приводят к продукции аномально короткой молекулы филаггрина, которая не может быть расщеплена с образованием белков филаггрина. В результате нехватка филаггрина может нарушить барьерную функцию кожи. Кроме того, нехватка филаггрина приводит к нехватке естественного увлажняющего фактора, что приводит к потере лишней воды через кожу и вызывает сухость кожи у пострадавших людей.

Исследования показывают, что нарушение барьерной функции кожи, вызванное нехваткой филаггрина, способствует развитию аллергических заболеваний. Первоначально атопический дерматит не вызывается аллергической реакцией, хотя иногда считается, что вещества, которые могут вызывать аллергические реакции (аллергены), способствуют обострению сыпи. Кроме того, у людей с атопическим дерматитом повышена вероятность развития других аллергических заболеваний, включая астму, сенную лихорадку и пищевую аллергию.(Склонность к развитию аллергических заболеваний известна как атопия.)

Подробнее об этом состоянии здоровья

Генетика атопического дерматита: от последовательности ДНК до клинической значимости

Атопический дерматит (АД) представляет собой сложное заболевание, которое, как полагают, вызывается факторами окружающей среды у генетически предрасположенных лиц. Исследования близнецов оценили наследуемость БА примерно в 75% с нулевыми (потеря функции) мутациями гена, кодирующего филаггрин (FLG) (хромосома 1q21.3) как самый сильный известный генетический фактор риска. Открытие гена филаггрина сыграло важную роль в формирующейся модели патогенеза БА, сочетающей барьерную функцию кожи с адаптивным и врожденным иммунитетом. Благодаря недавнему развитию крупномасштабной высокопроизводительной геномики более 30 генетических локусов были связаны с AD в разных популяциях. Идентификация этих локусов вместе с функциональными исследованиями уже позволила по-новому взглянуть на биологию болезни и определить новые мишени для лекарств.Кроме того, эти локусы восприимчивости закладывают основу для общефеноменальных ассоциативных исследований для проверки их множественных фенотипических отношений и применения менделевской рандомизации для изучения причинно-следственных связей. Несмотря на множество известных генов, большая часть генетического риска БА еще не изучена. Таким образом, необходимы исследования, изучающие уточненные группы фенотипов, низкочастотные и редкие генетические вариации, взаимодействия ген-ген и/или ген-среда, эпигенетические механизмы и данные мультиомных технологий.В этом обзоре мы описываем генетические открытия для болезни Альцгеймера, включая результаты исследований генов-кандидатов, исследований генетических заболеваний, подобных болезни Альцгеймера, исследований ассоциаций всего генома и исследований генетического секвенирования. Мы объясняем, как некоторые из этих генетических открытий проливают свет на новые механистические представления о патогенезе болезни Альцгеймера, и приводим примеры того, как персональные генетические данные могут быть использованы для профилактических стратегий и индивидуального режима лечения (т. е. в прецизионной медицине).

Ключевые слова: Атопический дерматит; атопическая экзема; генетическая ассоциация; генетика; Полногеномные ассоциативные исследования; Менделевская рандомизация; общефеномные ассоциативные исследования; Последовательность действий.

Введение

Введение

Распространенность неалкогольной жировой болезни печени (НАЖБП) растет, в настоящее время поражая 14–24% населения в целом и до 80% лиц с морбидным ожирением [1]. Патофизиология НАЖБП сложна и до конца не выяснена. Однако все больше данных указывает на то, что воспаление и резистентность к инсулину являются важными факторами в его причинности. Предыдущие исследования предполагают, что воспалительные процессы при НАЖБП вызваны митохондриальной дисфункцией, окислительным стрессом и последующим перекисным окислением липидов [2].В то время как метаболические последствия НАЖБП хорошо задокументированы, точные механизмы, лежащие в основе, не совсем понятны. Недавно было признано, что бактериальные поверхностные молекулы, происходящие из кишечной микробиоты, при накоплении жира в печени [3,4]. Исследования на животных показали, что измененный состав микробиоты кишечника может вызывать воспаление кишечника, что приводит к утечке бактериальных компонентов кишечника или перемещению целых комменсальных бактерий в кровоток и периферические ткани хозяина [5–7]. Наши недавние результаты на людях позволяют предположить, что воспаление жировой ткани может быть ключевым связующим звеном между бактериальными молекулами кишечной микробиоты и НАЖБП [3]. В частности, у субъектов с высоким содержанием жира в печени повышена экспрессия воспалительных Vav1, Lat и MMP-9 в подкожной жировой ткани, которые, помимо функции трансэндотелиальной миграции лейкоцитов, являются компонентами сигнального пути Toll-подобного рецептора (TLR).

Члены семейства

TLR являются ключевыми медиаторами врожденной иммунной системы.Они распознают молекулы бактериальной поверхности, такие как липополисахариды (LPS) из внешней стенки грамотрицательных бактерий и флагеллин (FLG), который является структурным белком жгутика, бактериальной двигательной органеллой. Активация TLR приводит к плейотропной активации различных воспалительных и метаболических генов [8]. Предыдущие исследования показали, что три члена семейства TLR (TLR2, 4 и 9) играют роль в развитии НАЖБП [9]. Сообщалось о противоречивой роли TLR5, распознающего FLG [10–12]. Из рецепторов распознавания образов врожденной иммунной системы, которые обнаруживают экзогенные патогены, также были признаны Nod-подобные рецепторы (NLR) как связующее звено между иммунной функцией и метаболизмом [13]. Безусловно, пириновый домен, содержащий инфламмасому 3 (NLRP3), является наиболее изученной инфламмасомой из семейства NLR. Было обнаружено, что экспрессия NRLP3 повышена в жировой ткани субъектов с метаболическим синдромом и резистентностью к инсулину [14], а совсем недавно была признана его роль в регуляции прогрессирования НАЖБП [10].

Наши недавние результаты показали, что в адипоцитах бактериальных ФЛГ и ЛПС повышается секреция глицерина [15], который служит субстратом для синтеза печеночных триглицеридов. В резистентной к инсулину жировой ткани глицерин образуется в результате повышенного липолиза. Таким образом, в этом исследовании мы предположили, что уровни экспрессии TLR4 и TLR5 в жировой ткани и, возможно, других TLR и NOD-подобных рецепторов будут связаны с содержанием жира в печени и резистентностью к инсулину у людей. Чтобы проверить ассоциации и установить, что адипоциты являются связующим звеном между молекулами кишечного происхождения и гепатоцитами, в качестве модели вместо животных были выбраны клеточные культуры, чтобы исключить любые смешанные факторы.

Материалы и методыЧеловек-субъекты

Участники были набраны из более крупного исследования (AMB-исследование, программа Финской академии SKID-KID), проведенного в Университете Ювяскюля в соответствии с Хельсинкской декларацией и одобренного этическим комитетом Министерства здравоохранения Центральной Финляндии. округ. От всех участников исследования было получено письменное информированное согласие. Чтобы исключить искажающий эффект пола, в это исследование были включены только женщины. Всего было включено 23 женщины (возраст 18–57 лет).История болезни и текущий статус были проверены врачом-исследователем. Не было диабета 1 или 2 типа, сердечных заболеваний, аутоиммунных заболеваний или серьезных заболеваний печени (рак, гепатит). Все пациенты были клинически эутиреотичны.

Субъекты прошли пероральный тест на толерантность к глюкозе (ПГТТ) с дозой 75 г. Чувствительность всего организма к инсулину рассчитывали по значениям глюкозы и инсулина во время ПГТТ, как это было предложено Matsuda и DeFronzo [16]. Глюкозу измеряли с помощью анализатора KONELAB 20XTi (Thermo Fischer Scientific inc.) и сывороточный инсулин определяли иммуноанализом с использованием анализатора IMMULITE (Diagnostic Products Corporation, Los Angeles).

Биоптаты подкожной жировой ткани были взяты в стерильных условиях между 7 и 9 часами утра после ночного голодания. Биопсии замораживали в жидком азоте и хранили при -80°C до использования. Тотальную РНК выделяли с использованием систем FastPrep (MP Biomedicals, Франция) и мини-набора RNeasy Lipid Tissue Mini Kit (Qiagen, Валенсия, Калифорния, США), амплифицировали и обрабатывали с использованием экспресс-набора GeneChip 3´IVT (Affymetrix, Санта-Клара, Калифорния, США). и гибридизовали на планшетах Affymetrix Human Genome U219 Array, как описано ранее [3]. Из данных микрочипов жировой ткани были определены Toll-подобные рецепторы, NOD-подобные рецепторы и несколько уровней экспрессии генов, связанных с липолизом. Данные массива этого исследования были отправлены в ArrayExpress (E-MTAB-2649).

Оценка содержания жира в печени проводилась с помощью 1 H MRS (сканер 1,5T GE Signa CV/i, GE Medical Systems, Waukesha, WI, USA), как описано в Munukka et al. 2014.

Линии клеток, культуры и реагенты

преадипоцитов SGBS [17] поддерживали в среде DMEM/F12 с добавлением 10% FBS (Invitrogen), 0.17 мкМ пантотената плюс 0,33 мкМ биотина (P/B, Sigma Aldrich) и раствор пенициллина/стрептомицина (Invitrogen). Преадипоциты дифференцировали в зрелые адипоциты путем инкубации их сначала в течение 4 дней в среде DMEM/F12 с добавлением P/B, 0,01 мг/мл трансферрина, 20 нМ инсулина, 100 нМ кортизола, 0,2 нМ трийодтиронина, 25 нМ дексаметазона, 250 мкМ IBMX и 2 мкМ розиглитазона (QUICK DIF MEDIUM) (все от Sigma-Aldrich), а затем в DMEM/F12 с добавлением P/B, 0,01 мг/мл трансферрина, 20 нМ инсулина, 100 нМ кортизола и 0. 2 нМ трийодтиронина (3FC MEDIUM) в течение 10 дней. Когда адипоциты SGBS подвергались воздействию FLG для выделения РНК, 14-дневные дифференцированные адипоциты в 3FC MEDIUM обрабатывали в течение 1 и 4 часов 10 нг/мл FLG.

Когда клетки HepG2 подвергались воздействию кондиционированной культуральной среды SGBS, 14-дневные дифференцированные адипоциты в среде 3FC обрабатывали в течение 24 часов 100 нг/мл LPS или 10 нг/мл FLG. Было установлено, что эти концентрации эффективно влияют на адипоциты в нашем предыдущем исследовании 13 .Затем культуральную среду собирали и центрифугировали в течение 5 минут при 300×g. Затем свежесобранную кондиционированную культуральную среду наносили на клетки HepG2, которые предварительно дважды промывали PBS.

клетки гепатомы HepG2 (от ATCC) поддерживали в среде DMEM/Glutamax с добавлением 10% FBS, 100 ЕД/мл пенициллина, 100 мкг/мл стрептомицина и 1% пирувата натрия (все от Invitrogen, Карлсбад, Калифорния, США). Когда клетки HepG2 подвергались воздействию рекомбинантного FLG Salmonella typhimurium (Invivogen, Сан-Диего, Калифорния, США) и LPS Escherichia coli (Sigma-Aldrich, Сент-Луис, США), FBS исключали из среды, и клетки предварительно дважды промывали PBS. (Инвитроген).Чтобы имитировать условия, используемые для адипоцитов, для прямого воздействия HepG2 использовали LPS в концентрации 100 нг/мл и FLG в концентрации 10 нг/мл.

Иммунофлуоресценция

адипоцитов SGBS выращивали и позволяли дифференцироваться в течение 14 дней на покровных стеклах. Чтобы изучить влияние обработки FLG на липидные капли, FLG в концентрации 10 нг/мл добавляли к культуральной среде на 3 часа. После этого клетки дважды промывали PBS и фиксировали в течение 15 мин 4% PFA-PBS, пермеабилизировали 0,5% Triton-X в течение 5 мин, блокировали 1 час 5% ослиной сывороткой и затем инкубировали с первичными антителами в течение ночи при 4°С. С.Иммуномаркировку проводили с использованием кроличьего поликлонального антитела против TLR5 (Pierce, Appleton, WI, USA, 1:50 в 1% ослиной сыворотке) и мышиного моноклонального антитела против перилипина (Progen, Heidelberg, Германия, 1:200 в 1% ослиной сыворотке). В качестве вторичных антител использовали ослиные антимышиные Alexa Fluor 555 и ослиные антикроличьи 488 (Invitrogen). Меченые клетки визуализировали с помощью инвертированного широкопольного микроскопа (Carl Zeiss) с конфокальным блоком и объективом 40× масло/1,4 числовая апертура (Carl Zeiss). Для подсчета процента клеток, в которых липидные капли подверглись деградации, наблюдали 200 контрольных и обработанных FLG клеток в случайно выбранных полях с использованием 63×масла/л.4 Н/Д цель.

Экстракция РНК и количественная ПЦР в реальном времени. Клетки

HepG2 и SGBS гомогенизировали в реагенте Trizol (Invitrogen), а общую РНК экстрагировали в соответствии с протоколом поставщика. Тотальную РНК обратно транскрибировали в соответствии с инструкциями производителя с использованием набора для синтеза кДНК High Capacity (Applied Biosystems, Фостер-Сити, Калифорния, США). ПЦР-анализ в реальном времени выполняли в соответствии с рекомендациями MIQE с использованием праймеров собственной разработки (от Invitrogen), iQ SYBR Supermix и системы обнаружения ПЦР в реальном времени CFX96™ (Bio-Rad Laboratories, Ричмонд, Калифорния, США). Последовательности праймеров были следующими: IRS1: Fwd5’ TATGCCAGCATCAGTTTCCA’3 и Rev5’ GGATTTGCTGAGGTCATTTAGG’3; DGAT2: Fwd5’ GAGGGGTCTGGGAGATGG’3 и Rev 5’ CCTGTAGCTGCTTTTCCACC’3; β-актин: Fwd5’ AGAGCTAGCTGCCTGAC’3 и Rev5’GGATGCCACAGGACTCCA’3; MMP9: Fwd5’GAGTGGCAGGGGGAAGATGC’3 и Rev 5’CCTCAGGGCACTGCAGGATG’3; NFκB (p65): Fwd5’ATGGCTTCTATGAGGCTGAG’3 и Rev5’CACAGCATTCAGGTCGTAGT’3; GAPDH: Fwd5’CCACCCATGGCAAATTCC’3 и Rev5’TGGGATTTCCATTGATGACAA’3; ATGL: Fwd5’CAACGCCACGCACATCTA’3 и Rev5’ACCTCAATGAACTTGGCACC’3; MGL: Fwd5’TATGAAGAGCTGGTCCGGAT’3 и Rev5’TACCATCCTCTCCCCTTCG’3; FABP3: Fwd5’GCACCTGGAAGCTAGTGGAC’3 и Rev5’GTGGTAGGCTTGGTCATGCT’3, и PLIN1: Fwd5’ACCTTGCTGGATGGAGACC’3 и Rev5’AGGTCTTCTGGAAGCATTCG’3.

Все результаты для клеток HepG2 нормализовали по экспрессии β-актина, а для клеток SGBS — по экспрессии GAPDH. Относительные уровни экспрессии для каждого гена рассчитывали с помощью метода ΔΔC t (путем установки значения кратности изменения, равного 1, среднему значению Ct контрольных образцов). Эффективность амплификации для каждого гена составила 100±2%.

Экстракция белка и вестерн-блоттинг

Белки из клеток HepG2 экстрагировали при 4°C с использованием охлажденного льдом буфера для лизиса (10 мМ Tris-HCl, 150 мМ NaCl 2 , 2 мМ ЭДТА, 1% Triton X-100, 10% глицерин и 1 мМ DTT), дополненные ингибиторами протеазы и фосфатазы (Sigma Aldrich).20–30 мкг белковых экстрактов разделяли с помощью SDS-Page с использованием градиентных гелей Criterion 4–20% (Bio-Rad Laboratories, Ричмонд, Калифорния) и переносили на нитроцеллюлозные мембраны. После блокировки мембраны исследовали в течение ночи при 4°C первичными антителами, приобретенными у Cell Signaling Technology (Danvers, MA, USA) (p-Akt), Sigma-Aldrich (анти-GAPDH) и Abcam (MitoProfile® Total OXPHOS Rodent WB). Коктейль антител, Abcam, Кембридж, Массачусетс, США). В качестве вторичных антител использовали антикроличьи антитела Odyssey IRDye 800CW и антимышиные антитела IRDye 680RD (LI-COR Biosciences, Lincoln, NE, USA). Наконец, блоты сканировали и количественно определяли с использованием инфракрасного тепловизора Odyssey CLX компании Li-COR и программного обеспечения производителя. Если требовалось повторное зондирование, мембраны инкубировали в течение 10 мин в 0,2 М NaOH при комнатной температуре, промывали TBS и повторно зондировали соответствующими антителами. Все образцы и результаты были нормализованы к GAPDH.

Окрашивание Oil Red O для измерения нейтральных липидов в клетках HepG2 Краситель

Oil Red O (Sigma-Aldrich) использовали для окрашивания нейтральных триглицеридов и липидов в клетках HepG2. Вкратце, клетки HepG2 на 12-луночных культуральных планшетах подвергали воздействию в течение 24 часов либо непосредственно FLG и LPS, либо культуральной среды, полученной из обработанных адипоцитов.После этого клетки фиксировали 10% формалином, затем промывали H 2 O и 60% изопропанолом. После промывки клетки инкубировали с окрашивающим раствором Oil Red O при комнатной температуре в течение 10 мин. Перед элюированием окрашивающего раствора 100% изопропанолом и измерением оптической плотности при 550 нм клетки несколько раз промывали H 2 O.

Измерение АФК из клеток HepG2 с помощью люминесценции

Для измерения АФК клетки HepG2 обрабатывали FLG или LPS или культуральной средой из обработанных адипоцитов в течение 24 часов.АФК определяли с помощью нелитического анализа ROS-Glo™ h3O2 и системы мультидетекции Glomax (Promega, Мэдисон, Висконсин, США) в соответствии с инструкциями производителя.

Измерение глицерина в культуральной среде адипоцитов Адипоцитам

SBGS давали возможность дифференцироваться в течение 14 дней. Для измерения глицерина клетки обрабатывали FLG в течение 3 часов. Затем собирали среду для культивирования клеток и центрифугировали в течение 5 мин при 300×g. Глицерин измеряли с помощью анализатора KONELAB 20XTi (Thermo Fischer Scientific inc.).

Статистический анализ

Все данные были проверены на нормальность с помощью теста Шапиро-Уилка в PASW 18. 0 для Windows. Данные культуры клеток HepG2 анализировали с использованием ANOVA. Были проведены апостериорные тесты Бонферрони, чтобы локализовать влияние на результаты. Данные, полученные от клеток SGBS, обработанных FLG, анализировали с помощью Kruskal-Wallis. Для определения взаимосвязи между экспрессией генов жировой ткани и клиническими характеристиками был проведен корреляционный анализ Спирмена. Уровень значимости был установлен на уровне p<0.05.

Результаты Корреляция мРНК TLR4, TLR5 жировой ткани, а также других TLR и NOD-подобных рецепторов с содержанием жира в печени и чувствительностью к инсулину у людей

Средний возраст участников исследования составил 34 ± 15 лет. Все субъекты имели нормогликемию, а у троих была неалкогольная жировая дистрофия печени на основании клинико-диагностического порогового критерия (содержание жира в печени > 5,6%). Экспрессия TLR5 в жировой ткани тесно коррелировала с содержанием жира в печени (r = 0,699, p = 0,003) и индексом чувствительности к инсулину (r = -0,003). 529, р = 0,016, рис. 1А). Экспрессия TLR4 не была связана с содержанием жира в печени или чувствительностью к инсулину (рис. 1В). Из остальных TLR и NOD-подобных рецепторов TLR1 (r=-0,71, p<0,001), TLR2 (r=-0,599, p=0,005), TLR7 (r=-0,687, p=0,001), TLR8 (r=- 0,641, p = 0,002), NLRC4 (r = -0,505, p = 0,023) и NLRP3 (r = -0,628, p = 0,003) отрицательно связаны с индексом чувствительности к инсулину. В дополнение к TLR5 только NLRP3 положительно коррелировал с содержанием жира в печени (r = 0,545, p = 0,029).

10.1371/journal.pone.0152786.g001Рис. 1

Корреляция содержания жира в печени и индекса Мацуда (= чувствительность к инсулину) с (A) мРНК TLR5 жировой ткани и (B) мРНК TLR4 жировой ткани у людей (n = 23).

Влияние FLG и LPS на метаболизм липидов и содержание липидов в клетках HepG2

Далее мы определили основные механизмы, связывающие FLG с накоплением жира в печени и объясняющие отсутствие связи между TLR4 и содержанием жира в печени. Для этой цели клетки HepG2 либо подвергали непосредственному воздействию FLG и LPS, либо кондиционированной культуральной среде, полученной из адипоцитов, зараженных FLG и LPS. Прямое воздействие ЛПС на клетки гепатомы увеличивало синтез триглицеридов диглицерид-ацилтрансферазы 2, экспрессию DGAT2 через 24 часа и FLG через 4 и 24 часа (p<0,05). Однако прямое воздействие FLG или LPS не увеличивало содержание внутриклеточных липидов HepG2 (рис. 2А).

10.1371/journal.pone.0152786.g002Рис. 2

Прямое (A) и (B) опосредованное адипоцитами действие флагеллина и LPS на липидный метаболизм клеток HepG2. На рисунке представлены прямые и опосредованные адипоцитами эффекты FLG и LPS на изменения укладки мРНК DGAT2.Значения представляют собой средние значения + стандартное отклонение (n = 5). Результаты нормализовали по отношению к β-актину, и кратные изменения рассчитывали с помощью метода ΔΔC t . Столбцы с правой стороны графически представляют общее содержание липидов в клетках HepG2, измеренное спектрофотометрически с использованием Oil Red O после (A) прямого 24-часового воздействия FLG и LPS и (B) 24-часового воздействия кондиционированной среды, полученной из FLG и LPS- обработанные адипоциты. Значения представляют собой средние значения + стандартное отклонение (n = 12). * указывает на p-значение <0,05.

Воздействие на клетки HepG2 кондиционированной культуральной среды из адипоцитов, обработанных FLG и LPS, увеличивало экспрессию DGAT2 через 1 час, и, кроме того, кондиционированная среда, обработанная FLG, повышала экспрессию DGAT2 через 4 часа (p<0.05 для всех). Содержание липидов в клетках гепатомы было умеренно увеличено только при воздействии среды из адипоцитов, обработанных FLG (p<0,05, рис. 2B).

Воздействие FLG вызывает секрецию глицерола липидными каплями адипоцитов за счет увеличения экспрессии липолитических генов

Воздействие FLG на адипоциты увеличивает секрецию глицерина в культуральную среду (p<0,05, рис. 3A). Мы также определили влияние лечения FLG на экспрессию генов, связанных с липолизом, чтобы выявить механизмы, лежащие в основе высвобождения глицерина.Мы обнаружили, что после 1 часа воздействия FLG адипоциты экспрессировали больше жировой триглицеридлипазы (ATGL) и белка, связывающего жирные кислоты 3 (FABP3), а через 4 часа больше моноглицерид липазы (MGL) и меньше перилипина-1 (PLIN1) (p< 0,001 для всех, рис. 3В). Соответственно, в жировой ткани человека TLR5 положительно коррелировал с FABP3 (R = 0,549, p = 0,007) и отрицательно с PLIN1 (R = -0,631, p = 0,002).

10.1371/journal.pone.0152786.g003Рис. 3 Глицерин секретируется липидными каплями адипоцитов из-за повышенного липолиза в ответ на обработку флагеллином.

(A) Адипоциты обрабатывали FLG в течение 3 часов и измеряли глицерин в культуральной среде клеток. Значения представляют собой средние значения + стандартное отклонение (n = 4). * указывает на p-значение <0,05. (B) Адипоциты обрабатывали FLG в течение 1 и 4 часов и определяли изменения в экспрессии ATGL, PLIN1, FABP3 и мРНК MGL. Значения представляют собой средние значения + стандартное отклонение (n = 4). ** указывает p-значение <0,001. Результаты были нормализованы к GAPDH, и кратные изменения были рассчитаны с помощью метода ΔΔC t . (C) Адипоциты с 3-часовой обработкой FLG и без нее были помечены антителами к TLR5 и перилипину и визуализированы с помощью конфокального микроскопа. По сравнению с 30% в контрольных клетках, в 70% адипоцитов, обработанных FLG, наблюдалась деградация мембран липидных капель (маркировка перилипином красным цветом). В зрелых адипоцитах TLR5 в основном расположен во внутриклеточном пуле вблизи липидных капель и ядер без совместной локализации и лишь в меньшей степени на клеточных мембранах.

Чтобы визуализировать, был ли секретируемый глицерин получен из липидных капель адипоцитов, адипоциты, обработанные FLG, были помечены антителом против белка мембраны липидных капель, перилипина.Через 3 часа FLG индуцировал деградацию липидных капель, наблюдаемую как распад мембран липидных капель (рис. 3C). Деградация капель липидов наблюдалась в 70% адипоцитов, обработанных FLG, и только в 30% необработанных контрольных клеток. Кроме того, мы подтвердили наши более ранние выводы о том, что лишь небольшая часть пула TLR5 расположена на клеточных мембранах, а внутриклеточный пул вблизи ядер и липидных капель без какой-либо совместной локализации с этими структурами [15].

Влияние FLG и LPS на воспаление в клетках HepG2

После прямого воздействия на клетки HepG2 как FLG, так и LPS повышали экспрессию связанного с продукцией цитокинов ядерного фактора каппа B, NF-kB (p65) через 4 часа (p>0.05 для обоих, рис. 4А). Кроме того, LPS увеличивал количество расщепляющей внеклеточный матрикс матриксной металлопротеазы-9, мРНК MMP-9 через 4 часа и FLG через 24 часа (p<0,05 для обоих).

10.1371/journal.pone.0152786.g004Рис. 4

(A) Прямое и (B) опосредованное адипоцитами действие FLG и LPS на воспаление в клетках HepG2. На рисунке представлены изменения кратности мРНК NF-κB и MMP-9 в ответ на обработку через 4 и 24 часа. Результаты нормализовали по отношению к β-актину, и кратные изменения рассчитывали с помощью метода ΔΔC t .Значения представляют собой средние значения + стандартное отклонение (n = 5). Столбцы ниже графически представляют количество АФК, измеренное люминометрически, произведенное после 24-часового воздействия. Значения представляют собой средние значения + стандартное отклонение (n = 5). * указывает на p-значение <0,05.

В отличие от прямого воздействия, кондиционированные среды из адипоцитов, обработанных как FLG, так и LPS, незначительно снижали экспрессию NF-κB (p65) через 4 часа, а FLG-среды увеличивали ее через 24 часа (p<0,05 для всех, рис. 4B). ). Уровни мРНК ММР-9 повышались через 4 часа, а затем снижались после 24-часового воздействия (p<0,0.05 для всех).

Производство воспалительных активных форм кислорода (АФК) увеличилось после прямого воздействия на клетки HepG2 FLG и LPS (p<0,05 для обоих, рис. 4A). Кроме того, кондиционированная среда из адипоцитов, обработанных ЛПС, увеличивала продукцию АФК, а ФЛГ имел тенденцию к ее увеличению (р = 0,06, рис. 4В).

Влияние FLG и LPS на передачу сигналов инсулина в клетках HepG2

Прямое воздействие LPS на клетки гепатомы умеренно снижало экспрессию субстрата 1 инсулинового рецептора (IRS1) через 1 час, тогда как FLG повышало экспрессию IRS1 через 4 часа (p<0,0. 05 для обоих, рис. 5А). Фосфорилирование Akt ниже по сигнальному пути инсулина увеличивалось в ответ на лечение как LPS, так и FLG (p<0,05).

10.1371/journal.pone.0152786.g005Рис. 5

(A) Прямое и (B) опосредованное адипоцитами действие FLG и LPS на передачу сигналов инсулина в клетках HepG2. На фигуре представлены изменения кратности мРНК IRS1 в ответ на обработку в течение 1, 4 и 24 часов (n = 5) и уровни фосфорилирования Akt в ответ на обработку в течение 30 минут, 1 и 4 часа (n = 4).Результаты мРНК нормализовали по отношению к β-актину, а кратные изменения рассчитывали с помощью метода ΔΔC t . Уровни фосфорилирования Akt нормализовали к GAPDH, и определенные интенсивности полос вестерн-блоттинга представлены в произвольных единицах. Значения средние + стандартное отклонение. * указывает на p-значение <0,05.

Кондиционированная среда из адипоцитов, обработанных FLG, снижала мРНК IRS1 через 24 часа незначительно, но значительно (p<0,05, рис. 5B) и почти в 2 раза фосфорилировала Akt через 30 минут и 4 часа воздействия (p<0,0.05 для обоих).

Влияние FLG и LPS на экспрессию субъединиц комплекса митохондриальной дыхательной цепи в клетках HepG2

Прямое воздействие FLG и LPS на клетки гепатомы не оказывало существенного влияния на субъединицы комплекса митохондриальной дыхательной цепи (MRC) от I до V, за исключением что обработка LPS увеличивала экспрессию белка субъединицы АТФ-синтазы ATP5A (p<0,05, фиг. 6A). Напротив, кондиционированная среда, полученная из адипоцитов, обработанных FLG, снижала экспрессию белка ATP5A, а среды как FLG, так и LPS снижали экспрессию субъединицы цитохром-С-оксидазы MTCO1 (p<0.05 для всех, рис. 6А).

10.1371/journal.pone.0152786.g006Рис. 6

(A) Прямое и (B) опосредованное адипоцитами действие FLG и LPS на экспрессию субъединиц митохондриального комплекса дыхательной цепи в клетках HepG2. На рисунке представлены уровни экспрессии субъединиц митохондриального комплекса дыхательной цепи ATP5A (Compl V), UQCRC2 (Compl III), MTCO1 (Compl IV), SDHB (Compl II) и NDUFS8 (Compl I) в ответ на 4-х и 24-часовое воздействие ФЛГ и ЛПС. Все уровни экспрессии были нормализованы к GAPDH, и определенные интенсивности полос вестерн-блоттинга представлены в произвольных единицах.Значения представляют собой средние значения + стандартное отклонение (n = 3). * указывает на p-значение <0,05.

Обсуждение

Ось кишечник-печень в настоящее время считается важным путем в развитии и прогрессировании НАЖБП, но основные механизмы остаются в значительной степени неизвестными. Сообщалось о повышенных уровнях циркулирующих бактериальных поверхностных молекул, таких как ЛПС, у пациентов с НАЖБП и в моделях на животных [18–21]. Кроме того, была признана роль жировой ткани в накоплении жира в печени [22]. Однако возможность того, что кишечные бактериальные молекулы способствуют возникновению НАЖБП через жировую ткань, не рассматривалась, даже несмотря на то, что микробиота кишечника признана обильным источником, например, бактериальных FLG-компартментов, которые в дальнейшем вызывают различные физиологические и иммунологические процессы в организме хозяина. .В этом исследовании мы обнаружили тесную корреляцию содержания жира в печени и чувствительности к инсулину с уровнями экспрессии TLR5, распознающего FLG в жировой ткани, но не с распознающим LPS TLR4, который ранее был связан с НАЖБП. Наши исследования in vitro также показывают, что воздействие на клетки гепатомы человека кондиционированной культуральной среды адипоцитов, обработанных FLG, но не LPS, увеличивает синтез триглицеридов и умеренно увеличивает содержание липидов в клетках. Основные механизмы в клетках HepG2, наблюдаемые в этом исследовании, включают глицерин, полученный из адипоцитов, а также передачу сигналов инсулина и митохондриальные функции.

Результаты, показывающие, что FLG-распознающий TLR5 жировой ткани способствует накоплению жира в печени in vivo, согласуются с нашей предыдущей гипотезой о том, что воспаление жировой ткани действует как связующее звено между кишечной микробиотой (или производными от них поверхностными молекулами) и НАЖБП [3]. . Интересно, что не было обнаружено никаких связей между TLR4 и содержанием жира в печени, что согласуется с нашими предыдущими выводами о том, что люди с высоким содержанием жира в печени не отличались по уровням ЛПС в плазме от людей с низким содержанием жира в печени [3]. Однако эти результаты отличаются от нескольких других, демонстрирующих важную роль TLR4 при НАЖБП [9]. Возможно, эффекты TLR4 in vivo не универсальны и в значительной степени зависят от состава кишечной микробиоты, целостности кишечника и/или видов бактерий, из которых получены циркулирующие ЛПС.

Из других TLRs пептидогликан-распознающие TLR1 и TLR2 и одноцепочечные РНК-распознающие TLR7 и TLR8 связаны с чувствительностью к инсулину, что согласуется с их признанной ролью в связывании воспаления с метаболизмом [23].Было показано, что из NOD-подобных рецепторов NRLC4 является цитозольным рецептором флагеллина [24], а NRLP3 также связан с чувствительностью к инсулину. Однако кроме TLR5 только NRLP3 коррелировал с содержанием жира в печени. Ранее NRLP3 связывали с НАЖБП [10], ожирением и резистентностью к инсулину [25]. Считается, что он активируется в ответ на различные стимулы (например, ssRNA и LPS), включая целые патогенные агенты [26]. Тем не менее, остается неясным, что является реальным лигандом для NLRP3. Исследования показали, что он активируется АФК, предполагая, что это произойдет при продукции АФК, индуцированной TLR [26].Эта теория согласуется с нашим предыдущим исследованием, показывающим, что воздействие FLG на адипоциты человека увеличивает экспрессию TLR5 и продукцию АФК [15].

Наши результаты показывают, что FLG увеличивает секрецию глицерина адипоцитами за счет усиления липолиза и деградации липидных капель. Известно, что снижение действия инсулина в адипоцитах усиливает липолиз [27], и, как мы ранее показали, что FLG снижает передачу сигналов инсулина [15], это правдоподобная связь между FLG и липолизом.В липолитическом пути подавление PLIN1 активирует ATGL [27], что также можно наблюдать в наших результатах. ATGL расщепляет триглицериды до моноглицеридов, а моноглицериды MGL до глицерина, перенос которого из адипоцитов облегчается FABP3 [28]. На эти ключевые этапы липолиза в адипоцитах влияло воздействие FLG, что указывает на то, что FLG регулирует липолиз.

Ожидается, что глицерин, высвобождаемый из адипоцитов, увеличивает синтез триглицеридов в гепатоцитах, как и в печени, ферменты пути синтеза жира de novo используют углеводы и глицерин, полученные в результате липолиза жировой ткани, в качестве субстратов. Глицерин, образующийся в результате липолиза жировой ткани in vivo, поглощается печенью и используется для синтеза липидов [29]. Интересно, что, несмотря на то, что прямое воздействие также индуцировало экспрессию DGAT2, жир накапливался в клетках гепатомы только тогда, когда клетки подвергались воздействию среды, полученной из адипоцитов, обработанных FLG. Это может быть, по крайней мере частично, связано с тем, что в то время как среда, полученная из адипоцитов, обработанных FLG, снижала фосфорилирование Akt и, следовательно, передачу сигналов инсулина, прямое воздействие на клетки HepG2 увеличивало его.Повышенное фосфорилирование Akt в клетках HepG2 в ответ на молекулы бактериальной поверхности может быть связано с механизмом отрицательной обратной связи для воспаления, вызванного TLR [30]. Тем не менее, в целом нормальное митохондриальное дыхание и передача сигналов инсулина могут поддерживать правильный баланс между синтезом жира, окислением и клиренсом триглицеридов, тем самым предотвращая накопление жира клетками гепатомы, когда клетки непосредственно подвергаются воздействию бактериальных поверхностных молекул. Несмотря на то, что точные лежащие в основе регуляторные механизмы требуют дальнейшего внимания.

Мы дополнительно изучили основные механизмы, которые могут быть вовлечены в накопление жира гепатоцитами в ответ на FLG. Наши результаты показывают, что культуральная среда из адипоцитов, обработанных FLG, которая содержит глицерин, снижает экспрессию субъединиц комплекса MRC и имеет тенденцию к увеличению продукции АФК. Сообщалось о снижении MRC и активности АТФ-синтазы у пациентов с НАЖБП [31]. Когда жир накапливается в гепатоцитах, а нарушение MRC сочетается с повышенным окислением жирных кислот, увеличивается продукция АФК, которые вызывают клеточный метаболизм и воспалительные реакции [32].Таким образом, кажется, что как воспаление, так и поглощение глицерина способствуют накоплению жира в клетках HepG2, в то время как прямое воздействие на клетки FLG только увеличивает продукцию АФК, поддерживая нормальное внутриклеточное содержание липидов. Наши результаты согласуются с исследованиями, показывающими, что TLR и накопление липидов сами по себе увеличивают выработку АФК и воспаление [33,34]. Дисфункциональные MRC также были связаны со снижением передачи сигналов инсулина в печени [2], что согласуется с результатами этого исследования.

При прогрессировании НАЖБП воспалительные поражения в конечном итоге приводят к фиброзу. Печеночному фиброгенезу предшествует начальная деградация внеклеточного матрикса, позволяющая инфильтрировать воспалительные клетки в печень, и, наконец, описывается отложением внеклеточного матрикса. Одним из факторов, регулирующих фиброгенный процесс, являются АФК, которые в том числе модифицируют экспрессию матриксных металлопротеаз (ММП) [35]. В нашем исследовании FLG и LPS посредством их воздействия на адипоциты сначала увеличивали, а затем снижали экспрессию MMP-9, чего можно было бы ожидать, когда внеклеточный матрикс сначала разрушается, а затем откладывается.Прямое воздействие на клетки HepG2 сразу и в долгосрочной перспективе приводило к увеличению экспрессии MMP-9, что указывает на то, что фиброгенные процессы могут не активироваться. Однако наши результаты согласуются с предыдущими исследованиями, показывающими, что TLR регулируют экспрессию MMP [36] и профиброгенные ответы [37], и что накопление липидов само по себе активирует воспалительные ответы и экспрессию профиброгенных генов в гепатоцитах [38].

Недостатком этого исследования является то, что адипоциты не были отделены от других воспалительных процессов в жировой ткани в биоптатах человека.Следовательно, мы не можем исключить, что, например, макрофаги также могли способствовать уровням экспрессии TLR5 у людей. Тем не менее, эта неудача не исключает важности относительно умеренного, но четкого воздействия адипоцитов, обработанных FLG, на клетки гепатомы in vitro, предполагая, что ось адипоцитов-гепатоцитов представляет собой один путь, который приводит к накоплению жира в гепатоцитах. Кроме того, результаты клеточных культур ограничены тем фактом, что мы не меняли концентрации инсулина. Необходимы дальнейшие исследования, чтобы определить, усиливает или ослабляет инсулин действие FLG и LPS на гепатоциты.

Мы пришли к выводу, что жировая ткань, FLG-распознающая TLR5 и не распознающая LPS TLR4, связана с содержанием жира в печени и чувствительностью к инсулину у людей. Исследования in vitro выявили основные механизмы, показав, что активация TLR5 в адипоцитах, индуцированная флагеллином, может усиливать накопление жира в печени за счет снижения передачи сигналов инсулина и митохондриальных функций и увеличения синтеза триглицеридов из-за увеличения липолиза и секреции глицерола из адипоцитов.

Настройка флагов базы данных  | Облачный SQL для PostgreSQL  | Google Cloud

На этой странице описывается, как настроить флаги базы данных для Cloud SQL и перечисляет флаги, которые вы можете установить для своего экземпляра.Вы используете флаги базы данных для многих операций, включая настройку параметров PostgreSQL, настройку параметры, а также настройку и настройку экземпляра.

В некоторых случаях для установки одного флага может потребоваться установка другого флага для полностью включить желаемый функционал.

При установке, удалении или изменении флага для экземпляра базы данных может быть перезапущен. Затем значение флага сохраняется для экземпляра до тех пор, пока вы не убери это. Если экземпляр является источником реплики, а экземпляр перезапускается, реплика также перезапускается для согласования с текущей конфигурацией экземпляра.

Чтобы просмотреть все текущие значения настроек PostgreSQL, войдите в ваш экземпляр с

Обратите внимание, что вы можете изменить значение только для поддерживаемых флагов (как указано ниже).

Не указанные ниже флаги не поддерживаются.

Для данного флага Cloud SQL может поддерживать другой диапазон из соответствующего параметра или опции PostgreSQL.

Флаг Cloud SQL Тип
Допустимые значения и примечания
Перезапустить
Требуется?
auto_explain.log_analyze логическое значение
на | от
По умолчанию выключено .
Нет
auto_explain.log_buffers логическое значение
на | от
По умолчанию выключено .
Нет
auto_explain.log_min_duration Целое число
-1 . .. 2147483647
Нет
auto_explain.log_format Струна
текст|xml|json|yaml
Нет
auto_explain.log_level Струна
отладка5|отладка4|отладка3|отладка2|отладка1|отладка|
информация|уведомление|предупреждение|журнал
Нет
auto_explain.log_nested_statements логическое значение
на | от
По умолчанию выключено .
Нет
auto_explain.log_settings логическое значение
на | от
По умолчанию выключено .
Нет
auto_explain.log_timing логическое значение
на | от
По умолчанию на .
Нет
auto_explain.log_triggers логическое значение
на | от
По умолчанию выключено .
Нет
auto_explain.log_wal логическое значение
на | от
По умолчанию выключено .
Нет
auto_explain.log_verbose логическое значение
на | от
По умолчанию выключено .
Нет
auto_explain.sample_rate Поплавок
0 ... 1
Нет
автопылесос логический
на | от
Сведения об использовании, которые могут повлиять на SLA, см. Руководство по работе с Cloud SQL для экземпляров PostgreSQL.
autovacuum_analyze_scale_factor плавающий
0 100
autovacuum_analyze_threshold целое число
0 2147483647
autovacuum_freeze_max_age целое число
100000 . .. 2000000000
Сведения об использовании, которые могут повлиять на SLA, см. Руководство по работе с Cloud SQL для экземпляров PostgreSQL.
Да
autovacuum_max_workers Целое
1 варьируется (см. примечание) Примечание: Чтобы определить максимальное значение, которое вы можете установленный для этого флага, необходимо сначала вычислить число внутренних подключений, которые уже используются. Этот расчет представляет собой сумму значения для max_connections (максимальное количество клиентских подключений), autovacuum_max_workers (максимум количество процессов автоочистки) и макс_рабочие_процессы.Сумма не может превышать 262142 .
Да
autovacuum_multixact_freeze_max_age целое число
10000 . .. 2000000000
Сведения об использовании, которые могут повлиять на SLA, см. Руководство по работе с Cloud SQL для экземпляров PostgreSQL.
Да
autovacuum_naptime целое число
1 2147483 с
autovacuum_vacuum_cost_delay integer
0 100 мс или -1 для использования значения Vacuum_cost_delay
Для PostgreSQL 9.6, 10 и 11 значение по умолчанию равно 2.
autovacuum_vacuum_cost_limit целое число
0 . .. 10000 или -1 для использования значения Vacuum_cost_limit
autovacuum_vacuum_scale_factor плавающий
0 100
autovacuum_vacuum_threshold целое число
0 2147483647
autovacuum_work_mem целое число
0 2147483647 КБ или -1 для использования значения Maintenance_work_mem
checkpoint_completion_target плавающий
0. 0 1,0
контрольная точка_время ожидания целое число
30 86 400
Сведения об использовании, которые могут повлиять на SLA, см. Руководство по работе с Cloud SQL для экземпляров PostgreSQL.
контрольно-пропускной пункт_предупреждение целое число
0 2147483647 с
облакоsql.enable_auto_explain логический
на | от
по умолчанию: выкл. Примечание. Этот флаг относится к Cloud SQL.
Да
cloudsql.enable_pgaudit логический
на | от Примечание. Этот флаг относится к Cloud SQL. Дополнительные сведения об этом флаге см. Аудит PostgreSQL с помощью pgAudit.
Да
cloudsql.enable_pg_cron логический
на | от
по умолчанию: выкл. Примечание. Этот флаг относится к Cloud SQL.
Да
cloudsql.enable_pg_hint_plan логический
на | от
по умолчанию: выкл. Примечание. Этот флаг относится к Cloud SQL.
Да
cloudsql.enable_pglogical логический
на | от
по умолчанию: выкл. Примечание. Этот флаг относится к Cloud SQL. Дополнительные сведения об этом флаге см. Настройка логической репликации и декодирования.
Да
cloudsql.iam_authentication логический
на | от
по умолчанию: выкл. Примечание. Этот флаг относится к Cloud SQL.
Да
cloudsql.logical_decoding логический
на | от
по умолчанию: выкл. Примечание. Этот флаг относится к Cloud SQL. Дополнительные сведения об этом флаге см. Настройка логической репликации и декодирования.
Да
commit_delay целое число
0 100000
commit_siblings целое число
0 1000
ограничение_исключение перечисление
раздел | на | от
cpu_index_tuple_cost с плавающей запятой
0,0 . .. инф
cpu_operator_cost с плавающей запятой
0,0 инф
cpu_tuple_cost с плавающей запятой
0,0 инф
cron.имя_базы_данных Струна Да
хрон.log_statement логическое значение
на | от
По умолчанию на .
Да
cron. log_run логическое значение
на | от
По умолчанию на .
Да
cron.max_running_jobs Целое число
0 ... варьируется
Да
хрон.log_min_messages Струна
отладка5|отладка4|отладка3|отладка2|отладка1|отладка|
информация|уведомление|предупреждение|ошибка|журнал|фатальная|паника
Нет
cursor_tuple_fraction с плавающей запятой
0,0 1,0
deadlock_timeout целое число
1 . .. 2147483647 мс
default_statistics_target целое число
1 10000
default_tablespace струна
default_transaction_deferrable логический
на | от
default_transaction_isolation перечисление
сериализуемое | 'повторяемое чтение' | 'чтение подтверждено' | 'чтение незафиксированного'
эффективный_размер_кэша целое число
Диапазон размера составляет от 10% до 70% от размера экземпляра. Память.
Единица измерения: 8 КБ.
enable_bitmapscan логический
на | от
enable_hashagg логический
на | от
enable_hashjoin логический
на | от
enable_indexonlyscan логический
на | от
enable_indexscan логический
на | от
enable_material логический
на | от
enable_mergejoin логический
на | от
enable_nestloop логический
на | от
enable_seqscan логический
на | от
enable_sort логический
на | от
enable_tidscan логический
на | от
принудительный_параллельный_режим перечисление
от | на | регресс
from_collapse_limit целое число
1 . .. 2147483647
гэко логический
на | от
geqo_effort целое число
1 10
geqo_generations целое число
0 2147483647
geqo_pool_size целое число
0 2147483647
geqo_seed с плавающей запятой
0,0 . .. 1,0
geqo_selection_bias плавающий
1,5 2,0
geqo_threshold целое число
2 2147483647
gin_fuzzy_search_limit целое число
0 2147483647
gin_pending_list_limit целое число
64 2147483647 КБ
hot_standby_feedback логический
на | от
огромные_страницы перечисление
попытка | от
Да
idle_in_transaction_session_timeout целое число
0 . .. 2147483647 мс
join_collapse_limit целое число
1 2147483647
lock_timeout целое число
0 2147483647 мс
log_autovacuum_min_duration целое число
0 2147483647 мс или -1 для отключения
log_checkpoints логический
на | от
log_connections логический
на | от
log_disconnections логический
на | от
log_duration логический
на | от
log_error_verbosity перечисление
краткость | по умолчанию | подробный
log_executor_stats логический
на | от
log_hostname логический
на | от
log_lock_waits логический
на | от
log_min_duration_statement целое число
-1 . .. 2147483647 мс
log_min_error_statement перечисление
отладка5 | отладка4 | отладка3 | отладка2 | отладка1 | инфо | уведомление | предупреждение | ошибка | журнал | фатальный | паника
log_min_messages перечисление
отладка5 | отладка4 | отладка3 | отладка2 | отладка1 | инфо | уведомление | предупреждение | ошибка | журнал | фатальный | паника
log_parser_stats логический
на | от
log_planner_stats логический
на | от
log_replication_commands логический
на | от
log_statement перечисление
нет | ддл | мод | все
Установите значение mod для регистрации всех языков определения данных (DDL) операторы, а также операторы, изменяющие данные, такие как INSERT , UPDATE , DELETE , TRUNCATE
log_statement_stats логический
на | от
Нельзя включать вместе с log_parser_stats , log_planner_stats или log_executor_stats .
log_temp_files целое число
0 2147483647 КБ или -1 для отключения
Maintenance_work_mem целое число
1024 2147483647 КБ
макс_соединений целое
14 варьируется (см. примечание)
95 000 95002 400
Размер памяти (МБ) Значение по умолчанию Max Value
0 — 1,700 25 25
1 700 — 6000 50 30 000
6 000 — 7500 200 8 85 000
7500 — 120 000 400 200 000
120,00 и выше 120,00 и выше 1000 262 000

Примечание: Для определения максимальной ценности вы можете установленный для этого флага, необходимо сначала вычислить число внутренних подключений, которые уже используются. Этот расчет представляет собой сумму значения для max_connections (максимальное количество клиентских подключений), autovacuum_max_workers (максимум количество процессов автоочистки) и макс_рабочие_процессы. Сумма не может превышать 262142 .

Значение на репликах должно быть больше или равно значению на начальный. Изменения на первичном сервере распространяются на реплики, имеющие значение, ниже, чем новое значение на первичном, или которые не были изменены с значение по умолчанию.

Да
max_locks_per_transaction целое число
10 2 147 483 647

Значение на репликах должно быть больше или равно значению на начальный. Изменения на первичном сервере распространяются на реплики, имеющие значение, ниже, чем новое значение на первичном, или которые не были изменены с значение по умолчанию.

Да
max_parallel_maintenance_workers целое
0 варьируется Примечание: Ограничения на основе ОЗУ экземпляра, способом, описанным для max_worker_processes .

PostgreSQL 11 и выше

Да
max_parallel_workers целое
0 варьируется Примечание: Ограничения на основе ОЗУ экземпляра, способом, описанным для max_worker_processes .

PostgreSQL 10 и выше

Да
max_parallel_workers_per_gather целое число
0 . .. варьируется Примечание: Ограничения на основе ОЗУ экземпляра, способом, описанным для max_worker_processes .

PostgreSQL 9.6 и выше

Да
max_pred_locks_per_page целое число
... 2147483647
Да
max_pred_locks_per_relation целое число
-2147483648 ... 2147483647
Да
max_pred_locks_per_transaction целое число
64 ... 1048576 Примечание: Максимальное значение этого параметра масштабирует линейно с памятью, доступной на вашем экземпляре.
Размер памяти (ГБ) Максимальное значение
0 - 1 512
1 - 2 1024
2 - 4 2048
4 - 8 4096
8 - 16 8192
16 - 32 16384
32 - 64 32768
64 - 128 65536
128 - 256 131072 131072
256 - 512 262144
512 - 1024 524288
> 1024
1048576
Да
max_prepared_transactions целое число
0 ... варьируется
90 000
Размер памяти (MB) Макс. Значение
0 - 3,840 30 000
3840 - 7 680 85 000
7 680 - 15 360183 200 000
15 360 и выше 262 000

Значение на репликах должно быть больше или равно значению на начальный. Изменения на первичном сервере распространяются на реплики, имеющие значение, ниже, чем новое значение на первичном, или которые не были изменены с значение по умолчанию.

Да
max_replication_slots целое
10 ... варьируется Примечание: Максимальное значение этого параметра масштабирует линейно с памятью, доступной на вашем экземпляре.
Размер памяти (GB) Макс. Значение
0 - 4
10
4 - 16 4 9 32
16 - 32 128
32 - 64 256
64 -128 512 512 512 - 256 1024 1024
256 - 512 2048
> 512 4096

Для получения дополнительной информации об этом флаг см. Настройка логической репликации и декодирования.
Да
max_standby_archive_delay целое число
0 ... 2147483647 мс, или -1 ждать вечно
max_standby_streaming_delay целое число
0 ... 2147483647 мс или -1 для ожидания навсегда
max_wal_senders целое число
10 ... варьируется Примечание: Максимальное значение этого параметра масштабирует линейно с памятью, доступной на вашем экземпляре. Это значение должно быть установлено на значение, большее или равное значению max_replication_slots .
Размер памяти (GB) Макс. Значение
0 - 4
10
4 - 16 4 9 32
16 - 32 128
32 - 64 256
64 -128 512 512 512 - 256 1024 1024
256 - 512 2048
> 512 4096

Для получения дополнительной информации об этом флаг см. Настройка логической репликации и декодирования.
Да
max_wal_size целое число
2 ... 2147483647

Единица измерения составляет 16 МБ (размер файла WAL) для версии 9. 6 и 1 МБ для PostgreSQL 10 и выше.

Информацию об использовании, которая может повлиять на SLA, см. Руководство по работе с Cloud SQL для экземпляров PostgreSQL.
max_worker_processes целое число
8 ... варьируется Примечание: Максимальное значение этого параметра масштабирует линейно с памятью, доступной на вашем экземпляре.
Размер памяти (GB) Max Value
0 - 8
10
8 - 16 16
16 16 - 32 32
32 - 64 64
64 -128 128 128
128 - 256 256 256
256 - 512 512
> 512 1024

Для получения дополнительной информации об этом флаг см. Настройка логической репликации и декодирования.
Да
min_parallel_relation_size целое число
0 ... 715827882
Блок 8 КБ
min_wal_size целое число
32 ... 2147483647

Единица измерения составляет 16 МБ (размер файла WAL) для версии 9.6 и 1 МБ для PostgreSQL 10 и выше.

old_snapshot_threshold целое число
0 ... 86400 мин или -1 для отключения
Да
параллельная_настройка_стоимость с плавающей запятой
0,0 . .. инф
parallel_tuple_cost с плавающей запятой
0,0 ... инф
пароль_шифрование перечисление
md5 | скрам-ша-256

Постгрес 10, 11, 12 и 13.

по умолчанию md5 .

pg_hint_plan.enable_hint логическое значение
на | от
По умолчанию на .
Нет
pg_hint_plan.debug_print Струна
выключено|включено|подробно|подробно|0|1||2|3|нет|да|ложь|истина
Нет
pg_hint_plan. parse_messages Струна
отладка5|отладка4|отладка3|отладка2|отладка1|отладка|
информация|уведомление|предупреждение|ошибка|журнал
Нет
pg_hint_plan.message_level Струна
отладка5|отладка4|отладка3|отладка2|отладка1|отладка|
информация|уведомление|предупреждение|ошибка|журнал
Нет
pg_hint_plan.enable_hint_table логическое значение
на | от
По умолчанию выключено .
Нет
pglogical.batch_inserts логический
на | от
по умолчанию: на Примечание: Сведения о функции, использующей этот флаг, см. Настройка логической репликации и декодирования.
Да
pglogical.conflict_log_level Строка
по умолчанию: ЖУРНАЛ .
Этот флаг принимает те же значения, что и log_min_messages . Примечание: Сведения о функции, использующей этот флаг, см. Настройка логической репликации и декодирования.
pglogical.conflict_resolution Строка
ошибка|apply_remote|keep_local|last_update_wins|first_update_wins
по умолчанию: apply_remote Примечание: Значения keep_local , last_update_wins и first_update_wins требуется track_commit_timestamps для включения на обоих узлах. Сведения о функции, использующей этот флаг, см. Настройка логической репликации и декодирования.
pglogical.extra_connection_options Строка
Принимает PostgreSQL строки соединения ключевое слово/значение.
По умолчанию используется пустая строка. Примечание: Сведения о функции, использующей этот флаг, см. Настройка логической репликации и декодирования.
pglogical.synchronous_commit логический
на | от
по умолчанию: на Примечание: Сведения о функции, использующей этот флаг, см. Настройка логической репликации и декодирования.
Да
pglogical.use_spi логический
на | от
по умолчанию: выкл. Примечание: Сведения о функции, использующей этот флаг, см. Настройка логической репликации и декодирования.
Да
pg_stat_statements.max целое число
100 ... 2147483647
Да
pg_stat_statements.save логический
на | от
pg_stat_statements.track перечисление
нет | топ | все
pg_stat_statements. track_utility логический
на | от
pgaudit.log перечисление
чтение | написать | функция | роль | ддл | разное | misc_set | все|нет

Вы можете указать несколько классов, используя список, разделенный запятыми, и вычесть класс, предваряя класс с помощью знак - .По умолчанию нет .

pgaudit. log_catalog логический
на | от

По умолчанию на .

pgaudit.log_client логический
на | от

По умолчанию отключено от .

пгаудит.лог_уровень перечисление
отладка5 | отладка4 | отладка3 | отладка2 | отладка1 | инфо | уведомление | предупреждение | ошибка | журнал

По умолчанию журнал . Кроме того, pgaudit.log_level включается только при pgaudit.log_client включен.

пгаудит.log_параметр логический
на | от

По умолчанию отключено от .

pgaudit.log_relation логический
на | от

По умолчанию отключено от .

pgaudit.log_statement_once логический
на | от

По умолчанию отключено от .

pgaudit.role струна

Нет значения по умолчанию.

random_page_cost с плавающей запятой
0,0 ... инф
replace_sort_tuples целое число
0 ... 2147483647
общие_буферы целое число
Диапазон размера составляет от 10% до 60% от размера экземпляра. Память.
Единица измерения: 8 КБ.
Да
ssl_max_protocol_version перечисление
Postgres 12: устанавливает максимальный SSL/TLS используемая версия протокола. Допустимые значения как для ssl_min_protocol_version с добавлением пустой строки, что позволяет указать любую версию протокола.
ssl_min_protocol_version перечисление
Postgres 12: устанавливает минимальный SSL/TLS используемая версия протокола.Допустимые значения в настоящее время: TLSv1 , TLSv1.1 , TLSv1.2 , TLSv1.3 .

По умолчанию используется TLSv1 .

стандартные_соответствующие_строки логический
на | от
синхронизация_seqscans логический
на | от
tcp_keepalives_count целое число
0 . .. 2147483647
tcp_keepalives_idle целое число
0 ... 2147483647
tcp_keepalives_interval целое число
0 ... 2147483647
temp_buffers целое число
100 ... 1 073 741 823
Блок 8 КБ
temp_file_limit целое число
1048576 . .. 2147483647 КБ
трассировка_уведомление логический
на | от
trace_recovery_messages перечисление
отладка5 | отладка4 | отладка3 | отладка2 | отладка1 | журнал | уведомление | предупреждение | ошибка
трассировка_сортировка логический
на | от
track_activities логический
на | от
track_activity_query_size целое число
100 . .. 102400
Да
track_commit_timestamp логический
на | от
Да
количество треков логический
на | от
трек_функции перечисление
нет | пл | все
track_io_timing логический
на | от
вакуум_стоимость_задержка целое число
0 . .. 100 мс
вакуум_стоимость_лимит целое число
1 ... 10000
вакуум_замораживание_мин_возраст целое число
0 ... 1000000000
вакуум_замораживание_таблица_возраст целое число
0 ... 2000000000
вакуум_multixact_freeze_min_age целое число
0 ... 1000000000
вакуум_multixact_freeze_table_age целое число
0 . .. 2000000000
wal_buffers целое число
Диапазон размеров от -1 до 5% от размера экземпляра Память.
Единица измерения: 8 КБ.
Да
wal_compression логический
на | от
wal_receiver_timeout целое число
0 ... 2147483647
Значение по умолчанию — 60 секунд.

Этот флаг влияет на отправителя и получателя WAL. Если этот флаг не установлен должным образом, он влияет на логическая и физическая репликация. Этот флаг также влияет на репликацию производительность и задержка. Нулевое значение отключает механизм тайм-аута. Единица измерения — миллисекунды.

wal_sender_timeout целое число
0 ... 2147483647
Значение по умолчанию — 60 секунд.

Этот флаг влияет на отправителя и получателя WAL. Если этот флаг не установлен должным образом, он влияет на логическая и физическая репликация. Этот флаг также влияет на репликацию производительность и задержка. Нулевое значение отключает механизм тайм-аута. Единица измерения — миллисекунды.

рабочая_память целое число
64 . .. 2147483647 КБ

Расшифровка медицинских рецептов с помощью Wolfram|Alpha—Wolfram|Alpha Blog

Я не врач, но для целей этой записи в блоге представьте, что я ношу лабораторный халат и стетоскоп — может быть, даже два стетоскопа, просто для дополнительного профессионализма. Wolfram|Alpha теперь понимает сиг-коды, которые представляют собой отметки на ваших рецептах на лекарства, которые сообщают фармацевту, что именно вы получаете, что оно делает и когда именно его следует принимать.В наши дни пациенты не часто сталкиваются с сиг-кодами, но фармацевты узнают их, так как они получают эти сокращенные инструкции от врача. Если вы подвергаетесь воздействию сиг-кодов, они написаны на листе бумаги, который ваш врач дает вам, чтобы отнести к фармацевту.

Я всегда считал, оказывается, неправильно, что врачи пишут в рецептах настоящие слова, и просто ужасно читал то, что они писали. На самом деле они использовали сиг-коды, похожие на стенографию, и для фармацевтов очень важно знать, что они обозначают, тем более что я мог легко увидеть, как букву «В» ошибочно принимают за букву «Д» или букву «Е». ошибочно принимают за «Ф.

Итак, давайте начнем с чего-нибудь простого. Если вы хотите определить только один код, нет проблем. Многие сиг-коды являются аббревиатурами латинского языка, поэтому сиг-код BID означает «би в штампе» или два раза в день. Мы также предоставляем аналогичные написанные коды и их описания. (Черт возьми, Джим, я врач, а не лингвист.)

Тем не менее, вы также можете комбинировать несколько сиг-кодов вместе, и мы будем интерпретировать входные данные в том порядке, в котором они заданы. Просто введите сиг-коды в строку запроса Wolfram|Alpha, и мы предоставим вам массу информации о них.

В приведенном выше случае мы видим, что Амоксициллин 250/5 мл. 1 чайная ложка PO TID X10D означает, что вы принимаете 250 мл амоксициллина по одной чайной ложке внутрь три раза в день в течение десяти дней. После этого мы покажем вам структурную схему амоксициллина, а также его трехмерную структуру, какие лекарства взаимодействуют с ним и каковы его основные лекарственные свойства. (В данном случае это антибактериальное средство.)

В силу того факта, что сиг-коды представляют собой латинские сокращения, на рецепте вполне можно было увидеть «PO QAM».Если бы я не знал, что это имеет особое значение, это заставило бы меня думать, что я сумасшедший.

Так что же означает «PO QAM»? Внутрь, каждое утро. В частности, приведенный выше запрос предназначен для пациента, чтобы он прекратил прием Левоксила и начал принимать Синтроид, антитиреоидный агент. После приема препарата в таблетированной форме пациенту следует воздерживаться от приема пищи в течение одного часа.

Чтобы интерпретировать различные сиг-коды в Wolfram|Alpha, введите «сиг-код», а затем остальную часть запроса.Просто имейте в виду, что, хотя мы можем сообщить вам, что представляют собой различные коды и лекарства, мы интерпретируем их по мере их ввода, поэтому на случайный выбор кодов не следует полагаться почти так же, как на то, что вам прописывает врач.

Добавить комментарий

Ваш адрес email не будет опубликован.