Для нормализации стула: Запор: как наладить стул?

Содержание

Как нормализовать работу кишечника? | Еженедельник АПТЕКА

Дискомфорт, урчание, ощущение тяжести и вздутие живота — симптомы, свидетельствующие о проблемах с кишечником, с которыми так или иначе сталкивался, пожалуй, каждый из нас. Причин этому может быть множество, ведь жизнь современного человека буквально насыщена факторами, способными ухудшить здоровье кишечника: любовь к фастфуду и перекусы бутербродами, сидячая работа и пассивный отдых дома, стрессы, недостаточное употребление жидкости — лишь краткий их перечень. Поэтому многим из нас сегодня пригодится помощник, включение которого в рацион питания поможет позаботиться о сохранении здоровья кишечника, а именно: нормализовать стул и восстановить баланс микрофлоры. О нем и пойдет речь далее.

Для устранения деликатных проблем с кишечником, пожалуй, стоит начать с коррекции питания, ведь несбалансированная диета способна приводить к нарушению стула — запору или диарее. В свою очередь, рафинированные и консервированные продукты, составляющие значительную часть рациона, особенно в холодное время года, существенно влияют на микрофлору кишечника, вызывая гибель ее облигатных микроорганизмов (Конев Ю.

В., 2005). Поэтому для устранения дисбактериоза кишечника и нормализации стула важно провести коррекцию дие­ты, добавив в нее пищевые волокна и продукты, содержащие живые бифидо- и лактобактерии (Бельмер С.В., Малкоч А.В., 2006).

Для тех, кто испытывает проблемы с эвакуаторной функцией кишечника, актуальным является включение в рацион питания диетической добавки ЛЕПИКОЛ. Ее состав представляет собой «3 в 1» для здоровья кишечника — клетчатку, пробиотики и пребиотики. В 1 дозе (5 г) ЛЕПИКОЛА содержатся пробиотические микроорганизмы Lactobacillus rhamnosus PXN 54, Bifidobacterium bifidum PXN 23, Lactobacillus acidophilus PXN 35, Lactobacillus plantarum PXN 47, Lactobacillus bulgaricus PXN 39 — суммарно 6,0 · 108 КУО, а также инулин и шелуха семян подорожника.

Шелуха семян подорожника, входящая в состав ЛЕПИКОЛА, благодаря своей способности впитывать и удерживать большое количество воды размягчает и увеличивает объем кишечного содержимого. Она помогает ускорить прохождение каловых масс через пищеварительный тракт (Денисов Н.Л. и соавт., 2007). Пробиотики способствуют нормализации баланса микрофлоры кишечника, проявляют иммуномодулирующую активность (Корниенко Е.А., 2007). В свою очередь, пребиотики (инулин) стимулируют рост и активность представителей нормальной мик­рофлоры кишечника (Гриневич В.Б. и соавт., 2008). В результате активные компоненты ЛЕПИКОЛА способствуют нормализации эвакуа­торной функции и микрофлоры кишечника, а также контролю массы тела, что особенно актуально для тех, кто тщательно следит за стрелкой на весах и сидит на диетах.

Благодаря слабительным свойствам компонентов ЛЕПИКОЛА данная диетическая добавка подойдет взрослым и детям в возрасте старше 11 лет с запором или тем, кто нуждается в смягчении каловых масс ввиду заболеваний желудочно-кишечного тракта, например, синдрома раздраженной толстой кишки с преобладанием запора, дивертикулита, геморроя и др. Благодаря пробиотикам и пребиотикам в составе ЛЕПИКОЛ также будет актуален для восстановления микрофлоры кишечника при дисбактериозе, в том числе спровоцированном приемом антибиотиков.

ЛЕПИКОЛ: комплексное решение деликатных проблем с кишечником!

Спрашивайте ЛЕПИКОЛ у оптовых поставщиков: «БАДМ», «Вента. ЛТД», «Оптима-Фарм», «Фармпланета», «ФРАМ КО». Производитель: «Probiotics International Limited» (Великобритания). Импортер: «Топ-Маркет», тел.: +38 (044) 458-96-54 . Дополнительную информацию о продукте ЛЕПИКОЛ можно найти на сайте: www.lepicol.com.uarel="nofollow">.

Пресс-служба «Еженедельника АПТЕКА»

Цікава інформація для Вас:

Нерегулярный стул, кишечная аритмия - лечение в СПб в медицинском центре

24.02.2015

Нерегулярный стул – безобидная физиология или грозный симптом

Блажен, кто рано поутру
Имеет стул без принужденья,
Тому все яства по нутру
И все доступны наслажденья.
А.С. Пушкин

Нормальным кишечным ритмом следует считать ежедневное опорожнение кишечника в утренние часы, приносящее облегчение. У некоторых лиц, даже при условии ежедневного питания, опорожнение кишечника может иметь двухфазное течение: первое опорожнение до завтрака, последующее после. Повышение частоты стула более трех раз в сутки расценивается как высокая частота опорожнения и у практикующего гастроэнтеролога служит критерием оценки раннего симптома избыточного питания.

В тоже время, урежение частоты опорожнения является отдельной нозологической единицей и рассматривается в западной медицинской литературе как «скрытая национальная проблема». Рост выявления онкологических заболеваний толстой и прямой кишки за последние десятилетия, безусловно, связаны с ранней её диагностикой, что обусловлено доступностью аппаратуры и уровнем подготовки персонала. В тоже время, по данным ГНЦ колопроктологии (2009г.), изменение характера деятельности человека, питания, среды обитания, эндоэкологической обстановки служат предпосылками в появлении и развитии колоректального рака. Одним из фактором риска рака толстой и прямой кишки, желчного пузыря, поджелудочной железы является кишечная аритмия.

Следует различать понятие между урежением стула и запором, и, если при первом, частота стула бывает от 2 до 6 раз в неделю, то при запоре стул может быть от 1 до 2 раз в неделю.

Причины развития нерегулярного стула в процессе жизнедеятельности человека многообразны и распространяются от алиментарного, рефлекторного факторов до электролитных нарушений, токсических или медикаментозных воздействий. «Боязнь чужих туалетов», ложный стыд, особенно в школьном возрасте, когда ребенку приходится прилюдно отпрашиваться в туалет, приводит к вынужденной задержке стула, что со временем развивает привычку подавления позывов. Перенесенные воспаления, операции на органах брюшной полости, чаще после аппендэктомий, по данным Я.М. Иванусы с соавт., (1988г.) в 40-45% случаев приводит к атонии кишечника. Наличие таких заболеваний как анальные трещины, геморрой с частыми (более трех раз в год) обострениями, сопровождающие акт опорожнения болевым синдромом, вынуждают искусственно задерживать стул, что также вырабатывает патологическую привычку. Многофакторность развития аритмии кишечника, короткий переход от острой фазы в хроническое течение, длительность состояния в конечном итоге приводит к заболеванию и к терминальной своей фазе – запору.

Нерегулярный стул, задержка его протекают бессимптомно, сопровождаются ежедневным повышением концентрации в просвете кишечника целого ряда токсических веществ, которые, проникая в сосудистое русло, действуют как нейротропный яд, отравляя весь организм, что появляется рядом неврологических симптомов: головокружением, головной болью, утомляемостью, раздражительностью, агрессивностью, в том числе и атонии кишечника. Как пример, приведем известный исторический факт, описанный А. Гулем (2006). Великий Кормчий страдал запорами, которые носили длительный характер, поэтому, когда у Мао Цзэдуна происходила задержка стула, китайская армия постоянно (днем и ночью) наступала, когда наступало опорожнение, то в Народной Армии Китая наступал праздник: заводился патефон с записями русских песен и американских фокстротов, обожаемые полководцем и начинались танцы. Болезнь не тревожит пока не разовьются возможные осложнения, такие как язвенный колит, геморрой или колоректальный рак.

Нормальная физиология пищеварительного тракта основывается на незыблемом правиле: «Ежедневное питание – Ежедневный стул», при этом именно утренняя фаза опорожнения кишечника является наилучшей для уменьшения риска запора, при условии функциональности пищи, способствующей опорожнению кишечника: овощи, фрукты, кисломолочные продукты, ржаной хлеб, рыба, каши, минеральная вода, столовые белые вина, но следует помнить, что ряд продуктов могут задерживать эвакуаторную функцию кишечника: рис, черника, крепкий чай, макароны, красные вина.

Немаловажным фактором в развитии задержки стула является также гиподинамия, недостаточный питьевой режим, увлечение медикаментозным лечением (антациды, антидепрессанты, нестероидные противовоспалительные препараты, мочегонные средства, антибиотики и др.), предпочтения в жирных мясных пищевых продуктах, которые дольше задерживаются в кишечнике, усугубляя процессы гниения, чем растительная клетчатка, приводят к накоплению в организме канцерогенных метаболитов. Об этом наглядно свидетельствует пример питания фастфудами, где пища насыщена жирными кислотами, а употребление дополнительно больших объемов лимонадов (Кока-кола, Пепси-кола, Миринда, Севенап и др.), где присутствует большая концентрация  углеводов. В конечном итоге, зависимые от вышеописанного, страдают ожирением, сахарным диабетом, у них чаще развивается язвенный колит, панкреатит.

Как же лечить кишечную аритмию?

Безусловно, принцип лечения любого заболевания, а мы выяснили, что нерегулярное опорожнение кишечника является болезнью и далеко не безобидной, заключается в комплексном и индивидуальном подходе к каждому случаю и должно быть последовательным. И без помощи самого больного, врач не справится с вроде как безобидным состоянием. В комплексное лечение входит понятие нормализации диеты, соблюдение режима труда и отдыха, строго соблюдая ритм сна и бодрствования, активизация физический активности (не путать с занятиями спортом), прибегать к медикаментозной коррекции только в случаях неэффективности всех трех вышеперечисленных факторов.

Индивидуальный подход заключается в полном выявлении и устранения причин развития нерегулярного стула. Последовательность – в выработке тактики нормализации суточного ритма кишечника, нормализации питьевого режима, диеты и двигательной активности и только потом, при необходимости, прибегать к медикаментозному лечению.

Лекарственный ряд для лечения нерегулярного стула (хронического запора) в нашей стране широк. Традиционно применяется Бисакодил, Сенаде, Касторовое масло, однако применять их длительно не рекомендуется из-за возникновения нежелательных побочных эффектов, так, по данным Федорова В.Д. (1999), применение препаратов Сенны вызывают привыкание и стойкие запоры при отмене препарата. Большинство слабительных препаратов ухудшают пищеварение, приводят к водно-электролитным нарушениям, изменяют состав микрофлоры кишечника.

Назначение слабительных препаратов должно быть строго индивидуальным, при исключении органических и воспалительных заболеваний кишечника и только при неэффективности других методов лечения, назначаться только врачом-специалистом.

Записаться на прием проктолога в отделение сети «Моя Клиника» можно на нашем сайте www.myclinic.ru или по телефону 493-03-03. Наши медицинские центры находятся по адресам: ул. Гороховая, д. 14/26 (м. Адмиралтейская) и ул. Варшавская, д. 59 (м. Московская).

Методы лечения запоров во время беременности

В чем проблема?

Термин «запор» определяется как трудности прохождения стула и уменьшение частоты стула (дефекаций - движений кишечника по его опорожнению). Запор характеризуется дискомфортом, чрезмерным напряжением, твердым или комковатым стулом, ощущением неполного опорожнения, и нечастыми испражнениями. Запор является распространенным симптомом во время беременности. Это может быть результатом влияния комбинации факторов, включающих гормональные изменения (сдвиги) во время беременности, влияющие на пищеварительную систему, низкую физическую активность и изменения привычного питания во время беременности. Кроме того, когда плод (ребенок) растет, он может сдавливать кишечник матери и тем самым вызывать задержки опорожнения кишечника / препятствия.

Почему это важно?

Запор во время беременности связан с нарушением качества жизни и приносит страдание беременным женщинам, а также физические проблемы, включая развитие геморроя. Предложен ряд вариантов лечения, включая использование лекарств, пищевых добавок или изменения диеты.

Как правило, первоначально рекомендуется использовать не медикаментозные вмешательства (изменения в диете, потребление воды и упражнения), и в случае их неэффективности или недостаточности, - медикаментозные (фармакологические) вмешательства. Медикаментозные вмешательства включают широкий круг лекарств: смазочные средства (любриканты), средства, способствующие формированию объемного стула, осмотические и стимулирующие слабительные, смягчители стула (смягчающие слабительные), клизмы и суппозитории (слабительные средства в свечах и клизмах).

Этот обзор рассмотрел преимущества медикаментозных и не медикаментозных вмешательств в лечении запора во время беременности, а также, являются ли они безопасными для женщин и детей.

Какие доказательства мы нашли?

Мы выявили четыре исследования, но только в двух исследованиях (в общей сложности 180 женщин) были получены данные для анализа. В этих исследованиях сравнивали стимулирующие слабительные с объемными слабительными и пищевые добавки (пищевые волокна) с отсутствием вмешательства. Включенные исследования были признаны исследованиями среднего (умеренного) качества.

Мы рассмотрели два основных сравнения. В первом сравнении, мы обнаружили, что стимулирующие слабительные могут быть более эффективными в лечении запора, чем объемные слабительные (среднее качество доказательств ). Однако это также может привести к большему дискомфорту в животе (низкое качество доказательств) и к диарее (среднее качество доказательств). Мы не обнаружили различий в удовлетворенности женщин (среднее качество доказательств). Второе сравнение между добавками волокон и отсутствием вмешательства, позволило установить, что добавки волокон могут быть эффективными в увеличении частоты стула (среднее качество доказательств). Использование пищевых добавок (волокон) было связано с улучшением консистенции стула, как это было определено испытателями (частота жесткого стула снизилась на 11% до 14%, нормального стула увеличилась на 5% до 10%, а частота жидкого стула увеличилась на 0% до 6%).

Не было исследований, рассматривавших другие виды вмешательств, такие как осмотические слабительные, смягчающие стул средства (слабительные, способствующие размягчению каловых масс), смазки (смазывающие слабительные средства - любриканты), клизмы и суппозитории (свечи).

Что это значит?

Те немногие доказательства, что имеются, позволяют предполагать, что диетические добавки, богатые волокнами (или клетчаткой - объемные слабительные или наполнители) могут увеличивать частоту стула. При выборе между стимулирующими или объемными слабительными: стимулирующие слабительные могут лучше облегчить запор, но в большей степени вызвать дискомфорт в животе и диарею.

Необходимо больше исследований в этой области.

Как избавиться от запоров? Причины и лечение запоров, питание при запорах

весь список

Запоры — нарушение функции кишечника, выражающееся в увеличением интервалов между актами дефекации по сравнению с индивидуальной физиологической нормой или в систематически недостаточном опорожнении кишечника (А. Л. Гребенев, Л. П. Мягкова, 1994).

Частота стула у здоровых людей весьма индивидуальна и зависит от характера питания, образа жизни, привычек.
Запор — это хроническая задержка опорожнения кишечника более чем на 48 ч.

Лечебная программа при запорах, разумеется, индивидуальна, однако можно сформулировать ее общие направления:

  1. Этиологическое лечение, т. е. лечение или устранение причин.
  2. Режим физической активности.
  3. Лечебное питание.
  4. Слабительные средства.
  5. Нормализация моторной функции кишечника.
  6. Лечение минеральными водами.
  7. Физиотерапия.
  8. Лечебная физкультура, специальная гимнастика, массаж.

Этиологическое лечение

Причины запоров многообразны. Приступая к лечению запоров, необходимо выяснить причины, способствовавшие их развитию, так как нередко устранение причины приводит к нормализации стула.

Алиментарный запор — развивается при неправильном, нерациональном, т. е. однообразном питании, механически и химически щадящей пище с ограничением растительной клетчатки.

Продуктами, задерживающими опорожнение кишечника, являются: каши манная и рисовая, слизистые супы, кисели, пища в протертом виде; крепкий чай, кофе, шоколад, черника.

Нормализация режима питания, включение в рацион продуктов, стимулирующих опорожнение кишечника, приводят к устранению алиментарных запоров (питание при запорах излагается ниже).

Неврогенный запор — встречается наиболее часто и возникает в связи с нарушениями механизмов регуляция кишечной моторики на любых уровнях нервной системы. Позывы к дефекации находятся под контролем коры головного мозга, в осуществлении акта дефекации участвуют центры поясничного и крестцового отделов спинного мозга.

Неврогенные запоры подразделяются на:
  • дискинетический;
  • рефлекторный;
  • вследствие подавления позывов к дефекации (привычный запор).

Дискинетический запор обусловлен первичной дискинезией кишечника (гипокинетической или спастической), рефлекторный запор развивается при различных заболеваниях органов пищеварения, мочеполовой системы и других органов (вторичная дискинезия кишечника).

Ослабление позывов к дефекации может возникнуть вследствие первичных психогенных воздействий (привычные запоры, вызванные подавлением позывов к дефекации, например, при отсутствии возможности оправиться на работе), в результате нарушения привычного ритма дефекации, утренней спешки и т. д.Условно-рефлекторные механизмы дефекации особенно легко ранимы у детей.

При выявлении запора неврогенного или психогенного характера, необходима рациональная психотерапия, восстановление привычки ежедневно опорожнять кишечник (посещение туалета в одни и те же часы, гимнастика Трюссо-Бергмана — см. ниже), прием натощак холодной воды с медом или лимоном (это способствует выработке желудочно-кишечного рефлекса). Кроме того, больному с неврогенным или психогенным запором рекомендуется подобрать оптимальную позу для опорожнения кишечника (лучше на корточках), в первые дни для облегчения акта дефекации можно использовать свечи с глицерином или небольшую масляную клизму (50–100 мл растительного масла), в дальнейшем надобность в них отпадает. При отсутствии эффекта от вышеизложенных мероприятий. Выполняются остальные разделы лечебной программы.

Гиподинамический запор — обусловлен малой физической активностью человека, гиподинамией, слабостью соматической мускулатуры. Гиподинамический запор может иметь место у больных, длительно соблюдающих постельных режим, а также у лиц пожилого. Возраста в связи с резким снижением физической активности.

Активный образ жизни, ходьба, занятия физкультурой способствуют устранению гиподинамического запора.

Запор вследствие воспалительных заболеваний кишечника — наблюдается у больных хроническим колитом, реже — хроническом энтеритом. Лечение этих заболеваний способствует восстановлению стула.

Проктогенный запор — наблюдается у больных с заболеваниями аноректальной области (геморрой, анальные трещины, прокталгии и др.) Устранение этой патологии приводит к исчезновению запоров.

Механический запор — развивается у больных с опухолями кишечника, при рубцовых сужениях толстой кишки, механическом сдавлении прямой кишки извне и др.

Устранение этих факторов способствует нормализации стула.

Запор вследствие аномалий развития толстой кишки — наблюдается у лиц с врожденным мегаколон, идиопатическим мегаколон и мн. др.

Токсический запор — наблюдается при хронических профессиональных отравлениях (свинцом, ртутью, таллием), при отравлении никотином у курильщиков.

Медикаментозный запор — вызывается приемом некоторых лекарственных средств. К ним относятся мн. снотворные, мочегонные, сорбенты (активированный уголь), препараты железа и др.

Соответственно, прекращение приема этих средств способствует устранению запоров.

Эндокринный запор — наблюдается прежде всего при гипотиреозе (гипотонический тип запора), гипопаратиреозе (гипертонический, спастический тип запора), гипофизарной недостаточности, реже — при сахарном диабете, надпочечниковой недостаточности, феохромоцитоме, глюкагономе, климаксе и др.

Запор вследствие нарушений водно-электролитного обмена — развивается при сердечной недостаточности, недостаточности почек, обезвоживании любого генеза.

Режим физической активности

Если позволяет общее состояние, необходимо вести активный образ жизни: занятия физкультурой, спортом, подвижные игры, бег, длительная ходьба, плавание и т. д. Эти мероприятия способствуют лучшему опорожнению кишечника, укрепляют мускулатуру, в том числе и брюшного пресса.

Лечебное питание

При запорах рекомендуется лечебное питание в рамках диеты № 3.

Энергетическая ценность и состав: белки — 100 г, жиры — 100 г, углеводы 400–450 г, поваренная соль 8–10 г, свободная жидкость — 1.5 л, масса рациона — 2.5-З кг (в зависимости от массы пациента), энергетическая ценность: 2900–3000 ккал.

Перечень рекомендуемых блюд:

Хлеб и хлебобулочные изделия: хлеб пшеничный из муки грубого помола или с добавлением пшеничных отрубей, вчерашний; при отсутствии противопоказаний и хорошей переносимости более целесообразен черный хлеб; печенье сухое, несдобное лучше с добавлением отрубей; сухари (лучше ржаные).

Супы: на некрепком обезжиренном мясном, рыбном бульонах, овощном наваре; борщи, свекольники из сборных овощей, с перловой крупой, гречневой крупой, цветной капустой.

Блюда из мяса: мясо нежирных сортов (говядина, телятина, курица, кролик, индейка), отварное, запеченное, преимущественно куском.

Блюда из рыбы: рыба нежирная (судак, лещ, треска, карп, щука, хек) в отварном, заливном виде; при хорошей переносимости — немного вымоченнной сельди.

Блюда и гарниры из овощей: разнообразные овощи в сыром и вареном виде в качестве гарниров, салатов. Особенно рекомендуются свекла, морковь, помидоры, лиственный салат, кабачки, тыква, цветная капуста, капуста белокочанная и зеленый горошек разрешаются в отварном виде при хорошей переносимости. Исключаются овощи, богатые эфирными маслами: репа, редька, лук, чеснок, редис; грибы.

Блюда и гарниры из круп, макаронных изделий разрешаются в ограниченных количествах, употребляются рассыпчатые каши из гречневой, ячневой, пшенной круп.

Блюда из яиц: 1–2 яйца в день (всмятку, в виде омлета или в блюда по кулинарным показаниям) Яйца вкрутую способствуют развитию запоров!

Сладкие блюда, фрукты, ягоды: свежие, спелые, сладкие фрукты и ягоды в сыром виде и в блюдах в повышенном количестве, а также в виде соков.

Сушеные фрукты и ягоды в размоченном виде в различных блюдах особенно рекомендуются чернослив, курага, урюк, инжир.

Не рекомендуются яблочный и виноградный соки, полезен сливовый сок. Сливы содержат органические кислоты, способствующие опорожнению кишечника, поэтому настоятельно рекомендуется чернослив в любом виде.

Рекомендуется ежедневно употреблять настой из 24 плодов чернослива, по 12 плодов и по ½ стакана, настоя 2 раза в день.

Разрешаются мармелад, пастила, зефир, ирис, молочные и сливочные карамели, варенье, джемы, повидло, сладкие фрукты, ягоды, сахар, мед.

Молочные продукты: рекомендуются кефир однодневный (свежий), ацидофильный, простокваша, ряженка, свежий некислый творог (в натуральном виде, в виде запеченных пудингов, ватрушек, ленивых вареников). Молоко при хорошей переносимости в блюдах и к чаю. Сметана некислая в виде приправы к блюдам в небольшом количестве. Сыр неострый.

Соусы и пряности: зелень петрушки, укропа, кинзы, сельдерея, лавровый лист, корица, гвоздика. Фруктовые соусы, белый соус с небольшим количеством сметаны.

Закуски: сыр неострый, икра черная, ветчина без сала, телятина, курица, рыба заливная, сельдь вымоченная, овощные и фруктовые салаты. Очень полезна и эффективна морская капуста.

Напитки: чай некрепкий, отвар шиповника, кофе суррогатньнй не крепкий, соки фруктовые сладкие (сливовый, абрикосовый), овощные (томатный, морковный и др.).

Жиры: масло сливочное, оливковое (добавлять в готовые блюда, подавать в натуральном виде). Подсолнечное и другие растительные масла разрешаются при хорошей переносимости. Исключаются тугоплавкие животные жиры: свиное, говяжье, баранье сало, комбижир.

При отсутствии противопоказаний целесообразно рекомендовать «диету с зеленью», включающую 100 г салата из сырых овощей З раза в день перед едой.

При составлении дневного рациона необходимо предусмотреть содержание в диете не менее 25–30 г пищевых волокон в сутки. Пищевые волокна стимулируют моторику кишечника, способствуют его опорожнению.

Приводим содержание пищевых волокон в граммах на 100 г продукта в различных пищевых продуктах (А. А. Покровский, 1992 г.).

  • Апельсины — 1.4
  • Морковь — 1.2
  • Вишня — 0.5
  • Отруби пшеничные — 8.2
  • Горошек консервированный — 1.1
  • Персики (мякоть и кожура) — 0.9
  • Грибы сушеные — 19.8
  • Петрушка — 1.5
  • Груши — 0.6
  • Ревень сырой — 1.0
  • Капуста белокочанная — 1.0
  • Репа — 1.4
  • Капуста квашеная — 1.0
  • Сливы — 0.5
  • Капуста цветная — 0.9
  • Томаты свежие — 0.8
  • Картофель — 1.0
  • Хлеб белково-отрубный — 2.1
  • Клубника — 4.0
  • Хлеб зерновой — 1.3
  • Крупа гречневая — 1.1
  • Хлеб ржаной — 1.1
  • Крыжовник — 2.0
  • Чернослив — 1.6
  • Курага — 3.2
  • Яблоки — 0.6
  • Лук зеленый — 0.9
  • Яблоки сушеные — 5.0
  • Малина — 5.0

Физиологические эффекты пищевых волокон: увеличение насыщения, подавление аппетита, снижение гиперхолестеринемии, желчегонный эффект; увеличение массы фекалий, разжижение кишечного содержимого, ускорение кишечного пассажа.

Целесообразно включать в рацион пациента, страдающего запорами, отруби, способствующие опорожнению кишечника.

М. Х. Левитан (1981), Е. А. Беюл (1983) рекомендует применять их следующим образом:

«Пшеничные отруби залить кипятком (чтобы они набухли и стали мягче), затем надосадочную жидкость слить. Разбухшие отруби (можно добавлять в компоты, кисели, супы) в первые 2 недели назначают по 1 чайной ложке З раза в день, далее увеличивают дозу до 1–2 столовых ложек З раза в день; после достижения послабляющего эффекта дозу снижают до 1/5–2 чайных ложек З раза в день. Лечение продолжается не менее 6 недель.»

Слабительные средства

При хронических запорах, как правило, следует избегать слабительных средств. Они не показаны при алиментарных, неврогенных эндокринных запорах. Но при очень упорных запорах, особенно при сниженной моторной функции кишечника и при проктогенных запорах, главным образом у пожилых людей, приходится применять слабительные средства.

Самые безобидные слабительные:

Лактулоза (нормазе, дюфалак) — препарат не подвергается гидролизу в кишке, создает благоприятные условия для развития молочнокислых бактерий. Выпускается в виде сиропа, в 100 мл которого содержится 67 г лактулозы. Назначается по 1–3 столовые ложки в день, по достижении эффекта дозу понижают до 1–2 чайных ложек в день.

Свечи с глицерином — 1 свеча содержит 1.44 г глицерина, 0.12 г стеариновой кислоты, 0.66 г натрия карбоната. При введении в прямую кишку свеча оказывает легкое раздражающее действие на слизистую оболочку и рефлекторным путем стимулирует дефекацию, кроме того, размягчаются каловые массы. Вводят по 1 свече 1 раз в сутки через 15–20 мин после завтрака.

Противопоказаны глицериновые свечи при обострении геморроя, трещинах заднего прохода, воспалительных и опухолевых заболеваниях прямой кишки.

При лечении запоров широко применяются растительные средства. К послабляющим лекарственным растениям относятся: лист сенны, кора крушины ольховидной, плоды жостера (крушина слабительная), корень ревеня, морская капуста, корень и корневище солодки, трава укропа, корень щавеля конского, листья столетника, стебли горца почечуйного, стебли золототысячника, корни стальника полевого, семя льна.

Сбор №1
  • 3 части листьев сенны
  • 2 части коры крушины
  • 2 части плодов жостера
  • 1 часть плодов аниса
  • 1 часть корня солодки

1 столовую ложку смеси заварить стаканом кипятка, настоять 30–40 минут и пить на ночь по полстакана.

Сбор №2
  • 1 часть листьев сенны
  • 1 часть травы укропа
  • 1 часть цветов ромашки
  • 1 часть листьев мяты
  • 1 часть корня валерианы
  • 1 часть цветов бессмертника

Готовить как сбор №1. Принимать по стакану на ночь или по полстакана 2 раза в день.

Нормализация моторной функции кишечника

У больных с запорами встречаются различные типы двигательных нарушений толстой кишки.

Пациенту следует восстановить рефлекс к дефекации самостоятельно (как бы смешно это ни звучало), особенно, если запор обусловлен подавлением позывов к дефекации.

Пациенту рекомендуется выпивать утром натощак стакан холодной воды или фруктового сока. Через 30 мин больной завтракает и направляется в туалет и, приняв соответствующую позу (притянув бедра к животу), пытается вызвать дефекацию, натуживаясь в течение каждого выдоха.

Акту дефекации помогает также массаж живота руками, ритмичное втягивание заднего прохода, надавливание на область между копчиком и задним проходом. Если этого недостаточно, то можно добавить в принимаемый утром фруктовый сок или холодную воду 0,5–1 чайную ложку карловарской соли (но, мое мнение, это крайность), а после завтрака ввести в задний проход свечу с глицерином.

Если удается выработать рефлекс к дефекации, введение свечей и прием слабительной соли прекращают, пациенты продолжают пить по утрам лишь холодную воду.

Лечение минеральными водами

Больным с запорами показаны минеральные воды: «Ессентуки» № 17 и № 4, «Баталинская», Славяновская», «Джермук».

Минеральную воду «Ессентуки» № 17 назначают при запорах с гипомоторикой (склонность к спазмам), а менее минерализованную воду «Ессентуки» № 4 — при запорах с гипермоторикой толстой кишки.

Назначают 1 стакан холодной минеральной воды на прием 2–3 раза в день за 1–1.5 ч до еды в течение нескольких недель. При запоре с гипермоторной дискинезией предпочтительнее теплая минеральная вода.

Физиотерапия

В домашних условиях провести не сможете. Да и, признаться, эффективность её не велика.

Лечебная физкультура (ЛФК), специальная гимнастика, массаж

ЛФК играет весьма существенную роль в лечении запоров.

По данным А. В. Фролькиса, ЛФК должна включать различные упражнения, в частности: диафрагмальное дыхание, поочередное подтягивание согнутой ноги к животу, разведение согнутых ног в стороны, упражнение «велосипед», поднимание таза с опорой на стопы согнутых ног, толчковые движения передней брюшной стенки, ритмичные сжимания сфинктера, втягивание его (неоднократно в течение дня).

Упражнения выполняются лежа на спине или в положении стоя «на четвереньках». Люди с запорами должны также выполнять ежедневно комплекс утренней гимнастики, вести активный образ жизни.

Рекомендуется также гимнастика Трюссо-Бергмана, включающая специальные дыхательные упражнения, которые повышают внутриректальное давление, стимулируют перистальтику, играют роль условного раздражителя.

Упражнение заключается в следующем:

Глубокий вдох с выпячиванием брюшной стенки — пауза 5–10 секунд — полный вдох с втягиванием передней брюшной стенки — пауза 5–10 секунд; глубокие вдохи и выдохи повторяются З раза, затем следует глубокий вдох и сильное натуживание. После нескольких спокойных дыханий цикл повторяется снова (7–10 раз за время посещения туалета). Рекомендуется перед началом гимнастики прием натощак холодной воды (с медом или лимоном).

Целесообразно также проведение общего массажа.

Автор статьи — врач-хирург Чернов С. Л.

Как наладить стул. Простые способы избавиться от запора | Здоровая жизнь | Здоровье

Врачи предупреждают, кишечник должен опорожняться регулярно, не менее трех раз в неделю. Задержка стула не только вызывает ощущение дискомфорта, но и может привести к серьезным проблемам со здоровьем – вплоть до развития злокачественных опухолей в кишечнике.

Как же себе помочь? Существует несколько простых и эффективных способов.

Больше пейте

Вода обеспечивает правильное пищеварение и регулярный стул, недаром признанное средство от запора – стакан воды, выпитый натощак. Однако в течение дня тоже необходимо следить за тем, чтобы ваш организм не испытывал недостатка жидкости. Посчитать, какое количество воды нужно именно вам, очень просто. Суточная потребность организма – 30 мл жидкости на 1 кг веса, поэтому известная норма 2 л воды в день справедлива лишь для людей со средним весом около 70 кг. Если же вы отличаетесь богатырским сложением, пить нужно больше.

Следите за диетой

Чтобы избежать запора, включайте в рацион продукты, богатые клетчаткой. В первую очередь – овощи, фрукты и хлеб из муки грубого помола.

Наладить стул поможет капуста, бобовые, свекла, шпинат, помидоры, виноград, яблоки, кабачки, тыква, чернослив. Почаще включайте в рацион кисломолочные продукты, растительные масла, сливочное масло.
А вот от риса, белого хлеба, шоколада, черного кофе, крепкого чая, черники, протертых блюд на время откажитесь: они обладают вяжущими свойствами и задерживают перистальтику кишечника.

Еще одно важное условие профилактики запора – соблюдение режима дня и питание по графику. Так вашему кишечнику будет проще «привыкнуть» к опорожнению в одно и то же время.

Не пренебрегайте спортом

Физические нагрузки не только укрепляют сердце, но и способствуют слаженной работе кишечника. Особенно хороши приседания. Обязательно включите в свою утреннюю гимнастику такое упражнение: встаньте прямо, поднимите вытянутые руки над головой и медленно присядьте.

В продолжении: Упражнения при запоре →

Делайте массаж

Легкие поглаживания по животу по часовой стрелке могут стать отличным средством от запора. Сядьте на стул, положите ладонь на живот и делайте массаж в течение 10–15 минут.

Избегайте стрессов

Оказывается, нервные перегрузки тоже могут стать причиной запора. По возможности сохраняйте спокойствие и учитесь расслабляться. Кстати, признанным лекарством от запора считается смех. Когда вы хохочете, происходит своеобразный массаж стенок кишечника, кроме того, во время смеха организм избавляется от стресса.

Запор у детей. Профилактика. Диетотерапия

21.06.2019


Запоры широко распространены как среди взрослых, так и детей (5-30% в зависимости от критериев диагностики). Симптомы становятся хроническими более чем у 30% пациентов, доставляют не только дискомфорт и болевые ощущения самому ребенку, но и нарушают качество жизни его семьи.

ЗАПОР – состояние, проявляющееся увеличением интервалов между дефекациями (по сравнению с индивидуальной нормой) или систематически замедленным, затрудненным и/или недостаточным опорожнением кишечника. К запорам относят и стул “кашицей”, но после того, как дефекация отсутствовала до 3 сут.

Запоры могут быть связаны с функциональными или органическими причинами (аномалии, воспаление). У детей в 90-95% запор — функциональный. Пик заболеваемости функциональными запорами приходится на 2-4года, когда начинают приучать ребенка к горшку/туалету.

Основные причины функциональных запоров

  • Боль
  • Лихорадка
  • Обезвоживание
  • Неправильный режим питания кормящей матери
  • Недостаточный питьевой режим ребенка при искусственном вскармливании
  • Недостаточный питьевой режим ребенка на естественном вскармливании при введении прикорма
  • Ранний перевод ребенка на искусственное вскармливание
  • Быстрый перевод малыша с одной смеси на другую (менее, чем за 7дней)
  • Нерациональное питание ребенка (длительное время ребенок получает питание с большим количеством белков, жиров и недостаточным содержанием пищевых волокон, злоупортебление напитками, содержащими большое количество вяжущих веществ – чай, кофе, какао)
  • Чрезмерное использование средств детской гигиены или развитие аллергической реакции кожи перианальной области
  • Последствия перинатальных повреждений нервной системы
  • Рахит, дефицит витамина Д
  • Анемия
  • Нарушение функции щитовидной железы (недостаточность – гипотиреоз)
  • Пищевая аллергия, прежде всего аллергия к белку коровьего молока
  • Принудительное приучение к горшку, период адаптации к новым условиям (ясли, детский сад)
  • Гиподинамия – малоподвижный образ жизни
  • Психическая травма или стресс
  • Систематическое подавление позывов на опорожнение кишечника, связанное, например, с началом посещения детского сада, школы и т. п.
  • Прием некоторых препаратов
  • Запоры у членов семьи

Частота дефекций у детей разного возраста

Возраст Число дефекаций в неделю Число дефекаций в сутки
0 – 3мес
грудное вскармливание
искусственное вскармливание

5 - 40
5 - 20

2,9
2,0
6 - 12мес 5 - 28 1,8
1 - 3года 4 - 21 1,4
4года и старше 3 - 14 1,0

Помимо частоты стула следует обращать внимание на его характер. Для более объективной оценки удобна “Бристольская шкала форм кала”, так как именно форма кала, а не частота стула, в большей мере соответствует времени кишечного транзита.

Бристольская шкала форм кала

В соответствии с этой шкалой 3 и 4 форма кала расценивается как норма, а 1 и 2 свидетельствуют о замедленном транзите (запор). Довольно часто на практике бывают ситуации, когда у ребенка частота дефекации укладывается в пределы нормальных значений, но стул плотный, фрагментированный, в скудном количестве. Эти признаки указывают на неполное опорожнение кишечника и рассматриваются как проявления запоров.

По консистенции у новорожденных и младенцев стул должен быть кашицеобразным. С 6 месяцев до 1,5 – 2 лет кал может быть как оформленным, так и кашицеобразным. С двух лет стул должен быть оформленным.

Признаки и симптомы запора

  • боли в животе, часто распирающие, ноющие, иногда коликообразные
  • вздутие живота
  • изменение формы и консистенции стула
  • чрезмерный метеоризм
  • неприятный запах газов и стула
  • могут быть боли при дефекации
  • натуживание при дефекации
  • может быть кровь в стуле – на поверхности каловых масс или в виде следов на салфетке (свидетельствует об анальной трещине)
Если не устранить запор и не наладить опорожнение кишечника, то имеется риск копростаза (образование каловых камней) и каловой интоксикации:
  • потеря аппетита
  • недостаток энергии
  • общее недомогание
  • депрессия, раздражительность
  • тошнота, рвота
  • кожные симптомы – сухость, сыпь, шелушение
  • недержание кала, мажущий стул
  • задержка и недержание мочи вследствие давления переполненным отделом кишечника на мочевой пузырь
  • кровотечения из трещин, геморроидальных узлов

Лечение запора предусматривает достижение следующих целей:

1. Нормализация консистенции стула (мягкий безболезненный стул)

2. Регулярность опорожнения кишечника (профилактика повторного скопления каловых масс)

Лечение запоров – процесс последовательный, комплексный, индивидуальный и состоит из нескольких этапов:
  • обучение ребенка и родителей
  • проведение коррекции питания и питьевого режима
  • устранение с помощью медикаментозных средств имеющегося копростаза
  • поддерживающая терапия

Необходимо исключить факторы, провоцирующие и способствующие запорам (нормализация двигательного и пищевого режима, прекращение приема лекарственных препаратов, которые могут вызывать запор, выявление пищевого аллергена, исключение или подтверждение нервно-мышечного заболевания, целиакии и т. п.).

Нормализация стиля жизни включает в себя:

  • выработку условного рефлекса
  • подвижный образ жизни
  • гимнастика
  • обучение навыкам легкого массажа живота
  • для маленьких детей – выкладывание на живот, подгибание ног к животу.

Обучение является первым этапом лечения функциональных запоров. Необходимо помнить, что эпизоды каломазания и энкопреза (недержание кала) не являются произвольными и не следует в этом винить ребенка, который и так может быть напуган и дезориентирован. В некоторых случаях, когда внутрисемейная обстановка сложная, может понадобиться помощь семейного психолога.

Важно понимать, что лечение функциональных запоров может быть длительным, основано на доверии врачу, партнерстве и требует терпения. Современные слабительные, разрешенные у детей, не сделают кишечник “ленивым”, не вызовут “привыкания”, они попадают в кровоток в минимальных количествах или вообще не всасываются и безопасны при длительном приеме.

Коррекция поведения ребенка с запором основывается на выработке режима посещения туалета, с целью добиться регулярной дефекации. Дефекация должна быть каждый раз в одно и то же время. В основе позыва к дефекации лежит гастроцекальный рефлекс, который проявляется утром через 1час после еды. Ребенку с запором необходимо проводить в туалете 3-10 минут (в зависимости от возраста). Высаживать ребенка на горшок или предлагать посетить туалет надо после каждого приема пищи.

Обязательное условие эффективной дефекации – обеспечить хороший упор для ног (низкая скамейка, на которую ребенок может поставить ноги), что способствует повышению внутрибрюшного давления.

Если дефекация не удалась, ребенка ни в коем случае нельзя наказывать и наоборот. Ежедневную частоту дефекаций можно отмечать в дневнике, который может быть проанализирован при плановом посещении врача.

Лечение запора необходимо начинать с изменения образа жизни, что включает в себя коррекцию питания, питьевого режима и физической активности.

Расчет объема жидкости для здоровых детей

Дети в возрасте до 1 года должны выпивать не менее 100 мл воды в сутки.

Для здоровых детей с весом от 10 до 20 кг потребность в воде рассчитывается по формуле:

100 мл (объем воды для детей до 1 года) + 50 мл на каждый кг при массе тела свыше 10 кг.

Например, при массе 12 кг: 100 мл + 2 х 50 мл = 200 мл.

Ребенок с массой 20 кг должен выпивать воды: 100 мл + 50 х 10 = 600 мл

Для детей массой выше 20 кг предлагается следующая формула для расчета:

600 мл (объем воды для ребенка массой 20 кг) + 20 мл на каждый кг при массе свыше 20 кг.

Для детей старше 3-5 лет можно воспользоваться расчетом количества воды: 30мл / кг массы

Принципы диетотерапии запоров:

  • удовлетворение физических потребностей в пищевых веществах и энергии
  • исключение избыточного потребления белков и жиров, которое может тормозить моторику кишечника
  • обогащение рациона пищевыми волокнами
  • нормализация кишечной микрофлоры с помощью про- и пребиотиков

Если ребенок на грудном вскармливании, то проводится коррекция питания мамы (ограничение продуктов, способствующих газообразованию). При искусственном вскармливании показаны специальные смеси. При запорах, связанных с аллергией к белку коровьего молока, назначаются лечебные смеси если ребенок находится на искусственном вскармливании. Если же ребенок на грудном вскармливании, из рациона матери полностью исключается коровье молоко и продукты на его основе.

После введения “густого” прикорма – кипяченая вода необходима всем детям, независимо от вида вскармливания.

Для детей более старшего возраста рекомендуется употреблять пищу, богатую растительными волокнами. Не рекомендуется “пища-размазня”, пюреобразная, “перекусы”, “еда на ходу”. Пища должна быть рассыпчатая, мясо/птица/рыба – “куском”. Обязателен “объемный” завтрак для стимуляции “гастроцекального рефлекса”.

Основным источником грубоволокнистой растительной клетчатки, содержащей в большом количестве пищевые волокна, являются отруби злаковых, ржаной хлеб, а также ряд овощей и фруктов. Согласно принципам доказательной медицины, продемонстрировано статистически достоверное учащение стула и улучшение его консистенции при использовании клетчатки по сравнению с плацебо.

Отруби, как основной источник растительной клетчатки, рекомендуется добавлять во вторые и третьи блюда, предварительно заливая крутым кипятком и отстаивая в течение 20 мин. Отруби можно применять и в промежутках между едой, запивая большим количеством жидкости. Для детей школьного возраста общее количество жидкости при приеме отрубей должно быть не менее 1,5-2х литров в сутки, иначе они выполняют, преимущественно, роль сорбентов, поглощая жидкость из кишечника, тем самым усиливая запор. Доза подбирается индивидуально, рекомендуется начинать с 1 чайной ложки 2-3 раза в день, с постепенным увеличением до 40 г в сутки. При достижении эффекта – доза снижается и ограничивается до одного приема.

Американская академия педиатрии (2009) рекомендует потребление клетчатки 0,5 г/кг/день (максимум 35 г/день) для всех детей. Потребление клетчатки ниже минимального рекомендуемого значения доказало, что является фактором риска развития хронического запора у детей.

Однако длительный прием большого количества растительных волокон вследствии ферментации кишечной микрофлорой закономерно сопровождается вздутием и метеоризмом.

Детям с запорами показан прием прохладной жидкости натощак (питьевой и минеральной воды, сока, компотов, кваса), для усиления послабляющего эффекта возможно добавление меда, ксилита или сорбита. Очень полезно для работы кишечника увеличение потребления соков, содержащих сорбит/сорбитол, таких как сок из сливы, груши, абрикоса, персика и яблок,

При “вялой” работе кишечника (гипомоторный запор) применяется прохладная минеральная вода средней и высокой минерализации, такие как, Ессентуки 17, Баталинская, Арзни, Донат Магния и др; при спастическом запоре (гипермоторный запор, форма стула чаще тип 1) – теплая и малой минерализации (Ессентуки 4). Расчет минеральной воды – 3-5мл/кг в сутки.

Следует ограничить молоко в чистом виде и в блюдах, так как может возникнуть метеоризм с появлением или усилением болей в животе. Лучше цельное молоко заменить кисло-молочным продуктами – кефир, ацидофилин, простокваша, йогурты и др.

В диету детей с запорами включают блюда, богатые растительной клетчаткой - салаты из свежих овощей, зелени 2-3р в сутки, печеные яблоки, овощи в тушенном виде, разбавленные овощные и фруктовые соки с мякотью. Пища готовится преимущественно в неизмельченном виде, на пару или отваривают в воде.

Предпочтителен прием овощей и фруктов в сыром виде (при отсутствии противопоказаний). Особенно рекомендуются томаты, кабачки, тыква, морковь, свекла, лиственный салат, цветная капуста, яблоки. Сухофрукты (чернослив, курага, инжир) дают в размоченном виде и в составе приготовленных блюд. Капуста белокочанная, молодая стручковая фасоль, зеленый горошек разрешаются при хорошей переносимости. Зелень петрушки, укропа, сельдерея хорошо добавлять к различным блюдам и салатам.


Если после прочтения статьи у Вас остались вопросы или Вы не понимаете как применить рекомендации в Вашем конкретном случае, приглашаем Вас с ребенком на осмотр детского гастроэнтеролога в ДДЦ. Для удобства родителей записаться на приём детского гастроэнтеролога в Детском диагностическом центре можно и в будний день и по субботам.
Будем рады помочь!

Возврат к списку

«Хороший стол – хороший стул». Как нормализовать пищеварение

Пищеварение – основа хорошего самочувствия и долголетия. Ведь кишечник – это второй мозг. 90% серотонина, который обеспечивает наше позитивное отношение к жизни, образуется в кишечнике. И поэтому важность этого процесса трудно переоценить.

Нужно очень хорошо жевать пищу

Пищеварение начинается во рту, где щелочная среда, затем оно продолжается в желудке, где среда кислая, дальше в 12-ти перстной кишке снова щелочная реакция и в тонком – снова щелочная, и в толстом – кислая. Вот так меняется pH. Когда мы проглатываем не дожёванную пищу, то пищеварение нарушается уже во рту и далее – на всех этапах. В результате человек мучается от вздутия, испытывает дискомфорт, развиваются ненужные бактерии, меняется микробиота и иммунитет. Человек становится уязвимым к болезням.

Достаточный питьевой режим

Современные люди недостаточно пьют обычной чистой воды комнатной температуры. Нужно начать за этим следить. Приложений на телефон, которые это помогают сделать, много. Два литра в день обеспечивают хорошее самочувствие и профилактику тромбоза. Кстати, холодную воду пить не надо. Горячая возможна только если нет противопоказаний, таких как камни в почках, поэтому ее можно лишь после консультации с вашим врачом.

Ежедневный стул

Его нужно добиться любым способом. Из быстрых лайфхаков:

Магний. Мы живем в его дефиците. А ведь это элемент спокойствия, он дает мышечное расслабление. Магний вечером 400 мг- это рекомендация без противопоказаний.

Пищевые волокна. Мы не додаем овощей и клетчатки. Поэтому волокна можно добавлять в рацион в любом виде.

Уберите гаджеты из туалета.

Если стула нет каждый день, то нужно обследоваться у врача. Ведь вы каждый день что-то едите, и поэтому каждый день должны выводить из себя что-то.

Это особенно важно для женщин. С желчью женский организм покидают токсичные метаболиты эстрогенов и если происходит задержка стула, то они снова всасываются и вызывают такие заболевания как эндометриоз, фиброзно-кистозную мастопатию, повышают риск онкологии.

Переобучение кишечника: стратегии установления контроля над кишечником

Обучение или переподготовка кишечника относится к программам поведения, разработанным, чтобы помочь людям с расстройствами кишечника установить или восстановить контроль. Эти программы могут быть полезны людям с симптомами неспособности контролировать дефекацию, неполного опорожнения или хронического запора. Переобучение кишечника работает путем обучения новым навыкам или стратегиям разработки обычного и предсказуемого графика эвакуации. Это предотвращает запор и снижает вероятность непредсказуемого выведения.

К специалистам здравоохранения, имеющим опыт оценки и лечения заболеваний кишечника, относятся врачи, специализирующиеся на гастроэнтерологии, колоректальных заболеваниях или физической медицине и реабилитации. Медсестры, специализирующиеся на гастроэнтерологии, реабилитации или энтеростомальной терапии, также хорошо разбираются в этой области.

Оценка перед началом программы тренировки кишечника должна включать исчерпывающий анамнез кишечника, в котором рассматриваются прошлые и настоящие паттерны выведения кишечника, история болезни, диета и лекарства.Следует принимать во внимание влияние расстройства на жизнь человека, а также его или ее цели в отношении управления кишечником. Медицинский осмотр может включать специальные тесты для оценки различных факторов, влияющих на контроль кишечника. Полезным инструментом при разработке индивидуальной программы лечения является дневник симптомов, в котором записывается время произвольных и непроизвольных испражнений и других симптомов, связанных с заболеванием. Одновременно можно вести дневник питания. Тип съеденной пищи и жидкости помогает определить консистенцию стула.

Программы тренировки кишечника обычно принимают во внимание эти три основных принципа:

  1. Улучшить консистенцию стула.
  2. Установите обычное время для исключения.
  3. Регулярно стимулируйте опорожнение. Перед началом программы важно исключить каловые пробки. Это необходимо исправить, иначе попытки тренировать кишечник будут неудачными.

Нормализовать консистенцию стула

Оптимальная консистенция стула - это сформированный мягкий стул.Твердый стул трудно откачать, и утечка более вероятна, если стул жидкий. Следует есть хорошо сбалансированные, регулярно рассчитанные по расписанию блюда с высоким содержанием клетчатки. Пищевые волокна относятся к тем частям пищи, которые люди не могут переваривать. Это включает цельнозерновые, бобовые, свежие фрукты и овощи. Клетчатка увеличивает объем стула, выводит излишки жидкости и способствует более частым и регулярным движениям. При увеличении клетчатки важно пить достаточно жидкости. Если потребление жидкости недостаточное, стул становится жестким, поскольку в толстой кишке остается меньше воды.Количество клетчатки и жидкости, необходимое для оптимальной работы кишечника, варьируется от человека к человеку. Диетологи являются экспертами в оценке и корректировке диет.

Подробнее о пищевых волокнах

Установить основное время для исключения

Программа тренировки кишечника должна выполняться каждый день в одно и то же время. Цель состоит в том, чтобы установить обычное и предсказуемое время для устранения. При выборе подходящего времени человек должен учитывать его или ее прошлую модель выведения кишечника и нынешний образ жизни.Время должно быть удобным и не спешить. Планирование программы после еды позволяет воспользоваться волнообразными движениями, которые продвигают каловые массы через толстую кишку в прямую кишку, которые происходят через 20-30 минут после еды.

Регулярное стимулирование опорожнения

Для опорожнения прямой кишки может потребоваться какой-либо стимул. Стимул будет варьироваться от человека к человеку. Стимул создает перистальтику или волновые движения толстой кишки. Прием пищи или горячего напитка может стимулировать некоторых людей.Другим может потребоваться использование суппозиториев, клизм или слабительных (только по рекомендации врача) или комбинации вышеперечисленного. Следует использовать наименьший стимул, способствующий эвакуации.

Адаптировано из публикации IFFGD: «Стратегии установления контроля над кишечником» Мэри К. Пламмер, OTR, WI.

Руководство по профилактике рака толстой кишки: нормализация стула

Шаг 1. Нормализация аномального стула

Большинство взрослых американцев «носят» от 10 до 20 фунтов сформированного стула внутри своего кишечника вместо 1-2 фунтов полумягких фекалий, как это предполагала мать-природа.Эта патология стоит за бушующими эпидемиями кишечных расстройств и колоректального рака в Соединенных Штатах. Таким образом, уменьшение размера, веса и плотности стула до нормы и сохранение их в таком состоянии до конца вашей жизни является наиболее важным и эффективным шагом к цели предотвращения колоректального рака.

Источник: Википедия; под лицензией Creative Commons [ссылка]

Обильный и тяжелый стул вызывает расстройства кишечника, которые предшествуют раку толстой кишки. по тем же причинам, что большие и глубокие выбоины портят вашу машину подвеска - ускоренный износ.

Пока ваше тело еще молодое и упругое, оно может справиться с «Выбоины» с относительной легкостью. Но по мере того, как он стареет и теряет упругость и эластичность, кишечник трансформируется в разместить «тяжелый багаж».

Однако за эту трансформацию приходится дорого обходиться: увеличение кишечника, дивертикулярная болезнь, внутреннее увеличение геморрой, повреждение аноректального нерва, инерция моторики и последующее накопление пораженного стула внутри толстой кишки, что приводит к нерегулярность и / или запор.Колоректальные полипы, поражения и опухоли завершены. эта цепочка событий, с основной тяжестью «поломок» начиная с 50 лет.

Увы, вы не можете заменить толстую кишку, чтобы поддерживать стареющий организм. таким же образом можно заменить амортизаторы на опорные стареющая машина. Однако вы можете «продлить гарантию», уменьшение размера, веса и плотности стула так же, как движение по выбоинам, продлевает срок службы вашего машина.

Чтобы узнать, какие табуреты считаются «большими», а какие нет, посмотрите на графике слева.Если ваш похож на тип 2 или 3, вы в «глубоком дерьме» в прямом и переносном смысле. Значит, ваш кал воздействуют на всю длину ваш толстый кишечник вплоть до слепой кишки, особенно тип 2. Подробнее о Таблица табуретов Бристоля, и что это значит здесь.

Затрудненный стул требует значительных физических усилий (напряжения) для устранения их. Возникающее давление на тонкий и узкий анал канал вызывает анальные разрывы (полосы крови на стуле), повреждение нервов (потеря ощущения позывов) и увеличенное внутреннее геморрой (боль при дефекации) при прохождении большого стула анальный канал.

По мере развития этих состояний дефекация становится все более и более трудным, болезненным и неполным, еще большее увеличение размеров табуретов. Как размер табуретов и объем увеличивается, стул растягивает толстую кишку и вызывает дивертикулез.

Почти постоянный контакт с большими стульями, такими как 2 и 3 тип с внутренней стенкой толстой кишки вызывает неизбежное воспаление, удаляет слизистую оболочку при движется вниз и наружу и способствует образованию полипов и поражения.

Вздутие живота, спазмы, сильное метеоризм и случайная диарея является маркером этого состояния. Обычно толстая кишка поглощает большую часть газов, связанных с брожением, обратно в кровоток для выпуска через легкие. Воспаление слизистая оболочка, однако, блокирует их всасывание. Отсутствие немедленный выход, захваченные газы расширяют толстую кишку. Этот расширение, в свою очередь, вызывает вздутие живота и болезненные ощущения. спазмы.

Более тяжелое воспаление кишечника также блокирует поглощение жидкостей, которые непрерывно стекают из тонкий кишечник.Когда объем и давление жидкостей превышает удерживающую способность толстой кишки, и они достигают прямой кишки, пострадавший испытывает обильный понос. В в результате освобождение застрявшего стула дает временную передышку до порочного круга нерегулярность -> больше клетчатки -> увеличение стула -> воспаление слизистой оболочки -> диарея возобновляется снова.

Пока идет вся эта тяжелая работа, один день вы можете оказаться в кабинете врача с острым животом боль, скорее всего, связанная с дивертикулярной болезнью.После просмотр результатов вашего отчета о колоноскопии или компьютерной томографии (добавляя еще одну дозу радиации, вызывающей рак), ваш врач порекомендует больше клетчатки, чтобы набрать и без того большой стул и больше упражнений для укрепления мышц брюшного пресса, чтобы вы могли напрячься с еще большей силой!

Я ничего из этого не придумываю. Вот дословное описание этого протокола любезно предоставлено The Merck Руководство [ссылка]:

Если вы последуете этому совету, вы практически гарантированно получите один день в больнице с острым дивертикулитом или толстой кишкой перфорация, или аппендицит, или выпадение прямой кишки, или внутренняя кровотечение или что-то еще не менее плохое.

В тот момент, когда ты признаться, врачи начинают лечение с того, что жидкая диета без клетчатки, чтобы вы могли (наконец) поправиться. если ты действительно испортились, снова заказывают компьютерную томографию или операцию по вырежьте пораженные участки толстой кишки [ссылка]:

При выписке из больницы врачи порекомендуют вам: снова возобновите диету с высоким содержанием клетчатки, как только вылечитесь:

И так до колэктомии или колоректального рака, в зависимости от того, что наступит раньше, при условии, что вы не уступите первым инсульт, сердечный приступ, инфекция грудной клетки, почечная недостаточность или любой другой другие виды рака в результате кровопотери, операций, общего анестезия, радиация, побочные эффекты лекарств, сильный стресс, или медицинские ошибки.

Кому Избегайте этих рисков, просто нормализуйте стул, чтобы правильный введите 4 или 5, следуя моим рекомендациям на странице «Восстановление естественного движения кишечника и нормализация стула».

Я предоставил непропорционально большое количество внимание к обсуждению дивертикулярной болезни для простого Причина: локализованное воспаление дивертикула является наиболее вероятная точка происхождения предраковых поражений, полипов и опухоли. Соответственно, дивертикулез является маркером большого стул, и представляет одну из самых высоких степеней риска для колоректальный рак.

По данным Национального института Здоровье, около половины всех людей старше 60 лет имеют дивертикулез [ссылка]. На ту же возрастную группу влияют колоректальный рак чаще всего. Вы видите какую-нибудь связь?

Если вам уже поставили диагноз: дивертикулярная болезнь, и хотелось бы избавить себя от связанных осложнений, следуйте моим рекомендациям в Дивертикулез и Дивертикулит с.

Примечание автора

Следующее предложение было добавлено к разделу Дивертикулез Руководства Merck в 2007 г., I полагаю, конкретно отреагирую на мой анализ оптоволоконно-дивертикулезное соединение в Fiber Menace опубликовано двумя годами ранее.

Интуитивный совет избегать семян или других диетических продуктов. материал, который может попасть в дивертикул, не имеет установленная медицинская база.

Претензия " без установленного медицинского основания " это неверно. Дело в том, что к тому времени, когда пораженная толстая кишка осмотрена радиологом или эндоскопистом на предмет повреждений, есть уже был тщательно промыт (вычищен) от стула, в том числе пострадали, поэтому врачи не увидят ничего, кроме незагрязненная толстая кишка, чистые стенки кишечника и пустые дивертикулы.

Угроза волокна , собственно, различает маленькие и большие дивертикулы, так как а также мягкий и твердый стул. Недостаток « диетического материала » возможно только при больших размерах пораженного дивертикула или стул твердый и большой. Во всех остальных случаях действительно ничто не может « повлиять на ». Вот актуальный отрывок из моей книги:

Начало дивертикулеза развивается на латентной стадии запор, связанный с клетчаткой, который, как вы можете напомним, в первую очередь характеризуется натуживание, геморрой и большой тип 1–3 табуреты по Бристольской шкале формы стула.В меньшие дивертикулы в диаметре от 3 мм до 3 см, и обычно бывают множественными. В действительно большие, скорее всего, одиночный (единственное число - дивертикул), и диапазон диаметров от 3 до 15 см. Когда фекалии, содержащие клетчатку, «попадают» в дивертикулы, они имеют тенденцию застревать там, а затем слипаются и затвердевают.

Дивертикулез может быть надежно виден и диагностирован рентгенологически (Рентген, ядерное сканирование) или колоноскопия длительная до того, как у большинства пациентов возникнут какие-либо симптомы.В общем и целом, меньшие дивертикулы безвредны, если кал остается маленьким, мягким и влажным, потому что фекалии с этими свойствами не получают в ловушке внутри небольших щелей.

Но когда кал постоянно большой, твердый и плотные, они могут содержать даже крошечные дивертикулы забит на неопределенный срок из-за того же причины, по которым плотная пробка удерживает жидкость внутри сосуд перевернулся, даже если горловина внутри есть несколько щелей.

Чем больше каловых Материя забита внутри каждого дивертикул, они могут увеличиваться чистая сила внешнего давления.В конце концов, эпителий внутри одного или больший дивертикул рвется и зараженный. Инфекция может вызвать воспаление, изъязвление, ректальное кровотечение, мучительная боль и / или перфорация стенка толстой кишки - все вместе называемые дивертикулит.

Глава 7, Дивертикулярная болезнь;
Fiber Menace, стр. 146

Если вы все еще сомневаетесь в моем анализе, проведенном еще в 2005 году (когда впервые была опубликована Fiber Menace), слава Богу, медицинская наука не в стороне. То, что я тогда «пищал», к настоящему времени превратилось в громкий припев:

Волокно не защищает от дивертикулеза

Вопреки распространенному мнению врачей, соблюдение диеты с высоким содержанием клетчатки не защитный эффект от развития бессимптомного дивертикулеза, согласно исследованию на основе колоноскопии, представленному на выставке Digestive 2011 Заседание Недели болезней (DDW) (аннотация 275).Фактически исследование показало, что пациенты, которые ели больше клетчатки, на самом деле имели более высокую распространенность болезнь. [Гастроэнтерология и Новости эндоскопии, июль 2011 г., том: 62:07]

Клетчатка не может предотвратить дивертикулярную болезнь

Для десятилетиями врачи рекомендовали диеты с высоким содержанием клетчатки пациентам из группы риска. для развития кишечных мешков, известных как дивертикулы. В думали, что, поддерживая пациентов регулярно, диета с высоким содержанием клетчатки может препятствовать образованию дивертикулов.Но новое исследование предполагает противоположное может быть правдой . [WebMD, 23 января 2012 г.]

Диета с высоким содержанием клетчатки не защищает от бессимптомного дивертикулеза

Диета с высоким содержанием клетчатки и повышенная частота испражнений связана с большей, чем ниже - дивертикулез. Гипотезы относительно риска факторы бессимптомного дивертикулеза следует пересмотреть. [Гастроэнтерология; Том 142, выпуск 2, страницы 266-272.e1, февраль 2012 г.]

Если вы похожи на « нормальный », обсуждение показателей своего стула - табу не только между родителями и их взрослыми детьми, но также между супругами и братьями и сестрами. Что ж, вам не обязательно ... Вместо этого просто нажмите кнопку ниже, чтобы поделиться этой жизненно важной информацией с людьми, которых вы любите.

Константин Монастырский

Понимание физики функциональных волокон в желудочно-кишечном тракте: научно обоснованный подход к устранению стойких заблуждений о нерастворимой и растворимой клетчатке

Устойчивые заблуждения о физических эффектах клетчатки в кишечнике привели к неправильному пониманию преимуществ для здоровья, связанных с нерастворимой и растворимая клетчатка.Этот обзор будет сосредоточен на изолированных функциональных волокнах (например, пищевых добавках), влияние которых на клинические исходы было легко оценено в хорошо контролируемых клинических исследованиях. В этом обзоре также будут рассмотрены три преимущества для здоровья (снижение уровня холестерина, улучшение гликемического контроля и нормализация формы стула [запор и диарея]), для которых были опубликованы воспроизводимые доказательства клинической эффективности. В тонком кишечнике клинически значимые преимущества для здоровья (например, снижение холестерина и улучшение гликемического контроля) сильно коррелируют с вязкостью растворимых волокон: волокон с высокой вязкостью (например, гелеобразующих волокон, таких как b-глюкан, псиллиум и сырой гуар). камедь) проявляют значительный эффект на снижение уровня холестерина и улучшение гликемического контроля, тогда как невязкие растворимые волокна (например, инулин, фруктоолигосахариды и декстрин пшеницы) и нерастворимые волокна (например, пшеничные отруби) не обеспечивают этих зависимых от вязкости преимуществ для здоровья.В толстом кишечнике есть только два механизма, вызывающих слабительный эффект: крупные / грубые частицы нерастворимых волокон (например, пшеничные отруби) механически раздражают слизистую оболочку кишечника, стимулируя воду и слизистую секрецию, а также высокая водоудерживающая способность гелеобразователя. растворимая клетчатка (например, псиллиум) сопротивляется обезвоживанию. Оба механизма требуют, чтобы клетчатка сопротивлялась ферментации и оставалась относительно неповрежденной на протяжении всего толстого кишечника (т.е. клетчатка должна присутствовать в стуле), и оба механизма приводят к повышенному содержанию воды в стуле, что приводит к объемному / мягкому / легкому прохождению стула. .Растворимые ферментируемые волокна (например, инулин, фруктоолигосахарид и декстрин пшеницы) не оказывают слабительного эффекта, а некоторые волокна могут вызывать запор (например, декстрин пшеницы и мелкие / гладкие нерастворимые частицы пшеничных отрубей). При составлении рекомендаций по добавке клетчатки важно понимать, какие волокна обладают физическими характеристиками, необходимыми для обеспечения положительного воздействия на здоровье, а какие пищевые добавки подтверждаются воспроизводимыми точными доказательствами одного или нескольких клинически значимых преимуществ для здоровья.

Доказательный подход к добавкам клетчатки и клинически значимым преимуществам для здоровья, часть 2

Nutr Today. 2015 Март; 50 (2): 90–97.

На что обратить внимание и как порекомендовать эффективную волоконную терапию

Джонсон В. МакРори-младший, доктор философии, FACG, AGAF, FACN, - клинический ученый, Procter & Gamble, Мейсон, Огайо, где он работал на 18 лет. После службы в армии США (509-я воздушно-десантная, 221-я военная полиция) доктор МакРори получил степень младшего специалиста по медсестринскому делу и проработал 14 лет в отделении неотложной помощи / отделении интенсивной терапии в учебных больницах, включая больницу Джона Хопкинса в Балтиморе и детскую больницу. Госпиталь Национального медицинского центра в Вашингтоне, округ Колумбия.Затем он получил степень бакалавра наук в Университете Мэриленда, а затем получил двойную докторскую степень в области нейробиологии и физиологии в Университете штата Мичиган, где он также был инструктором по физиологии в медицинской школе. Доктор МакРори ранее был директором по клиническим вопросам в Ethicon Endo-Surgery, компании Johnson & Johnson. Его исследовательские интересы включают нейрогастроэнтерологию и моторику, гастроэзофагеальную рефлюксную болезнь и физическое влияние пищевых добавок на метаболический синдром, снижение уровня холестерина, улучшение гликемического контроля, запоры, диарею и синдром раздраженного кишечника.Он является научным сотрудником Американского колледжа гастроэнтерологии, Американской гастроэнтерологической ассоциации и Американского колледжа питания, а также членом Американской диабетической ассоциации.

Для корреспонденции: Джонсон В. МакРори младший, доктор философии, FACG, AGAF, FACN, Procter & Gamble, Mason Business Center, 8700 Mason-Montgomery Road, Mason, OH 45040 ([email protected]). Авторское право © 2015 Wolters Kluwer Health, Inc. Все права защищены.

Это статья в открытом доступе, распространяемая в соответствии с условиями Creative Commons Attribution-NonCommerical-NoDerivatives 3.0 Лицензия, где разрешено скачивать и делиться работой при условии правильного цитирования. Произведение не может быть изменено или использовано в коммерческих целях.

Эта статья цитируется в других статьях в PMC.

Abstract

Пищевые волокна, которые являются неотъемлемой частью продуктов, богатых клетчаткой (например, фрукты, овощи, бобовые, цельнозерновые), считаются полезными для здоровья при потреблении в рекомендованных дозах (25 г / день для взрослых женщин. , 38 г / сут для взрослых мужчин). Большинство (90%) населения США не потребляет такой уровень пищевых волокон, в среднем всего 15 г / день.Пытаясь восполнить этот «пробел в волокнах», многие потребители обращаются к добавкам волокон, которые, как правило, изолированы от одного источника. Нельзя предположить, что пищевые добавки с клетчаткой обеспечивают те преимущества для здоровья, которые связаны с пищевыми волокнами из цельных продуктов. Из представленных сегодня на рынке пищевых добавок только меньшая часть обладает физическими характеристиками, лежащими в основе механизмов, обеспечивающих клинически значимую пользу для здоровья. В этой серии из двух частей первая часть (предыдущий выпуск) описывала 4 основных характеристики пищевых добавок, определяющих клиническую эффективность (растворимость, степень / скорость ферментации, вязкость и гелеобразование), 4 клинически значимых обозначения, которые определяют, какие из них Польза для здоровья связана с определенными волокнами и гелеобразными механизмами в тонкой кишке, которые обеспечивают определенные преимущества для здоровья (например, снижение уровня холестерина, улучшение гликемического контроля).Вторая часть (текущий выпуск) этой серии из двух частей будет посвящена влиянию пищевых добавок с клетчаткой на толстую кишку, включая 2 механизма, с помощью которых клетчатка предотвращает / снимает запор (нерастворимый механический раздражитель и растворимый гель-зависимая водоудерживающая способность. ), гелеобразный механизм ослабления диареи и нормализации формы стула при синдроме раздраженного кишечника, а также комбинированные эффекты волокон толстой и тонкой кишки для снижения / поддержания веса. Во второй части также будет обсуждаться, как переработка продаваемых продуктов может снизить эффективность, почему добавки с клетчаткой могут вызывать желудочно-кишечные симптомы и как избежать симптомов для лучшего долгосрочного соблюдения.

ВЛИЯНИЕ ВОЛОКОННЫХ ДОБАВОК НА БОЛЬШОЙ КИШЕЧНИК

Толстый кишечник состоит из слепой кишки (самая проксимальная часть, принимает остатки жидкости из дистального отдела подвздошной кишки), толстой кишки (восходящей, поперечной, нисходящей и сигмовидной), прямой кишки и ануса. . Примерно 1500 мл жидкого остатка поступает в толстую кишку ежедневно, и обычно более 90% воды и электролитов постепенно реабсорбируются, что приводит к образованию стула.1 Двигательные явления в толстой кишке сегментарны на 95% («смешивание»). ”Волны), которые способствуют поглощению воды и электролитов, тогда как оставшиеся ≈ 5% представляют собой распространяющиеся сокращения (перистальтику).2 Распространяющиеся сокращения происходят в широком диапазоне амплитуд и скоростей прохождения, от частых волн малой амплитуды (10 мм рт. к нечастым высокоамплитудным (> 100 мм рт. весь желудочно-кишечный тракт менее чем за 1 час (метеоризм ≈ 14 эпизодов в день) по сравнению с твердым стулом, для прохождения которого по толстому кишечнику может потребоваться несколько дней (нечастые испражнения).2,3

ВЛИЯНИЕ НА БОЛЬШОЙ КИШЕЧНИК: ДОБАВКИ ИЗ ВОЛОКНА ПРИ ЗАРЯДЕ, ДИАРЕИ И СИНДРОМЕ РАЗДРАЖЕНИЯ КИШКИ

Есть 2 механизма, с помощью которых добавки клетчатки могут уменьшить запор: (1) механическая стимуляция / раздражение слизистой оболочки толстой кишки и (2) гель -зависимая / вязкая водоудерживающая способность, препятствующая обезвоживанию. Оба механизма требуют добавки клетчатки, которая относительно неферментирована, поэтому большая часть клетчатки остается нетронутой и присутствует в стуле по всему толстому кишечнику.

Первый механизм - это механическое раздражение слизистой оболочки кишечника частицами нерастворимой клетчатки. Механическая стимуляция / раздражение приводит к секреции слизи и воды, что приводит к увеличению / мягкости стула и более быстрому прохождению через толстую кишку. Этот механизм пропорционален размеру и форме частиц - крупные крупные частицы обладают значительным слабительным эффектом, тогда как мелкие гладкие частицы - нет. 3–8 Этот эффект был обнаружен при оценке размолотых пшеничных отрубей до частиц разного размера / формы по сравнению с пластиковыми частицами, нарезанными для соответствия. .6,8 Пластмассовые частицы имели такое же слабительное действие, как и пшеничные отруби, и величина эффекта зависела от размера / формы частиц. Нерастворимая клетчатка не обладает водоудерживающей / гелеобразующей способностью, поэтому добавки с нерастворимой клетчаткой не могут быть полезны для уменьшения жидкого / жидкого стула при диарее. Стимулирующее / раздражающее действие нерастворимых частиц на слизистую оболочку может фактически усугубить симптомы диареи и синдрома раздраженного кишечника (СРК) .9,10

кишечник.Невязкие растворимые волокна, такие как декстрин пшеницы и инулин, ферментируются (не присутствуют в стуле по всему толстому кишечнику) и не обладают водоудерживающей способностью и, таким образом, не оказывают слабительного эффекта в физиологических дозах.11–24 Декстрин пшеницы на самом деле имеет большое значение. эффект запора при физиологических дозах (например, 10-15 г / день) .23 Большинство гелеобразующих волокон (например, гуаровая камедь, камедь акации, β-глюкан из овса и ячмень) также ферментируются в толстой кишке, что приводит к потеря их вязкой / гелеобразной природы3,4,25 и отсутствие слабительного эффекта.После ферментации клетчатка перестает быть неповрежденной и не присутствует в стуле, не имея водоудерживающей способности, необходимой растворимым волокнам для улучшения формы стула и улучшения симптомов запора, диареи или СРК.

В отличие от пищевых добавок, описанных выше, псиллиум не ферментируется в кишечнике3,26 и сохраняет свою водоудерживающую гелеобразную структуру по всей толстой кишке. Хотя псиллиум часто считается ферментируемым, существует значительное расхождение между данными in vitro и человеческим (клиническим) опытом.В условиях испытаний in vitro псиллиум смешивают со стулом и гомогенизируют в высокоскоростном механическом смесителе27–29. Гидратированный / гелеобразный псиллиум подвергается быстрым механическим сдвигающим силам, которые разрушают физическую структуру гелевой матрицы, искусственно делая псиллиум невязким / невязким. сбраживаемый. Напротив, 5 хорошо контролируемых клинических исследований показывают, что псиллиум не ферментируется в кишечнике человека.30–34 В 5 клинических исследованиях оценивалась ферментация псиллиума по сравнению с отрицательным контролем (плацебо), положительным контролем (лактулоза) и / или сравнительные пищевые добавки с клетчаткой (например, метилцеллюлоза, гуаровая камедь, пектин, целлюлоза), оценка газов из дыхания, метеоризма и / или продукции короткоцепочечных жирных кислот.Все 5 исследований показали, что гель псиллиума не подвергался ферментации.26 Этот удерживаемый гель позволяет псиллиуму оказывать дихотомический эффект в качестве нормализатора стула: смягчает твердый стул при запоре (более мягкий и объемный стул, который легче проходит, повышенная скорость прохождения кишечника, улучшенное опорожнение кишечника). частота) 3,7,35 и улучшает консистенцию жидкого / жидкого стула при диарее (сформированный стул, более медленная скорость прохождения, снижение позывов, менее частые испражнения) 36–39

В рандомизированном двойном слепом клиническом исследовании 170 пациентов с хроническим идиопатическим запором показали, что псиллиум превосходит докузат в отношении увеличения содержания воды в стуле (более мягкий стул; P =.007) и частота испражнений ( P = 0,02) .7 Целевая группа Американского гастроэнтерологического колледжа по хроническим запорам систематически проанализировала имеющиеся клинические данные об использовании пищевых добавок при хронических запорах и пришла к выводу, что клинических данных недостаточно. чтобы поддержать рекомендацию по поликарбофилу кальция, метилцеллюлозе или отрубям, но пришел к выводу, что псиллиум был единственной добавкой клетчатки с достаточными клиническими данными, чтобы поддержать рекомендацию по лечению хронического запора.40 Кроме того, в недавнем (2013 г.) всестороннем обзоре влияния клетчатки на функциональные расстройства кишечника был сделан вывод о том, что рекомендация в отношении псиллиума лучше всего подтверждается имеющимися клиническими данными.9 Этот вывод согласуется с более ранним систематическим обзором, проведенным Американским колледжем. гастроэнтерологической рабочей группы по СРК, которая также пришла к выводу, что псиллиум эффективен для лечения СРК.41

ВЛИЯНИЕ НА МАЛЕНЬКУЮ КИШЕЧНИКУ СОВМЕСТНО С ЭФФЕКТАМИ БОЛЬШОЙ КИШКИ: НАСЫЩЕННОСТЬ ВЛИЯЕТСЯ ОБРАЗОВАНИЕМ ГЕЛЯ (МАЛЫЙ КИШЕЧНИК), ПОТЕРЯ ВЕСА / ПОДДЕРЖАНИЕ ИНФОРМАЦИИ. К ФЕРМЕНТАЦИИ (ЖЕЛТЫ, ПОВРЕЖДЕННЫЕ В БОЛЬШОЙ КИШЕЧНИКЕ)

Высокий уровень потребления пищевых волокон (например, заменителей) был связан с 30% снижением риска набора веса или развития ожирения.42–44 Однако, как обсуждалось в предыдущих разделах, следует с осторожностью относить пользу для здоровья от диетического заменителя и добавок с клетчаткой . Недавний всесторонний обзор доступных клинических данных показал, что резистентный крахмал (растворимый, невязкий, ферментируемый; например, пшеничный декстрин) не оказывал значительного влияния на чувство сытости или потерю веса в физиологических дозах45. потеря для добавки с «пребиотическими» волокнами (растворимой, невязкой, ферментируемой), но более внимательный взгляд на данные показывает, что группа пребиотических волокон (8 г / день) не отличалась от исходного уровня по индексу массы тела.46 Напротив, гелеобразующие волокна (например, гуаровая камедь, пектин и псиллиум), как было показано, усиливают чувство сытости и снижают последующее потребление энергии.47–49 Цитируемое клиническое исследование продемонстрировало, что яблоки были значительно более насыщенными, чем клетчатка. бесплатный яблочный сок, даже несмотря на то, что сок содержит тот же уровень углеводов, что и яблоки.50 Пектин является гелеобразующим волокном в яблоках и, как было показано, усиливает чувство сытости.51

Гелеобразующие волокна могут влиять на чувство сытости по нескольким механизмам, включая замедленное разложение и всасывание питательных веществ в тонкой кишке, что приводит к «устойчивой» доставке питательных веществ и доставке питательных веществ в дистальный отдел подвздошной кишки с последующей стимуляцией механизма обратной связи, такого как феномен «подвздошного тормоза» (замедляет опорожнение желудка и тонкой кишки транзит) и снижение аппетита.3,4,52–54 Исследования использовали нерастворимую клетчатку или растворимую невязкую клетчатку в качестве отрицательного контроля, подтверждая утверждение о том, что влияние на чувство сытости является гелеозависимым явлением.49,55–59 Сытость часто оценивается вкратце: термин клинические исследования как инструмент или механизм для прогнозирования потенциала снижения потребления энергии и потери веса, но конечной терапевтической целью является потеря веса (или предотвращение восстановления веса). Обзор влияния пищевых добавок на потерю веса60 выявил 17 плацебо-контролируемых клинических исследований, в большинстве из которых испытуемые поддерживали диету с ограничением энергии и добавки с клетчаткой (в основном нерастворимой клетчаткой), которые давали 3 раза в день перед едой.Потребление пищевых добавок варьировалось от 4,5 до 20 г / день, и результаты показали, что только одно из 17 исследований предоставило доказательства большей потери веса, чем плацебо, 60 подтверждая предыдущий вывод о том, что нерастворимая клетчатка не оказывает значительного клинического воздействия на тонкую кишку.

В ходе 6-месячного исследования сравнивалось влияние вязкости на потерю веса путем оценки вязкого, гелеобразующего неферментированного волокна (псиллиум) и менее вязкого, легко ферментируемого волокна (частично гидролизованная гуаровая камедь) .61 Это рандомизированное контролируемое клиническое исследование. был включен 141 пациент с метаболическим синдромом.Пациенты поддерживали только ограниченную диету (диета Американской кардиологической ассоциации, ступень 2, отрицательный контроль) или ограниченная диета с добавлением псиллиума или частично гидролизованной гуаровой камеди (оба принимали по 3,5 г два раза в день во время завтрака и ужина). Контрольная группа показала постепенную потерю веса в течение первых 4 месяцев с последующим набором веса (рисунок). Через 2 месяца группа, получавшая гуаровую камедь, показала заметное снижение веса (-2,4 кг по сравнению с исходным уровнем), но это изменилось в сторону восстановления веса в течение следующих 4 месяцев (рисунок).Напротив, группа лечения псиллиумом показала постепенную и устойчивую потерю веса в течение всего 6-месячного периода тестирования (рисунок). Через 6 месяцев потеря веса в группе лечения псиллиумом составила -3,3 кг по сравнению с исходным уровнем, -2,1 кг по сравнению с контролем и -1,76 кг по сравнению с гуаровой камедью ( P <0,01 для всех трех сравнений) 61. Характеристики волокна, высокая вязкость / гелеобразование и неферментированность (отсутствие калорийности клетчатки) могут играть ключевую роль в долгосрочной потере веса.61

Приведены результаты 6-месячного исследования пациентов с метаболическим синдромом.Одна только ограниченная диета показала умеренную потерю веса в течение 4 месяцев с последующим увеличением веса. В сочетании с ограниченной диетой частично гидролизованная гуаровая камедь (3,5 г два раза в день), менее вязкая, легко ферментируемая клетчатка, показала значительную потерю веса через 2 месяца с последующим увеличением веса в течение следующих 4 месяцев. Напротив, псиллиум (3,5 г два раза в день), вязкая, гелеобразующая, неферментированная клетчатка, в дополнение к ограниченному рациону продемонстрировал устойчивую потерю веса в течение 6-месячного исследования. Источник: МакРори Дж., Фэи Дж.Обзор физиологии желудочно-кишечного тракта и механизмов, лежащих в основе пользы пищевых волокон для здоровья: соответствие эффективных волокон конкретным потребностям пациентов. Клин Нурс Конный завод . 2013; 1 (4): 82-92.

Следует отметить, что гелеобразующие волокна в вышеупомянутом исследовании также улучшили другие объективные клинические показатели метаболического синдрома. После 6 месяцев лечения группы лечения подорожника и гуаровой камеди показали значительное улучшение уровня глюкозы в плазме натощак (-28% против -11%, соответственно), инсулина в плазме натощак (-20% против -11%, соответственно), гемоглобина А. 1c (-10% против -10%, соответственно) и холестерин липопротеинов низкой плотности (ЛПНП) (-8% против -8%, соответственно).61 Только группа подорожника продемонстрировала значительное улучшение концентрации триглицеридов в плазме (-13,3%), систолического (-3,9%) и диастолического (-2,6%) артериального давления. По завершении исследования 12,5% пациентов в группе подорожника больше не соответствовали критериям диагностики метаболического синдрома по сравнению с 2,1% пациентов в группе гуаровой камеди и 0% пациентов в группе, получавшей только диету.61 Взятые вместе Эти данные подтверждают, что добавка с растворимой вязкой гелеобразующей клетчаткой может быть эффективной терапией для лечения метаболического синдрома.

СТЕПЕНЬ ОБРАБОТКИ МОЖЕТ ВЛИЯТЬ НА ПОВЕДЕНИЕ И ЭФФЕКТИВНОСТЬ ПОЛУЧЕНИЯ ВОЛОКНА В РЫНКАХ ПРОДУКТОВ

Хотя было ясно показано, что сырые гелеобразующие волокна (например, гуаровая камедь, высокомолекулярный β-глюкан) могут иметь значительные преимущества для здоровья, важно учитывать, как степень обработки для производства конечного продукта, представленного на рынке, может изменить вязкость / гелеобразование пищевых добавок3,57,59,62–64. Например, в двух клинических исследованиях изучалось влияние β-глюкана. из овсяных отрубей, испеченных в хлеб и печенье (исследование 1) или предоставленных в виде сырых волокон в апельсиновом соке (исследование 2), на концентрацию холестерина в сыворотке у 48 субъектов с гиперхолестеринемией.64 В первом исследовании субъекты завершили 3-недельный базовый уровень с контрольным хлебом и печеньем, богатым пшеничной клетчаткой (нерастворимый, отрицательный контроль), с последующим рандомизированным 4-недельным периодом лечения: оставались на контрольных волокнистых продуктах (отрицательный контроль) или перешли на хлеб и печенье, обогащенные β-глюканом (5,9 г / сут). Β-глюкан, испеченный в хлебе и печенье, не влиял на уровень холестерина ЛПНП в сыворотке (не отличался от отрицательного контроля). В отличие от этих результатов, исследование 2 предоставило более низкую дозу β-глюкана (5 г / день) в апельсиновом соке, что значительно снизило концентрацию холестерина ЛПНП по сравнению с контролем из пшеничных волокон ( P <.001). Авторы пришли к выводу, что пищевая матрица, обработка пищевых продуктов или и то, и другое могут отрицательно повлиять на эффективность снижения холестерина β-глюкана.64 Это подчеркивает важность признания того факта, что не все продаваемые добавки с клетчаткой будут обеспечивать клиническую эффективность исходной сырой клетчатки.

Другим примером важности обработки (нагревания и давления) на вязкость / гелеобразующую способность сырого волокна является двойное слепое, параллельное, многоцентровое клиническое исследование, в котором случайным образом было распределено 386 субъектов для приема зерновых, содержащих пшеничное волокно. (отрицательный контроль) или 1 из 3 злаков овсяных отрубей (высокой, средней и низкой вязкости), что составляет от 3 до 4 г β-глюкана в день.59 Вязкость β-глюкана изменялась в зависимости от степени обработки (тепла и давления), которой подвергалось волокно при изготовлении злаков. Результаты показали, что снижение холестерина сильно коррелировало с вязкостью β-глюкана: высокая вязкость (более низкие температуры и давление) коррелировала со значительным снижением холестерина; низкая вязкость (более высокая температура и давление) коррелировала со снижением уровня холестерина. Взятые вместе, эти исследования демонстрируют, что физико-химические свойства сырого овсяного β-глюкана были изменены в результате обработки, и следует принимать во внимание степень обработки гелеобразующего волокна (гидролиз, выпечка, экструзия под давлением с получением форм злаков) перед продажей. прежде чем рекомендовать конкретную добавку клетчатки или хлопья.

Попытки улучшить вкусовые качества пищевых добавок с клетчаткой также могут повлиять на эффективность пищевых добавок. Как обсуждалось ранее, сырая гуаровая камедь обычно представляет собой высоковязкое гелеобразующее волокно с доказанной гелеозависимой пользой для здоровья. Однако для улучшения вкусовых качеств обычно продаваемой версией является частично гидролизованная гуаровая камедь, которая представляет собой невязкий продукт, который полностью растворяется в воде без изменения вязкости. Другие аналогичные продукты также заявляют о «полностью растворяются» и / или «без вязкости» (например, пшеничный декстрин, инулин), как если бы невязкая природа волокна представляла пользу для потребителя.Реклама, в которой невязкая клетчатка сравнивается с желирующей клетчаткой на основе относительной вкусовой привлекательности, подразумевает, что две добавки с клетчаткой сравнимы по эффективности. Это подразумеваемое равенство не подтверждается клиническими данными, которые показывают, что большая часть пользы для здоровья, связанной с клетчаткой, зависит от вязкого геля. Поскольку термин добавка с клетчаткой подразумевает, что регулярное (ежедневное) потребление будет обеспечивать по существу те же преимущества для здоровья, что и диета с высоким содержанием клетчатки, разумно потребовать доказательства клинически значимой пользы для здоровья, прежде чем выбирать / рекомендовать добавку с клетчаткой.

Это требование к клиническим доказательствам соответствует определению клетчатки, предоставленному Институтом медицины 64, в котором проводится различие между «диетической клетчаткой» и «функциональной клетчаткой»: «Пищевая клетчатка определяется в этом отчете как неперевариваемые углеводы. и лигнин, который присутствует в растениях и остается неизменным. Функциональная клетчатка определяется как изолированные неперевариваемые углеводы, которые оказывают благотворное физиологическое воздействие на человека ». Обратите внимание, что определение Института медицины требует, чтобы изолированные углеводы (добавки с клетчаткой) имели клинические доказательства пользы для здоровья, прежде чем считаться функциональной клетчаткой.Это требование также согласуется с позиционным документом Академии питания и диетологии о влиянии пищевых волокон на здоровье, в котором говорится: «Некоторые пищевые добавки с клетчаткой были изучены на предмет физиологической эффективности, поэтому лучший совет - употреблять клетчатку в пищевых продуктах. Прежде чем выбирать функциональные волокна в диетической практике, поищите физиологические исследования эффективности ».66 В совокупности эти наблюдения подчеркивают важность понимания не только конкретных типов волокон, которые обладают характеристиками, тесно связанными с конкретными преимуществами для здоровья (например, вязкость / гелеобразование). ), но также и степень обработки, которой подвергся конечный продаваемый продукт.Для простого и разумного теста, чтобы определить, может ли добавка с клетчаткой обеспечивать пользу для здоровья в зависимости от геля, размешайте разовую дозу продаваемого продукта (обычно 2–4 г клетчатки) в 120 мл воды и дайте ей постоять в течение 15 минут. Если добавка с клетчаткой не растворяется в воде, а затем образует высоковязкий гель в течение отведенного времени, маловероятно, что она окажет клинически значимое влияние на снижение холестерина, улучшение гликемического контроля, контроль аппетита или другое состояние здоровья, связанное с вязкостью / гелем. преимущества.

ПОЧЕМУ ДОБАВКИ С ВОЛОКНАМИ МОГУТ ВЫЗЫВАТЬ ЖЕЛЕЗНО-КИШЕЧНЫЕ СИМПТОМЫ, И КАК ИЗБЕЖАТЬ СИМПТОМОВ ДОЛГОСРОЧНОГО СОБЛЮДЕНИЯ

Ощущение легкого дискомфорта от схваткообразной боли может быть связано с увеличением потребления пищевых волокон, особенно если у пациента запор и / или добавление клетчатки начинается в относительно высокой дозе.3,4 Когда стул такой же консистенции образуется, деформация перистальтики минимальна, поэтому нет значительного вздутия стенки кишечника.У нормальных людей этот толчок обычно не ощущается, если он не вызывает заполнение калом прямой кишки, стимулируя позыв к дефекации3,4,67. Напротив, если распространяющееся сокращение вызывает столкновение болюса стула с более низкой вязкостью, богатого клетчаткой. с более дистально сформированным / твердым стулом более низковязкий, богатый клетчаткой стул деформируется, вызывая резкое расширение кишечника, растягивая механорецепторы и вызывая ощущение дискомфорта до схваткообразной боли. Дискомфорт / боль будут временными, возникать с частотой распространяющихся сокращений и уменьшаться при дефекации.

Чтобы обеспечить долгосрочное соблюдение режима приема пищевых добавок, важно минимизировать значительные различия в вязкости стула. Для субъектов, не страдающих запорами, это влечет за собой постепенное начало приема новых пищевых добавок с клетчаткой, начало дозирования не более 3 или 4 г / день в первую неделю, а затем очень постепенное увеличение в течение последующих недель с целью примерно от 10 до 15 г / день. Для пациентов, страдающих запором, любое введение нового режима приема клетчатки сопряжено со значительным риском спазматической боли, если сначала не будет устранен твердый стул.Разумным предложением является сначала очистить кишечник от твердого стула значительной дозой осмотического слабительного (например, полиэтиленгликоля). Последующие схваткообразные боли и возможный жидкий стул после опорожнения твердого стула будут связаны с осмотическим слабительным, а не с добавкой клетчатки. После того, как твердый стул очистится, постепенно вводите новую добавку клетчатки, как указано выше. Это может улучшить долгосрочное соблюдение новых пищевых добавок с клетчаткой.

Выводы

Несмотря на общее мнение о том, что клетчатка «полезна для вас», важно осознавать разницу между заменой диетической клетчаткой, которая является неотъемлемой и неизменной в цельных продуктах, и добавкой с изолированным источником клетчатки.Нельзя предположить, что пищевые добавки с клетчаткой обладают такой же пользой для здоровья, как и пищевые волокна, которые являются неизменными и присутствуют в цельных продуктах. Клинически доказанная польза для здоровья от пищевых добавок связана с конкретными характеристиками (например, вязкий гель), и только небольшая часть продаваемых на рынке продуктов с клетчаткой обеспечивает пользу для здоровья (суммировано в таблице). Как описано в части 1 этой серии из двух частей, польза для здоровья, связанная с действием клетчатки в тонкой кишке (например, снижение уровня холестерина, улучшение гликемического контроля), является гелезависимым явлением, и степень пользы пропорциональна вязкости. желирующего волокна.Как описано в части 2 этой серии статей, польза для здоровья, связанная с воздействием клетчатки в толстом кишечнике (например, облегчение при запоре, диарее, СРК), обусловлена ​​двумя механизмами: нерастворимая клетчатка обеспечивает механический стимул, пропорциональный размеру частиц (например, пшеничные отруби - смягчают твердый стул при запоре, но могут усугубить диарею и СРК), тогда как растворимые неферментированные гелеобразующие волокна сохраняют свою высокую водоудерживающую способность по всей толстой кишке, обеспечивая эффект нормализации стула (например, псиллиум - смягчает твердый стул). стул при запоре, уплотняет жидкий / жидкий стул при диарее, нормализует форму стула при СРК).При рекомендации добавки с клетчаткой клинически доказано, что только растворимая неферментирующая, гелеобразующая клетчатка обеспечивает все преимущества для здоровья, обычно связанные с добавкой клетчатки.

ТАБЛИЦА

Клинически подтвержденная польза для здоровья, связанная с обычными добавками клетчатки

Сноски

Автор является штатным сотрудником компании Procter & Gamble, которая продает волокнистые продукты.

ССЫЛКИ

1. Гайтон А., Холл Дж.Учебник медицинской физиологии. 11-е изд Филадельфия, Пенсильвания: Elsevier Inc; 2006 г. Раздел XII, главы 62–66. [Google Scholar] 2. МакРори Дж., Гринвуд-Ван Меервельд Б., Рудольф К. Характеристика распространяющихся сокращений в проксимальном отделе толстой кишки амбулаторных мини-свиней. Dig Dis Sci. 1998; 43 ( 5): 957– 963. [PubMed] [Google Scholar] 3. Макрори Дж, Фэи Дж. Обзор физиологии желудочно-кишечного тракта и механизмов, лежащих в основе пользы пищевых волокон для здоровья: соответствие эффективных волокон конкретным потребностям пациентов.Clin Nurs Stud. 2013; 1 ( 4): 82– 92. [Google Scholar] 4. Чуткан Р., Фэйи Дж., Райт В., МакРори Дж. Сравнение вязких и невязких добавок с растворимой клетчаткой: механизмы и доказательства пользы для здоровья, связанной с клетчаткой. J Am Acad Nurse Pract. 2012; 24: 476– 487. [PubMed] [Google Scholar] 5. Гринвуд-Ван Меервельд Б., Нили Д., Тайлер К., Питерс Л., МакРори Дж. Сравнение эффектов на перистальтику толстой кишки и характеристики стула, связанных с кормлением олестрой и пшеничными отрубями амбулаторным мини-свиньям. Dig Dis Sci.1999; 44 ( 7): 1282– 1287. [PubMed] [Google Scholar] 6. Льюис С.Дж., Хитон К.В. Еще раз о грубых кормах: влияние на функцию кишечника инертных пластиковых частиц разных размеров и форм. Dig Dis Sci. 1999; 44: 744– 748. [PubMed] [Google Scholar] 7. Макрори Дж., Пеппл С., Рудольф К. Влияние слабительных волокон и докузата кальция на региональное содержание воды и вязкость пищеварительного тракта в толстом кишечнике свиньи. Dig Dis Sci. 1998; 43 ( 4): 738– 745. [PubMed] [Google Scholar] 9. Эсваран С., Мьюр Дж., Чей В.Клетчатка и функциональные желудочно-кишечные расстройства. Am J Gastroenterol. 2013; 108: 718– 727. [PubMed] [Google Scholar] 10. Фрэнсис CY, Whorwell PJ. Синдром отрубей и раздраженного кишечника: время для переоценки. Ланцет. 1994; 344 ( 8914): 39– 40. [PubMed] [Google Scholar] 11. Бухник Ю., Раскин Л., Симоно Г. и др. Способность неперевариваемых углеводов стимулировать фекальные бифидобактерии у здоровых людей: двойное слепое рандомизированное плацебо-контролируемое исследование зависимости доза-ответ в параллельных группах.Am J Clin Nutr. 2004; 80 ( 6): 1658– 1664. [PubMed] [Google Scholar] 12. Brighenti F, Casiraghi MC, Canzi E, Ferrari A. Влияние потребления готовых к употреблению хлопьев для завтрака, содержащих инулин, на кишечную среду и липиды крови у здоровых добровольцев мужского пола. Eur J Clin Nutr. 1999; 53 ( 9): 726– 733. [PubMed] [Google Scholar] 13. Castiglia-Delavaud C, Verdier E, Besle JM, et al. Чистая энергетическая ценность изолятов некрахмальных полисахаридов (клетчатка сахарной свеклы и коммерческий инулин) и их влияние на усвоение питательных веществ у здоровых людей.Br J Nutr. 1998; 80 ( 4): 343– 352. [PubMed] [Google Scholar] 14. Costabile A, Kolida S, Klinder A и др. Двойное слепое плацебо-контролируемое перекрестное исследование для установления бифидогенного эффекта инулина с очень длинной цепью, экстрагированного из луковичного артишока ( Cynara scolymus ) у здоровых людей. Br J Nutr. 2010; 104 ( 7): 1007– 1017. [PubMed] [Google Scholar] 15. Гибсон Г. Р., Битти Э. Р., Ван Х, Каммингс Дж. Х. Селективная стимуляция бифидобактерий толстой кишки человека олигофруктозой и инулином.Гастроэнтерология. 1995; 108 ( 4): 975– 982. [PubMed] [Google Scholar] 16. Kleessen B, Sykura B, Zunft HJ, Blaut M. Влияние инулина и лактозы на фекальную микрофлору, микробную активность и привычку кишечника у пожилых людей, страдающих запорами. Am J Clin Nutr. 1997; 65 ( 5): 1397– 402. [PubMed] [Google Scholar] 17. Kleessen B, Schwarz S, Boehm A, et al. Топинамбур и инулин цикория в хлебобулочных изделиях влияют на фекальную микробиоту здоровых добровольцев. Br J Nutr. 2007; 98 ( 3): 540– 549. [PubMed] [Google Scholar] 18.Колида С, Мейер Д, Гибсон ГР. Двойное слепое плацебо-контролируемое исследование по установлению бифидогенной дозы инулина у здоровых людей. Eur J Clin Nutr. 2007; 61 ( 10): 1189– 1195. [PubMed] [Google Scholar] 19. Линецки Вайцберг Д., Алвес Перейра С.С., Логулло Л. и др. Польза для микробиоты после приема инулина и частично гидролизованной гуаровой камеди: рандомизированное клиническое испытание на женщинах, страдающих запором. Nutr Hosp. 2012; 27 ( 1): 123– 129. [PubMed] [Google Scholar] 20. Марто П., Герен-Деремо Л., Вильс Д., Казобьель М., Хаус Б.Кратковременная пищеварительная толерантность высоких доз NUTRIOSE®FB10 у взрослых. Int J Food Sci Nutr. 2011; 62 ( 2): 97– 101. [PubMed] [Google Scholar] 21. Рамнани П., Годье Э., Бингхэм М., Ван Брюгген П., Туохи К. М., Гибсон Г. Р.. Пребиотический эффект инъекций фруктов и овощей, содержащих инулин топинамбура: исследование с участием человека. Br J Nutr. 2010; 104 ( 2): 233– 240. [PubMed] [Google Scholar] 22. Славин Дж., Фейртаг Дж. Цикорий инулин не увеличивает массу стула и не ускоряет прохождение через кишечник у здоровых мужчин.Food Funct. 2011; 2: 72– 77. [PubMed] [Google Scholar] 23. ван ден Хеувель Э.Г., Вильс Д., Пашман В.Дж., Саньез М.Х., Кардинаал А.Ф. Добавка к пище различных доз NUTRIOSE-FB, ферментируемого декстрина, изменяет активность фекальных ферментов у здоровых мужчин. Eur J Nutr. 2005; 44: 445– 451. [PubMed] [Google Scholar] 24. van Dokkum W, Wezendonk B, Srikumar TS, van den Heuvel EG. Влияние неперевариваемых олигосахаридов на функции толстой кишки, концентрацию липидов в крови и всасывание глюкозы у молодых здоровых мужчин.Eur J Clin Nutr. 1999; 53 ( 1): 1– 7. [PubMed] [Google Scholar] 25. Дикеман С., Фэи Г. Вязкость относительно пищевых волокон: обзор. Crit Rev Food Sci Nutr. 2006; 46: 649– 663. [PubMed] [Google Scholar] 26. МакРори Дж. Клинические данные подтверждают, что псиллиум не ферментируется в кишечнике [письмо редактору]. Am J Gastroenterol. 2013; 108 ( 9): 1541. [PubMed] [Google Scholar] 27. Кэмпбелл Дж., Фэи Г. Свойства ферментации подорожника и метилцеллюлозы по отношению к стандартам нерастворимых и растворимых волокон.Nutr Res. 1997; 17: 619– 629. [Google Scholar] 28. Каур А., Роуз Д., Румпагапорн П. и др. Сравнение периодической фекальной ферментации in vitro по производству газа и короткоцепочечных жирных кислот с использованием «медленно ферментируемых» пищевых волокон. J Food Sci. 2011; 76: h237– h242. [PubMed] [Google Scholar] 29. Тимм Д., Стюарт М., Хоспаттанкар А. и др. Декстрин пшеницы, псиллиум и инулин in vitro продуцируют различные паттерны ферментации, объемы газа и профили короткоцепочечных жирных кислот. J Med Food. 2010; 13: 961– 966.[PubMed] [Google Scholar] 30. Левитт, доктор медицины, Ферне Дж., Олссон С. Связь прохождения газов и вздутия живота с выделением газов в толстой кишке. Ann Intern Med. 1996; 124: 422– 424. [PubMed] [Google Scholar] 31. Marteau P, Flouri é B, Cherbut C и др. Усвояемость и объемный эффект шелухи испагулы у здоровых людей. Кишечник. 1994; 35: 1747– 1752. [Бесплатная статья PMC] [PubMed] [Google Scholar] 32. Волевер Т., Робб П. Влияние гуара, пектина, псиллиума, полисахарида сои и целлюлозы на водород и метан в выдыхаемом воздухе у здоровых людей.Am J Gastroenterol. 1992; 87: 305– 310. [PubMed] [Google Scholar] 33. Волевер Т., Тер Вал П., Спадафора П. и др. Гуар, но не псиллиум, увеличивает концентрацию метана и ацетата в сыворотке крови у людей. Am J Clin Nutr. 1992; 55: 719– 722. [PubMed] [Google Scholar] 34. Сумаррага Л., Левитт М., Суарес Ф. Отсутствие газообразных симптомов при приеме пищевых волокон. Алимент Pharmacol Ther. 1997; 11: 1067– 1172. [PubMed] [Google Scholar] 35. Макрори Дж., Дагги Б., Морел Дж., Дирсинг П., Майнер П., Робинсон М.Псиллиум превосходит докузат натрия в лечении хронических запоров. Алимент Pharmacol Ther. 1998; 12: 491– 497. [PubMed] [Google Scholar] 36. Эхерер А., Санта-Ана С., Фордтран Дж. Влияние псиллиума, поликарбофила кальция и пшеничных отрубей на секреторную диарею, вызванную фенолфталеином. Гастроэнтерология. 1993; 104: 1007– 1012. [PubMed] [Google Scholar] 37. Квицау С., Мацен П., Мадсен П. Лечение хронической диареи: лоперамид по сравнению с шелухой испагулы и кальцием. Сканд Дж Гастроэнтерол.1988; 23: 1237– 1240. [PubMed] [Google Scholar] 38. Сингх Б. Псиллиум как терапевтическое средство и средство доставки лекарств. Int J Pharm. 2007; 334: 1– 14. [PubMed] [Google Scholar] 39. Вашингтон Н., Харрис М., Масселуайт А., Спиллер Р. Умерение вызванной лактулозой диареи подорожником: влияние на моторику и ферментацию. Am J Clin Nutr. 1998; 67: 317– 321. [PubMed] [Google Scholar] 40. Брандт Л., Пратер С., Куигли Э., Шиллер Л., Шенфельд П., Талли Н. Систематический обзор лечения хронических запоров в Северной Америке.Am J Gastroenterol. 2005; 100: S5– S22. [PubMed] [Google Scholar] 41. Брандт Л., Чей В., Фокс-Оренштейн А. и др. Рабочая группа Американского колледжа гастроэнтерологии по СРК. Основанный на фактических данных систематический обзор лечения синдрома раздраженного кишечника. Am J Gastroenterol. 2009; 104 ( Приложение 1): S1– S35. [PubMed] [Google Scholar] 42. Du H, van der ADL, Boshuizen HC, et al. Пищевые волокна и последующие изменения массы тела и окружности талии у европейских мужчин и женщин. Am J Clin Nutr. 2010; 91: 329– 336.[PubMed] [Google Scholar] 43. Андерсон Дж., Бэрд П., Дэвис Р. и др. Польза пищевых волокон для здоровья. Nutr Rev. 2009; 67: 188– 205. [PubMed] [Google Scholar] 44. Лю С., Виллетт У. К., Мэнсон Дж. Э., Ху Ф. Б., Рознер Б., Кольдиц Г. Связь между изменениями в потреблении пищевых волокон и зерновых продуктов и изменениями веса и развитием ожирения у женщин среднего возраста. Am J Clin Nutr. 2003; 78: 920– 927. [PubMed] [Google Scholar] 45. Хиггинс Дж. Устойчивый крахмал и энергетический баланс: влияние на похудание и поддержание веса.Crit Rev Food Sci Nutr. 2014; 54: 1158– 1166. [Бесплатная статья PMC] [PubMed] [Google Scholar] 46. Абрамс С., Гриффин И., Хоторн К., Эллис К.Дж. Влияние пребиотических добавок и потребления кальция на индекс массы тела. Педиатрия. 2007; 151 ( 3): 293– 298. [PubMed] [Google Scholar] 47. Арчер Б., Джонсон С., Деверо Х., Бакстер А. Влияние замены жира инулином или клетчаткой из ядер люпина на приемлемость колбасных пирожков, восприятие сытости после еды и прием пищи у мужчин. Br J Nutr. 2004; 91: 591– 599.[PubMed] [Google Scholar] 48. Тивари К., Уорд Дж., Джексон Б. Влияние пектина на чувство сытости у здоровых взрослых в армии США. J Am Coll Nutr. 1997; 16: 423– 428. [PubMed] [Google Scholar] 49. Wanders A, van den Borne J, de Graaf C. и др. Влияние пищевых волокон на субъективный аппетит, потребление энергии и массу тела: систематический обзор рандомизированных контролируемых исследований. Obes Rev. 2011; 12: 724– 739. [PubMed] [Google Scholar] 50. Хабер Г.Б., Хитон К.В., Мерфи Д., Берроуз Л.Ф. Истощение и нарушение пищевых волокон.Влияние на чувство насыщения, уровень глюкозы в плазме и инсулин в сыворотке крови. Ланцет. 1977; 2: 679– 682. [PubMed] [Google Scholar] 51. Ди Лоренцо К., Уильямс К., Хайнал Ф., Валенсуэла Дж. Пектин задерживает опорожнение желудка и увеличивает чувство насыщения у людей с ожирением. Гастроэнтерология. 1988; 95 ( 5): 1211– 1215. [PubMed] [Google Scholar] 52. Ховарт Н., Зальцман Э., Робертс С. Пищевые волокна и регулирование веса. Nutr Rev. 2001; 59: 129– 139. [PubMed] [Google Scholar] 53. Перейра М., Людвиг Д. Пищевые волокна и регулирование массы тела: наблюдения и механизмы.Pediatr Clin North Am. 2001; 48: 969– 980. [PubMed] [Google Scholar] 54. Славин Ю. Пищевые волокна и масса тела. Питание. 2005; 21: 411– 418. [PubMed] [Google Scholar] 55. Ким Дж., Ча Й-Дж., Ли К. Х., Пак Э. Влияние добавок экстракта луковой шелухи на липидный профиль и антиоксидантный статус здоровых молодых женщин: рандомизированное плацебо-контролируемое двойное слепое перекрестное исследование. Nutr Res Pract. 2013; 7 ( 5): 373– 379. [Бесплатная статья PMC] [PubMed] [Google Scholar] 56. Шварц С.Е., Левин Р.А., Сингх А., Шайдекер-младший, Трек NS.Продолжительный прием пектина задерживает опорожнение желудка. Гастроэнтерология. 1982; 83 ( 4): 812– 817. [PubMed] [Google Scholar] 57. Вуксан В., Дженкинс А.Л., Роговик А.Л., Фэргрив С.Д., Йовановски Е., Лейтер Л.А. Вязкость, а не количество пищевых волокон предсказывает эффект снижения холестерина у здоровых людей. Br J Nutr. 2011; 106: 1349– 1352. [PubMed] [Google Scholar] 58. Wanders AJ, Jonathan MC, van den Borne JJ, et al. Влияние набухающих, вязких и гелеобразующих пищевых волокон на насыщение.Br J Nutr. 2013; 109: 1330– 1337. [PubMed] [Google Scholar] 59. Волевер Т., Тош С., Гиббс А. и др. Физико-химические свойства овсяного β-глюкана влияют на его способность снижать уровень холестерина ЛПНП в сыворотке крови человека: рандомизированное клиническое исследование. Am J Clin Nutr. 2010; 92: 723– 732. [PubMed] [Google Scholar] 60. Андерсон JW. Пищевые волокна и связанные с ними фитохимические вещества в профилактике и лечении диабета. В: Пасупулети В.К., Андерсон Дж. У., ред. Нутрицевтики, гликемическое здоровье и диабет 2 типа, Эймс, ИА: Blackwell Publishing Professional, 2008: 111– 142.[Google Scholar] 61. Cicero AFG, Derosa G, Bove M, Imola F, Borghi C, Gaddi AV. Псиллиум уменьшает дислипидемию, гипергликемию и гипертензию, в то время как гуаровая камедь снижает массу тела быстрее у пациентов, страдающих метаболическим синдромом, после диеты AHA step 2. Mediterr J Nutr Metab. 2010; 3: 47– 54. [Google Scholar] 62. Андерсон Дж., Флор Т., Гейл П., Спенсер Д., Бальзам Т. Гипохолестеринемические эффекты различных гидрофильных волокон, образующих объем, в качестве дополнения к диетической терапии при легкой и умеренной гиперхолестеринемии.Arch Intern Med. 1991; 151: 1597– 1602. [PubMed] [Google Scholar] 63. Андерсон Дж., Зеттвоч Н., Фельдман Т., Титиин-Кларк Дж., Ольтген П., Бишоп К. Снижающие холестерин эффекты гидрофильного муциллоида псиллиума для мужчин с гиперхолецеринемией. Arch Intern Med. 1988; 148: 292– 296. [PubMed] [Google Scholar] 64. Керкхоффс Д., Хорнстра Дж., Менсик Р. Снижающий холестерин эффект β-глюкана из овсяных отрубей у субъектов с легкой гиперхолестеринемией может уменьшаться, когда β-глюкан входит в состав хлеба и печенья.Am J Clin Nutr. 2003; 78: 221– 227. [PubMed] [Google Scholar] 65. Институт медицины, пищевых продуктов и питания. Рекомендуемая диета: энергия, углеводы, клетчатка, жиры, жирные кислоты, холестерин, белок и аминокислоты. Вашингтон, округ Колумбия: Национальная академия прессы; 2002. [Google Scholar] 66. Славин Ю. Позиция Американской диетической ассоциации: значение пищевых волокон для здоровья. J Am Diet Assoc. 2008; 108: 1716– 1731. [PubMed] [Google Scholar] 67. МакРори Дж., Зорич Н., Риккарди К. и др.Влияние потребления олестры и сорбита на объективные показатели диареи: влияние вязкости стула на общие желудочно-кишечные симптомы. Regul Toxicol Pharmacol. 2000; 31 ( 1): 59– 67. [PubMed] [Google Scholar]

Наборы для отбора проб стула и выделения ДНК влияют на качество ДНК и бактериальный состав после секвенирования гена 16S рРНК с использованием платформы MiSeq Illumina

  • 1.

    Suau, A. et al . Прямой анализ генов, кодирующих 16S рРНК из сложных сообществ, позволяет выявить множество новых молекулярных видов в кишечнике человека. Заявл. Environ. Microbiol. 65 , 4799–807 (1999).

    CAS PubMed PubMed Central Google Scholar

  • 2.

    Zoetendal, E.G. et al. . Бактерии, связанные со слизистой оболочкой желудочно-кишечного тракта человека, равномерно распределены по толстой кишке и отличаются от сообщества, выделенного из фекалий. Заявл. Environ. Microbiol. 68 , 3401–7 (2002).

    CAS PubMed PubMed Central Статья Google Scholar

  • 3.

    Рассел С. Л. и др. . Перинатальное лечение антибиотиками влияет на микробиоту мышей, иммунные реакции и аллергическую астму. Кишечные микробы 4 , 158–64 (2013).

    PubMed PubMed Central Статья Google Scholar

  • 4.

    Джандхьяла, С. М. и др. . Роль нормальной микробиоты кишечника. World J. Gastroenterol. 21 , 8787–803 (2015).

    CAS PubMed PubMed Central Статья Google Scholar

  • 5.

    Матаморос, С., Гра-Леген, К., Ле Вакон, Ф., Потель, Г., Де Ла Кошетьер, М. Ф. Развитие кишечной микробиоты у младенцев и ее влияние на здоровье. Тенденции в микробиологии 21 , 167–173 (2013).

    CAS PubMed Статья Google Scholar

  • 6.

    Андервуд, М. А. Дисбактериоз кишечника: новые механизмы, с помощью которых микробы кишечника запускают и предотвращают заболевание. Пред. Med. (Балтим). 65 , 133–137 (2014).

    Артикул Google Scholar

  • 7.

    Zhang, Y.-J. и др. . Воздействие кишечных бактерий на здоровье и болезни человека. Внутр. J. Mol. Sci. 16 , 7493–519 (2015).

    CAS PubMed PubMed Central Статья Google Scholar

  • 8.

    Маккензи, Б. У., Уэйт, Д. У. и Тейлор, М.W. Оценка различий в профилях микробиоты кишечника человека из-за метода экстракции ДНК и различий между субъектами. Фронт. Microbiol. 6 , 130 (2015).

    Google Scholar

  • 9.

    Яцуненко Т. и др. . Микробиом кишечника человека в зависимости от возраста и географии. Nature 486 , 222–227 (2012).

    ADS CAS PubMed PubMed Central Статья Google Scholar

  • 10.

    Абелес, С. Р. и др. . Разнообразие микробов у людей и их домашних контактов после типичных курсов антибиотиков. Микробиом 4 , 39 (2016).

    PubMed PubMed Central Статья Google Scholar

  • 11.

    Korpela, K. & de Vos, W. Использование антибиотиков в детстве изменяет микробиоту кишечника и предрасполагает к избыточному весу. Microb. Ячейка 3 , 296–298 (2016).

    CAS PubMed PubMed Central Статья Google Scholar

  • 12.

    Жернакова А. и др. . Популяционный метагеномический анализ выявляет маркеры состава и разнообразия кишечного микробиома. Наука 352 , 565–9 (2016).

    ADS CAS PubMed PubMed Central Статья Google Scholar

  • 13.

    Граф Д. и др. . Вклад диеты в состав микробиоты кишечника человека. Microb. Ecol. Health Dis. 26 , 26164 (2015).

    PubMed Google Scholar

  • 14.

    Горвитовская А., Холмс, С. П. и Хьюз, С. М. Интерпретация Prevotella и Bacteroides как биомаркеров диеты и образа жизни. Микробиом 4 , 15 (2016).

    PubMed PubMed Central Статья Google Scholar

  • 15.

    Клаус, С. П., Гийу, Х. и Эллеро-Симатос, С. Микробиота кишечника: главный игрок в токсичности загрязнителей окружающей среды? npj Biofilms Microbiomes 2 , 16003 (2016).

    PubMed PubMed Central Статья Google Scholar

  • 16.

    Мадан, Дж. К., Фарзан, С. Ф., Хибберд, П. Л. и Карагас, М. Р. Нормальные вариации микробиома новорожденных в зависимости от факторов окружающей среды, инфекции и аллергии. Curr. Opin. Педиатр. 24 , 753–9 (2012).

    PubMed PubMed Central Статья Google Scholar

  • 17.

    Schultze, A. et al. . Сравнение сбора стула на месте и дома в популяционном исследовании. Bundesgesundheitsblatt - Gesundheitsforsch. - Gesundheitsschutz 57 , 1264–1269 (2014).

    CAS Статья Google Scholar

  • 18.

    Фейгельсон, Х.С. и др. . Возможность самостоятельного сбора образцов кала женщинами, отобранными случайным образом, для исследований микробиома кишечника, связанных со здоровьем. BMC Res. Примечания 7 , 204 (2014).

    PubMed PubMed Central Статья Google Scholar

  • 19.

    Loftfield, E. et al. . Сравнение методов сбора образцов кала для обнаружения метаболомики в эпидемиологических исследованиях. Cancer Epidemiol. Биомаркеры Пред. 25 , 1483–1490 (2016).

    PubMed PubMed Central Статья Google Scholar

  • 20.

    Теджо Д. И. и др. . Влияние отбора и хранения образцов на состав фекальной микробиоты у здоровых и больных людей. PLoS One 10 , e0126685 (2015).

    PubMed PubMed Central Статья CAS Google Scholar

  • 21.

    Mathay, C. и др. . Оптимизация методов сбора образцов фекалий и экстракции ДНК из фекалий. Биоконсерв. Биобанк. 13 , 79–93 (2015).

    CAS PubMed Статья Google Scholar

  • 22.

    Панек М. и др. . Проблемы методологии изучения микробиоты кишечника человека - влияние сбора, хранения, извлечения ДНК и технологий секвенирования нового поколения. Sci.Отчет 8 , 5143 (2018).

    ADS PubMed PubMed Central Статья CAS Google Scholar

  • 23.

    Лаубер, К. Л., Чжоу, Н., Гордон, Дж. И., Найт, Р. и Фирер, Н. Влияние условий хранения на оценку структуры бактериального сообщества в почве и пробах, связанных с человеком. FEMS Microbiol. Lett. 307 , 80–86 (2010).

    CAS PubMed PubMed Central Статья Google Scholar

  • 24.

    Кардона. Условия хранения вещества кишечной микробиоты в метагеномном анализе. BMC Microbiol . 12 , 158 (2012).

  • 25.

    Горзелак М.А. и др. . Методы улучшения данных микробиома кишечника человека за счет уменьшения вариабельности за счет обработки образцов и хранения стула. PLoS One 10 , e0134802 (2015).

    PubMed PubMed Central Статья CAS Google Scholar

  • 26.

    Maukonen, J., Simões, C. & Saarela, M. Используемые в настоящее время коммерческие методы экстракции ДНК дают разные результаты для популяций клостридиумов и актинобактерий, полученных из образцов фекалий человека. FEMS Microbiol. Ecol. 79 , 697–708 (2012).

    CAS PubMed Статья Google Scholar

  • 27.

    Hill, C.J. и др. . Влияние транспортных флаконов комнатной температуры на качество ДНК и филогенетический состав фекальной микробиоты пожилых людей и младенцев. Микробиом 4 , 19 (2016).

    PubMed PubMed Central Статья Google Scholar

  • 28.

    Чу, Дж. М., Леонг, Л. Э. X. и Роджерс, Г. Б. Условия хранения образцов существенно влияют на профили фекального микробиома. Sci. Отчет 5 , 16350 (2015).

    ADS CAS PubMed PubMed Central Статья Google Scholar

  • 29.

    Ким, Д. и др. . Оптимизация методов и устранение ошибок в исследовании микробиома. Микробиом 5 , 52 (2017).

    PubMed PubMed Central Статья Google Scholar

  • 30.

    Юань, С., Коэн, Д. Б., Равель, Дж., Абдо, З. и Форни, Л. Дж. Оценка методов экстракции и очистки ДНК из микробиома человека. PLoS One 7 , e33865 (2012).

    ADS CAS PubMed PubMed Central Статья Google Scholar

  • 31.

    Джанаби, А. Х. Д., Керкхоф, Л. Дж., МакГиннесс, Л. Р., Биддл, А. С. и МакКивер, К. Х. Сравнение методов модифицированного фенола / хлороформа и коммерческого набора для извлечения ДНК из фекалий лошади. J. Microbiol. Методы 129 , 14–19 (2016).

    CAS PubMed Статья Google Scholar

  • 32.

    Кеннеди, Н.А. и др. . Влияние различных наборов для экстракции ДНК и лабораторий на оценку состава микробиоты кишечника человека с помощью секвенирования гена 16S рРНК. PLoS One 9 , e88982 (2014).

    ADS PubMed PubMed Central Статья CAS Google Scholar

  • 33.

    Смит, Б., Ли, Н., Андерсен, А. С., Слотвед, Х. К. и Крогфельт, К. А. Оптимизация экстракции бактериальной ДНК из образцов фекалий: сравнение трех методов. Open Microbiol. J. 5 , 14–7 (2011).

    CAS PubMed PubMed Central Статья Google Scholar

  • 34.

    Santiago, A. et al. . Обработка проб фекалий: шаг вперед к стандартам анализа микробного сообщества. BMC Microbiol. 14 , 112 (2014).

    PubMed PubMed Central Статья Google Scholar

  • 35.

    Герасимидис, К. и др. . Влияние методологии выделения ДНК на приложения для исследования микробиоты кишечника. BMC Res. Примечания 9 , 365 (2016).

    PubMed PubMed Central Статья CAS Google Scholar

  • 36.

    Claassen, S. et al. . Сравнение эффективности пяти различных коммерческих наборов для экстракции ДНК для выделения ДНК из образцов фекалий. Дж.Microbiol. Методы 94 , 103–110 (2013).

    CAS PubMed PubMed Central Статья Google Scholar

  • 37.

    Salonen, A. et al. . Сравнительный анализ методов экстракции фекальной ДНК с филогенетическим микрочипом: эффективное восстановление бактериальной и архейной ДНК с помощью механического лизиса клеток. J. Microbiol. Методы 81 , 127–134 (2010).

    CAS PubMed Статья Google Scholar

  • 38.

    Лим, М. Ю., Сонг, Э.-Дж., Ким, С. Х., Ли, Дж. И Нам, Ю.-Д. Сравнение методов выделения ДНК для профилирования микробного сообщества кишечника человека. Syst. Прил. Microbiol. 41 , 151–157 (2018).

    CAS PubMed Статья Google Scholar

  • 39.

    Costea, P. I. et al. . К стандартам обработки образцов фекалий человека в метагеномных исследованиях. Nat. Biotechnol. 35 , 1069–1076 (2017).

    CAS PubMed Статья Google Scholar

  • 40.

    Walker, A. W. et al. . На профилирование микробиоты кишечника младенца человека на основе гена 16S рРНК сильно влияет обработка образцов и выбор праймера для ПЦР. Микробиом 3 , 26 (2015).

    PubMed PubMed Central Статья Google Scholar

  • 41.

    Cruaud, P. и др. . Влияние метода экстракции ДНК, целевых гипервариабельных областей 16S рРНК и происхождения образцов на микробное разнообразие, обнаруженное с помощью пиросеквенирования 454 в морских хемосинтетических экосистемах. Заявл. Environ. Microbiol. 80 , 4626–4639 (2014).

    PubMed PubMed Central Статья CAS Google Scholar

  • 42.

    Шлосс, П. Д., Геверс, Д. и Весткотт, С. Л. Снижение влияния амплификации ПЦР и артефактов секвенирования на исследования на основе 16S рРНК. PLoS One 6 , e27310 (2011).

    ADS CAS PubMed PubMed Central Статья Google Scholar

  • 43.

    Клуни А.Г. и др. . Сравнение яблок и апельсинов? Секвенирование следующего поколения и его влияние на анализ микробиома. PLoS One 11 , e0148028 (2016).

    PubMed PubMed Central Статья CAS Google Scholar

  • 44.

    Lozupone, C.A. и др. . Метаанализ исследований микробиоты человека. Genome Res. 23 , 1704–1714 (2013).

    CAS PubMed PubMed Central Статья Google Scholar

  • 45.

    Fu, B.C. et al. . Характеристика микробиома кишечника в эпидемиологических исследованиях: опыт мультиэтнической когорты. Ann. Эпидемиол. 26 , 373–379 (2016).

    PubMed PubMed Central Статья Google Scholar

  • 46.

    Hsieh, Y.-H. и др. . Влияние различных методов обработки фекалий на оценку бактериального разнообразия в кишечнике человека. Фронт. Microbiol. 7 , 1643 (2016).

    PubMed PubMed Central Статья Google Scholar

  • 47.

    Lozupone, C.A., Stombaugh, J. I., Gordon, J. I., Jansson, J. K. & Knight, R. Разнообразие, стабильность и устойчивость микробиоты кишечника человека. Природа 489 , 220–30 (2012).

    ADS CAS PubMed PubMed Central Статья Google Scholar

  • 48.

    Бюргманн, Х., Пезаро, М., Видмер, Ф. и Зейер, Дж. Стратегия оптимизации качества и количества ДНК, экстрагированной из почвы. J. Microbiol. Методы 45 , 7–20 (2001).

    ADS PubMed Статья Google Scholar

  • 49.

    Schrader, C., Schielke, A., Ellerbroek, L. & Johne, R. Ингибиторы ПЦР - появление, свойства и удаление. J. Appl. Microbiol. 113 , 1014–1026 (2012).

    CAS PubMed Статья Google Scholar

  • 50.

    Oikarinen, S. et al. . Подавление ПЦР в образцах стула в зависимости от возраста младенцев. J. Clin. Virol. 44 , 211–214 (2009).

    CAS PubMed Статья Google Scholar

  • 51.

    Льюис, Дж. Д. и др. . Воспаление, антибиотики и диета как экологические стрессоры кишечного микробиома при болезни Крона у детей. Клеточный микроб-хозяин 18 , 489–500 (2015).

    CAS PubMed PubMed Central Статья Google Scholar

  • 52.

    TEIXEIRA, Y. et al., . Количественное определение ДНК человека в стуле пациентов с колоректальным раком. Arq. Гастроэнтерол. 52 , 293–298 (2015).

    PubMed Статья Google Scholar

  • 53.

    Варела, Э. и др. . Фекальная ДНК и кальпротектин как биомаркеры острой кишечной токсичности у пациентов, подвергающихся лучевой терапии органов малого таза. Алимент. Pharmacol. Ther. 30 , 175–85 (2009).

    CAS PubMed Статья Google Scholar

  • 54.

    Зоу, Х., Харрингтон, Дж. Дж., Клатт, К. К. и Алквист, Д. А. Чувствительный метод количественного определения длинной ДНК человека в кале: актуальность для скрининга колоректального рака. Cancer Epidemiol. Биомаркеры Пред. 15 , 1115–9 (2006).

    CAS PubMed Статья Google Scholar

  • 55.

    Клаассен, К.H. W. и др. . Количественный анализ ДНК человека в кале как диагностический тест на наличие колоректального рака. Clin. Chem. 49 , 1185–7 (2003).

    CAS PubMed Статья Google Scholar

  • 56.

    Хеспелл, Р. Б., Като, К. и Костертон, Дж. У. Характеристика клеточной стенки видов Butyrivibrio. Банка. J. Microbiol. 39 , 912–921 (1993).

    CAS PubMed Статья Google Scholar

  • 57.

    Thompson, B.G. и Murray, R.G. Изоляция и характеристика плазматической мембраны и внешней мембраны штамма Deinococcus radiodurans Sark. Банка. J. Microbiol. 27 , 729–34 (1981).

    CAS PubMed Статья Google Scholar

  • 58.

    Карлссон, Ф. Х. и др. . Метагеном кишечника у европейских женщин с нормальным, нарушенным и диабетическим контролем уровня глюкозы. Nature 498 , 99–103 (2013).

    ADS CAS PubMed Статья Google Scholar

  • 59.

    Li, E. et al. . Фенотип воспалительных заболеваний кишечника, генотип C. difficile и NOD2 связаны со сдвигами в микробном составе, ассоциированном с подвздошной кишкой человека. PLoS One 7 , e26284 (2012).

    ADS CAS PubMed PubMed Central Статья Google Scholar

  • 60.

    Геверс, Д. и др. . Микробиом, ранее не получавший лечения, при впервые возникшей болезни Крона. Клеточный микроб-хозяин 15 , 382–392 (2014).

    CAS PubMed PubMed Central Статья Google Scholar

  • 61.

    Gao, Z., Guo, B., Gao, R., Zhu, Q. & Qin, H. Дисбиоз микробиоты связан с колоректальным раком. Фронт. Microbiol. 6 , 20 (2015).

    PubMed PubMed Central Google Scholar

  • 62.

    Тернбо, П. Дж. и др. . Микробиом кишечника, связанный с ожирением, с повышенной способностью собирать энергию. Nature 444 , 1027–31 (2006).

    ADS PubMed Статья Google Scholar

  • 63.

    Лей, Р. Э., Тернбо, П. Дж., Кляйн, С. и Гордон, Дж. И. Микробная экология: кишечные микробы человека, связанные с ожирением. Nature 444 , 1022–1023 (2006).

    ADS CAS PubMed Статья Google Scholar

  • 64.

    Ларсен, Н. и др. . Микробиота кишечника взрослых людей с диабетом 2 типа отличается от взрослых людей, не страдающих диабетом. PLoS One 5 , e9085 (2010).

    ADS PubMed PubMed Central Статья CAS Google Scholar

  • 65.

    Tanaka, S., Yamamoto, K., Yamada, K., Furuya, K. & Uyeno, Y. Взаимосвязь увеличения производства бутирата бактериями, продуцирующими бутират толстой кишки, с иммуномодулирующими эффектами у нормальных мышей, которых кормили нерастворимыми веществами. Фракция Brassica rapa L. Заявл. Environ. Microbiol. 82 , 2693–9 (2016).

    CAS PubMed PubMed Central Статья Google Scholar

  • 66.

    Murri, M. et al. . Микробиота кишечника у детей с диабетом 1 типа отличается от таковой у здоровых детей: исследование случай-контроль. BMC Med. 11 , 46 (2013).

    ADS PubMed PubMed Central Статья Google Scholar

  • 67.

    Cheng, J. et al. . Состав микробиоты двенадцатиперстной кишки и гомеостаз слизистой оболочки при глютеновой болезни у детей. BMC Gastroenterol. 13 , 113 (2013).

    ADS CAS PubMed PubMed Central Статья Google Scholar

  • 68.

    Chen, W., Liu, F., Ling, Z., Tong, X. & Xiang, C. Просвет кишечника человека и микробиота слизистой оболочки у пациентов с колоректальным раком. PLoS One 7 , e39743 (2012).

    ADS CAS PubMed PubMed Central Статья Google Scholar

  • 69.

    Hong, P.-Y., Croix, J. A., Greenberg, E., Gaskins, H. R. & Mackie, R. I. Анализ микробиоты слизистой оболочки здоровых людей на основе пиросеквенирования выявляет повсеместные бактериальные группы и микрогетерогенность. PLoS One 6 , e25042 (2011).

    ADS CAS PubMed PubMed Central Статья Google Scholar

  • 70.

    Баджадж, Дж. С. и др. . Микробиом слизистой оболочки толстой кишки отличается от микробиома кала при циррозе и печеночной энцефалопатии и связан с познанием и воспалением. Am. J. Physiol. Гастроинтест. Liver Physiol. 303 , G675–85 (2012).

    CAS PubMed PubMed Central Статья Google Scholar

  • 71.

    Шнабл, Б. и Бреннер, Д. А. Взаимодействие между кишечным микробиомом и заболеваниями печени. Гастроэнтерология 146 , 1513–1524 (2014).

    CAS PubMed PubMed Central Статья Google Scholar

  • 72.

    Org, E. et al. . Взаимосвязь между микробиотой кишечника, метаболитами плазмы и признаками метаболического синдрома в когорте METSIM. Genome Biol. 18 , 70 (2017).

    PubMed PubMed Central Статья CAS Google Scholar

  • 73.

    Липперт, К. и др. . Дисбактериоз кишечной микробиоты, связанный с нарушениями метаболизма глюкозы и метаболическим синдромом у пожилых людей. Benef. Микробы 1–12, https://doi.org/10.3920/BM2016.0184 (2017).

    CAS PubMed Статья Google Scholar

  • 74.

    Biagi, E. et al. . Микробиом кишечника при синдроме Дауна. PLoS One 9 , e112023 (2014).

    ADS PubMed PubMed Central Статья CAS Google Scholar

  • 75.

    Ван, Л. и др. . Повышенная численность Sutterella spp. и Ruminococcus Torques в кале детей с расстройствами аутистического спектра. Мол. Аутизм 4 , 42 (2013).

    CAS PubMed PubMed Central Статья Google Scholar

  • 76.

    Mukhopadhya, I. et al. . Комплексная оценка изолятов слизистой оболочки толстой кишки Sutterella wadsworthensis от воспалительного заболевания кишечника. PLoS One 6 , e27076 (2011).

    ADS CAS PubMed PubMed Central Статья Google Scholar

  • 77.

    Vandeputte, D. et al. . Консистенция стула тесно связана с богатством и составом кишечной микробиоты, энтеротипами и скоростью роста бактерий. Кишечник 65 , 57–62 (2016).

    CAS PubMed Статья Google Scholar

  • 78.

    Falony, G. и др. . Популяционный анализ изменчивости микробиома кишечника. Наука 352 , 560–4 (2016).

    ADS CAS PubMed Статья Google Scholar

  • 79.

    Klindworth, A. et al. . Оценка общих праймеров для ПЦР гена 16S рибосомной РНК для классических исследований и исследований разнообразия на основе секвенирования следующего поколения. Nucleic Acids Res. 41 , e1 (2013).

    CAS PubMed Статья Google Scholar

  • 80.

    Чен, Х. М. и Лифшиц, К. Х. Подготовка образцов фекалий для анализа летучих жирных кислот с помощью газожидкостной хроматографии и высокоэффективной жидкостной хроматографии. Clin. Chem. 35 , 74–76 (1989).

    CAS PubMed Google Scholar

  • 81.

    Pagés, H., Aboyout, P., Джентльмен, Р. и Биострингс, Д. С. Строковые объекты, представляющие биологические последовательности, и алгоритмы сопоставления (2016).

  • 82.

    R Core Team (2016). R: Язык и среда для статистических вычислений . (Фонд R для статистических вычислений, Вена, Австрия, 2016 г.).

  • 83.

    Эдгар, Р. К., Хаас, Б. Дж., Клементе, Дж. К., Айва, К. и Найт, Р. UCHIME улучшает чувствительность и скорость обнаружения химер. Биоинформатика 27 , 2194–2200 (2011).

    CAS PubMed PubMed Central Статья Google Scholar

  • 84.

    Pruesse, E. et al. . SILVA: всеобъемлющий онлайн-ресурс для проверенных и согласованных данных о последовательностях рибосомных РНК, совместимых с ARB. Nucleic Acids Res. 35 , 7188–7196 (2007).

    CAS PubMed PubMed Central Статья Google Scholar

  • 85.

    Lozupone, C. & Knight, R. UniFrac: новый филогенетический метод для сравнения микробных сообществ. Заявл. Environ. Microbiol. 71 , 8228–8235 (2005).

    CAS PubMed PubMed Central Статья Google Scholar

  • 86.

    Эйчисон, Дж. (Джон). Статистический анализ композиционных данных . (Чепмен и Холл, 1986).

  • 87.

    Седлар, К., Виденская, П., Скуткова, Х., Рычлик И. и Провазник И. Двудольные графы для визуализации анализа данных микробиома. Evol. Биоинформа . 12 (2016).

  • 88.

    Блондель В. Д., Гийом Ж.-Л., Ламбьотт Р. и Лефевр Э. Быстрое развертывание сообществ в большие сети. J. Stat. Мех. Теория Exp. 2008 , P10008 (2008).

    Артикул Google Scholar

  • 89.

    Bastian, M., Heymann, S.И Джакоми, М. Гефи: программное обеспечение с открытым исходным кодом для исследования и управления сетями. Визуализация и исследование больших графов.

  • 90.

    Maeda, H. et al. . Количественная ПЦР в реальном времени с использованием TaqMan и SYBR Green для Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis, Prevotella intermedia, гена tetQ и всех бактерий. FEMS Immunol. Med. Микробиол . 39 (2003).

    CAS Статья Google Scholar

  • 91.

    Vandesompele, J. et al. . Точная нормализация количественных данных ОТ-ПЦР в реальном времени путем геометрического усреднения нескольких генов внутреннего контроля. Биология генома . 3 , RESEARCH0034 (2002).

  • Это грязная тема, но давайте поговорим о корме

    Его можно описать по-разному: мягкий, твердый, коричневый, зеленый, жидкий и вонючий. Это беспорядочная тема, которую часто обсуждают за закрытыми дверями, но сегодня мы разберем все, что вам нужно знать о фекалиях - от его цвета, плотности и частоты до того, что делать, когда ребенок находится на попечении.

    По словам доктора Молли Гроу, педиатра из Детского отделения Сиэтла и Вашингтонского университета, некоторым семьям может быть сложно открыто рассказать о естественном процессе выведения из организма. Другими словами, трудно говорить о фекалиях. Часто бывает неловко говорить о предмете, хотя этого быть не должно.

    «Как педиатры, нам очень комфортно говорить о фекалиях», - сказал Гроу. «Мы стараемся нормализовать разговор с пациентами и семьями.”

    Разрушение

    По словам Гроу, нормальные здоровые фекалии могут иметь различный цвет. Это особенно актуально для младенцев, когда родители больше осведомлены о ежедневных изменениях фекалий. Grow говорит, что нужно думать о цветах осени, оценивая, есть ли повод для беспокойства.

    «Зеленый, коричневый и желтый - это нормально, - сказал Гроу. «Но если цвета больше похожи на Микки Мауса - черный, белый и красный, - тогда вам следует вызвать врача вашего ребенка. Эти цвета ненормальны и могут указывать на то, что что-то не так.”

    Если у ребенка какашки черного цвета, это может быть признаком внутреннего кровотечения. Если в стуле есть красный цвет или кровь, у ребенка может быть порез на дне или в кишечнике. Белый кал возникает при недостатке желчи и может указывать на основную проблему, но, по словам Гроу, это бывает очень редко.

    «Если вы заметили какой-либо из этих цветов, рекомендуется проконсультироваться с врачом, - сказал Гроу.

    Также важно отметить, что диета может влиять на цвет фекалий ребенка.Например, употребление большого количества железа может привести к потемнению фекалий, а употребление свеклы может сделать фекалии ребенка красными.

    Когда дело доходит до частоты, Гроу говорит, что дети должны качать каждые один-два дня, а консистенция должна быть мягкой и сформированной, как у мягкого мороженого. Если фекалии у ребенка твердые, сухие, напоминают лепешки или если ребенку приходится напрягаться, у них может быть запор.

    По словам Гроу, запор - одна из самых частых жалоб, с которыми она сталкивается во время визитов в клинику, а четверть обращений к гастроэнтерологам связана с запорами.

    «Один из самых распространенных симптомов - боль в животе», - сказал Гроу. «Если у ребенка болит животик, первый вопрос, который вам следует задать:« Когда вы в последний раз какали? »»

    Резервная копия

    Согласно данным Grow, существует ряд факторов риска запора.

    «Низкое потребление клетчатки и жидкости может вызвать запор», - сказал Гроу. «Важно следить за тем, чтобы дети пили воду между приемами пищи и ели достаточно цельных фруктов и овощей. Фрукты без косточек, такие как абрикосы или сливы, а также груши, как правило, являются действительно хорошими источниками клетчатки.Не переусердствуйте с бананами, они могут вызвать запор. Кроме того, избегайте слишком большого количества молочных продуктов и предлагайте в основном цельнозерновые продукты. Многие дети страдают запорами из-за большого количества фаст-фудов и полуфабрикатов, в которых, как правило, очень мало клетчатки. По общему признанию, это вызов для семей, которые всегда в пути. Полезно искать способы добавлять цельные продукты и блюда, приготовленные дома ».

    Grow также рекомендует регулярно заниматься спортом, чтобы предотвратить запор.

    «Наша пищеварительная система работает лучше, когда мы активны», - сказал Гроу.«Дети должны уделять не менее 60 минут ежедневной активности. Отличный способ оставаться активным - поощрять времяпрепровождение на свежем воздухе и физические игры. Сидячий образ жизни может увеличить риск запора ».

    Обращаюсь за помощью

    Если у ребенка запор, важно обратиться за помощью на ранней стадии. По словам Гроу, самая большая проблема, связанная с игнорированием проблемы, заключается в том, что запор может привести к тому, что ребенок не сможет почувствовать, когда пора в туалет. Если у ребенка запор и в его прямой кишке скопилось большое количество стула, у ребенка может вытечь фекалии, что называется энкопрезом.Если ребенок держится за какашку, он также может потерять тонус в прямой кишке.

    «Это действительно большая проблема, - сказал Гроу. «Дети не могут контролировать протекающие фекалии, и это может стать большим источником смущения. Чего мы пытаемся избежать, так это удержания фекалий ».

    Еще одним признаком того, что у ребенка может быть запор, является ночное недержание мочи. Когда ребенок держит в своих фекалиях, сбор фекалий может давить на его мочевой пузырь. С ранним вмешательством проблему можно решить.

    «Сочетание того, что мы можем делать с точки зрения кормления и деятельности, работают рука об руку», - сказал Гроу.«Запор - частая причина бедствий в семьях. Чем раньше мы сможем вмешаться, тем лучше. Часто изменения в диете могут помочь справиться с этим, но если этого не происходит, существуют хорошие лекарства, которые могут помочь ».

    Разговоры о фекалиях, как и поход в ванную, не должны быть утомительным занятием. Поговорите с детьми о фекалиях и сделайте это занятие приятным.

    «Мы хотим, чтобы дети не боялись какашек, особенно когда они учатся приучать к туалету», - сказал Гроу.

    Grow также рекомендует разговаривать с детьми, когда они становятся старше, о своих фекалиях.По мере того, как дети становятся старше, родители будут меньше прислушиваться к их туалетным привычкам, поэтому возможность говорить о фекалиях поможет родителям определить, нужно ли что-то решать со своим врачом.

    Итак, в следующий раз, когда ребенок скажет: «У меня болит живот», полезно спросить: «Когда вы в последний раз какали?»

    Ресурсов:

    Связанные

    Границы | Микробиомы кишечника различаются в зависимости от типа питания и консистенции стула у красного волка в неволе (Canis rufus)

    Введение

    Экстремальные потери популяций животных во всем мире привели к созданию программ разведения в неволе, направленных на поддержание генетического разнообразия и целостности видов (Консультативная группа по таксономии собак, ассоциация зоопарков и аквариумов, 2012).Например, американский красный волк ( Canis rufus) - это находящийся под угрозой исчезновения псовый, который исторически населял юго-восток Соединенных Штатов, в частности, простирающийся от Атлантического побережья до центрального Техаса, а южный Нью-Йорк служил северной преградой до Залива. Мексика (Hinton et al., 2013). Этот вид был почти истреблен программами борьбы с хищниками и продолжает сталкиваться с угрозами гибридизации с койотами и человеческой смертностью (Служба рыбной ловли и дикой природы США, 2016).Сегодня красные волки существуют в неволе и одной небольшой повторно интродуцированной популяции в Национальном заповеднике дикой природы Аллигатор-Ривер (ARNWR) в Северной Каролине (Служба рыболовства и дикой природы США, 2016; Phillips, 2018). Популяция ex situ служит для поддержания генетического разнообразия красного волка и имеет решающее значение для продолжения существования этого вида (Hedrick and Fredrickson, 2008).

    К сожалению, популяции красных волков, содержащихся в неволе, угрожают проблемы со здоровьем, особенно желудочно-кишечные (ЖКТ), которые не описаны в дикой популяции (Acton et al., 2000). Заболевания желудочно-кишечного тракта являются второй по частоте причиной смертности популяции красных волков, содержащихся в неволе (Acton et al., 2000; Seeley et al., 2016). Например, с 1992 по 2012 год 21% (32/151) смертности взрослых красных волков был связан с заболеванием желудочно-кишечного тракта, причем 25% (8/32) этих лиц страдали воспалительным заболеванием кишечника (ВЗК) (Acton et al. ., 2000; Seeley et al., 2016). Еще 25% (37 из 151) волков, умерших с 1992 по 2012 год, имели нелетальные поражения желудочно-кишечного тракта (Acton et al., 2000; Seeley et al., 2016). В то время как ВЗК не убила этих людей, 68% (22/37) имели поражения, похожие на ВЗК (Acton et al., 2000; Seeley et al., 2016). С 2018 года в неволе произошло четыре смерти, связанных с желудочно-кишечным трактом, одна из которых была вызвана перфорацией желудка, потенциально связанной с ВЗК (Wolf, 2019).

    В настоящее время возбудитель заболевания желудочно-кишечного тракта красного волка остается неизвестным; однако вполне вероятно, что играют роль сложные взаимодействия между микробиотой желудочно-кишечного тракта или бактериями в кишечнике, факторами окружающей среды и генетической предрасположенностью (Suchodolski et al., 2012а; Henson et al., 2017). Предыдущее исследование предполагает, что красные волки могут иметь генетическую предрасположенность к ВЗК, поскольку у этого вида отсутствует предположительно защитный аллель тимина в двух однонуклеотидных полиморфизмах (SNP) в гене toll-подобного рецептора-5, которые связаны с ВЗК у домашних собак ( Henson et al., 2017). Хотя мы не проверяли отсутствие предполагаемого защитного аллеля тимина в двух SNP в гене toll-подобного рецептора-5 у отобранных особей, мы делаем предположение, что этот отсутствующий аллель является постоянным для всех содержащихся в неволе красных волков на основе небольшой популяции основателей.

    Изменение структуры микробиома кишечника или сообщества бактерий в кишечнике - это распространенный паттерн, связанный с заболеваниями желудочно-кишечного тракта у людей и собак (Suchodolski et al., 2012b; Aziz et al., 2013; Yang et al., 2015; Marchesi et al., 2016; Xu et al., 2016) и могут быть связаны с изменениями в производстве короткоцепочечных жирных кислот (SCFA) группами бактерий (Parada Venegas et al., 2019) . В желудочно-кишечном тракте собак с ВЗК исследования показали относительное увеличение филы Proteobacteria (Minamoto et al., 2015) и актинобактерий (Xenoulis et al., 2008; Suchodolski, 2011; Gonçalves et al., 2018) и относительное уменьшение филы Bacteriodetes (Minamoto et al., 2015; Omori et al., 2017) и Fusobacteria ( Xenoulis et al., 2008; Suchodolski, 2011; Gonçalves et al., 2018) по сравнению со здоровыми людьми. Противоречивые результаты были обнаружены для филума Firmicutes, поскольку некоторые исследования показывают увеличение (Xenoulis et al., 2008; Suchodolski, 2011; Gonçalves et al., 2018), в то время как другие демонстрируют снижение относительной численности в кишечнике домашних собак с ВЗК (Suchodolski et al., 2012а; Минамото и др., 2015). На сегодняшний день нет информации о взаимосвязи между кишечным микробным сообществом и здоровьем желудочно-кишечного тракта красного волка.

    Увеличение и уменьшение филума и их связь со здоровьем кишечника, вероятно, связаны с производством SCFA, таких как бутират, Firmicutes и Fusobacteria (Vital et al., 2014) и ацетат и пропионат Bacteridoetes (Jandhyala et al., 2015). Другие бактерии могут продуцировать эти SCFA, однако это не описано. Бутират может подавлять воспаление в иммунных и эпителиальных клетках, улучшая провоспалительный ответ иммунных клеток на антигены (Gonçalves et al., 2018). Бутират может стимулировать различные свойства, которые улучшают функцию кишечного барьера, координируя плотные соединения, которые препятствуют движению провоспалительных молекул через стенку кишечника (Chambers et al., 2018) и останавливают накопление токсичных продуктов метаболизма (Jandhyala et al. , 2015). Ацетат является одним из основных компонентов, который позволяет некоторым бактериям убивать патогены в желудочно-кишечном тракте (Ríos-Covián et al., 2016). Кроме того, ацетат участвует в липогенезе жировой ткани или окисляется мышцами, и это может улучшить гомеостаз глюкозы и, возможно, воспалительный статус (Chambers et al., 2018). Ацетат также может подавлять воспаление низкой степени за счет снижения количества TNF-α, цитокина, участвующего в индукции и / или поддержании воспаления (van der Beek et al., 2016). Пропионат SCFA обеспечивает энергией эпителиальные клетки толстой кишки (Poeker, 2019), поддерживает гомеостаз в желудочно-кишечном тракте (Marchesi et al., 2016) и контролирует иммунную функцию, вызывая увеличение продукции и дифференцировки Treg-клеток (Ríos-Covián et al. , 2016), обладающий противовоспалительным и антиметаболическим действием.Более того, пропионат является предшественником глюкогенеза в печени (den Besten et al., 2015) и может стимулировать регуляцию аппетита и снижать потребление пищи у людей (Chambers et al., 2018). Вследствие их механизмов влияния любое изменение присутствия или концентрации этих SCFA может иметь негативные последствия для здоровья ЖКТ.

    Микробиота кишечника связана с питанием людей (Jandhyala et al., 2015), собак (Suchodolski et al., 2012b) и других диких животных (Dhanasiri et al., 2011; Nelson et al., 2013; Amato et al., 2016). У людей, которые придерживаются диеты с высоким содержанием фруктов, овощей и клетчатки, наблюдается увеличение относительного количества Firmicutes в кишечнике, в то время как у тех, кто придерживается диеты с высоким содержанием мяса животных, увеличивается относительное количество Bacteroidetes (Jandhyala et al. , 2015). Было отмечено, что у домашних собак диета с высоким содержанием углеводов может увеличить относительное количество Firmicutes, в то время как диета с высоким содержанием белка может увеличить относительное количество Fusobacteria (Hang et al., 2012). Более того, у наземных хищников было зарегистрировано увеличение относительной численности Firmicutes и уменьшение относительной численности Bacteroidetes (Nelson et al., 2013). Рыжих волков, содержащихся под присмотром людей, обычно кормят диетой, включающей сухой корм для собак, хотя некоторым особям предлагают коммерческое мясо, смешанное с их кормом, а небольшому количеству волков дают цельное мясо или тушу без порции. Несмотря на то, что предприятия пытаются имитировать диету, эти диеты в неволе могут отличаться от питательного состава, который дикий волк получил бы в своей естественной среде (Association of Zoos and Aquariums Canid Taxonomic Advisory Group, 2012).Было показано, что диета в неволе может изменять состав микробиома кишечника и функциональное разнообразие многих видов, обитающих в зоопарках (McKenzie et al., 2017). Эти изменения могут вызвать снижение иммунной функции, усвоения питательных веществ и здоровья желудочно-кишечного тракта (McKenzie et al., 2017).

    Хотя гистопатологические данные патологоанатомического исследования ткани показали высокую распространенность ВЗК в популяции красных волков ex situ , диагностировать ВЗК у живых людей сложно. Золотым стандартом диагностики ВЗК является эндоскопия для оценки поверхности слизистой оболочки двенадцатиперстной кишки и получения биопсии на всю толщину для гистопатологической оценки (Seeley et al., 2016; Вольф, 2019). Из-за необходимости в специализированном оборудовании и опыте, которые недоступны во многих учреждениях, консистенция стула использовалась в качестве общего показателя здоровья желудочно-кишечного тракта красного волка (Jergens et al., 2003; Rist et al., 2013; Bermingham et al., 2017; Karu et al., 2018; Falony et al., 2019).

    Общая цель этого исследования состояла в том, чтобы охарактеризовать микробиом кишечника взрослых красных волков в неволе и его связь со здоровьем желудочно-кишечного тракта. В нашем исследовании мы хотели ответить на два основных вопроса: (1) как микробиомы кишечника красного волка различаются между людьми с жидким стулом, что указывает на проблемы с желудочно-кишечным трактом и нормальной консистенцией стула, и (2) как тип питания соотносится с консистенцией стула и красным цветом. микробиомы кишечника волка.Заболевания желудочно-кишечного тракта, такие как ВЗК, представляют серьезную угрозу для популяции красных волков ex situ . В мире осталось менее 300 красных волков, и очень важно лучше понять происхождение болезней желудочно-кишечного тракта в популяции, содержащейся в неволе.

    Материалы и методы

    Сбор и оценка образцов кала

    Образцы фекалий были получены случайным образом у 50 красных волков, 48 волков в неволе, содержащихся в восьми помещениях, и у двух диких волков (дополнительная таблица 1).У содержащихся в неволе волков смотрители взяли в общей сложности 62 пробы фекалий во время обычных медицинских осмотров или в течение одного часа после визуального наблюдения за дефекацией. Образцы хранили при -20 ° C до ночной отправки в Смитсоновский институт биологии охраны природы. Когда образцы поступали в SCBI, их хранили при -80 ° C до экстракции ДНК. Две пробы фекалий были случайно собраны у двух диких волков в ходе усилий по отлову оставшейся дикой популяции в 2018 году, проведенной Службой рыболовства и дикой природы США в ARNWR в Мантео, Северная Каролина.Комитет IACUC Смитсоновского национального зоологического парка и комитет IACUC Университета Джорджа Мейсона исключили проект из-за его оппортунистического характера.

    Мы оценили консистенцию каждого образца фекалий после размораживания перед экстракцией ДНК на основе ранее описанных критериев: 0 = нормальные / слегка мягкие фекалии ( n = 22), 1 = мягкие фекалии с кровью и / или слизью или без них. ( n = 14), 2 = очень мягкий кал ( n = 12) и 3 = водянистая диарея ( n = 1) (Jergens et al., 2003). Образцы с показателем консистенции кала (FCS) 0 были отнесены к категории «нормальных», а FCS 1, 2 и 3 были отнесены к категории «жидкий стул». Категория жидкого стула попадает в диапазон от легкой до тяжелой, но мы объединили три оценки, потому что каждая из них представляет собой отклонение от нормальной консистенции стула. Предварительный статистический анализ показал, что FCS 1 и 2 не отличаются друг от друга по структуре бета-разнообразия микробиома (данные не показаны), обеспечивая статистическое обоснование объединения FCS 1, FCS 2 и FCS 3 вместе в категорию жидкого стула для увеличения выборки. размер и включают FCS 3 (при размере выборки 1).

    Типы диет

    особей были разделены на один из четырех диетических типов: (1) диета на основе гранул, (2) цельное мясо, (3) смесь гранул и коммерческого мяса и (4) дикие. Волки в неволе были разделены на группы, если их кормили этим типом диеты не менее 5 из 7 дней в неделю. Рацион на основе сухих кормов, состоящий из высококалорийного сухого корма на мясной основе, одобренного для домашних собак. Как правило, цельномясная диета состояла из пожертвованных или убитых на дороге белохвостого оленя, лося, дикой индейки, бобра, крыс, морских свинок или курицы.Как правило, смешанная диета состояла из классических диет для плотоядных животных - бревна из мяса собак или кошек (торговая марка Небраски), в основном состоявшей из конины и крупы. Дикие красные волки в основном потребляют белохвостого оленя, кролика, енотов, мелких млекопитающих и различных грызунов (McVey et al., 2013).

    Методы молекулярной генетики

    Мы экстрагировали ДНК из каждого образца с помощью набора QIAamp PowerFecal DNA Kit (№ 12530-50, Qiagen, MD) в соответствии с протоколом производителя. Стерильная микроцентрифужная пробирка объемом 1,5 мл была включена для каждого набора экстрактов образцов в качестве отрицательного контроля.Мы определяли концентрацию и качество ДНК на NanoDrop One (Thermo Fisher Scientific, Массачусетс).

    Мы использовали протокол двухэтапной полимеразной цепной реакции (ПЦР) в сочетании с двухиндексным парным секвенированием Illumina для секвенирования микробиома кишечника каждого человека. Для первого этапа ПЦР (ПЦР ампликона) мы амплифицировали область размером ~ 380 пар оснований в области V3 – V5 гена 16S рРНК с использованием универсальных праймеров 515F (GTGCCAGCMGCCGCGGTAA) и 939R (CTTGTGCGGGCCCCCGTCAATTC). Дублирующие реакции ПЦР были выполнены для каждого образца и включали отрицательные контроли экстракции и отрицательные контроли ПЦР.ПЦР ампликона на 20 мкл состояла из 10 мкл 2x Phusion HotStart II HF Master Mix, 1 мкМ прямого праймера, 1 мкМ обратного праймера и 2 мкл матрицы ДНК при концентрации 10-15 нг / мкл. Условиями ПЦР были: (а) активация при 98 ° С в течение 30 с, (б) 25 циклов денатурации при 98 ° С в течение 10 с, (в) отжиг при 68 ° С в течение 20 с, (г) удлинение при 72 ° С. C в течение 30 с и (e) окончательное удлинение при 72 ° C в течение 5 минут. Мы объединили дубликаты ПЦР ампликонов вместе, затем выполнили индексную ПЦР, подключив пользовательские адаптеры i5 и i7 на втором этапе ПЦР (индексная ПЦР), чтобы обеспечить уникальную идентичность каждого образца фекалий.Анализ 50 мкл индексной ПЦР состоял из 25 мкл 2x Phusion Hot Start II HF Master Mix, 5 мкл праймера i5, 5 мкл праймера i7 и 5 мкл очищенных продуктов ампликона. Условиями индексной ПЦР были: (а) активация при 98 ° C в течение 2 минут, (b) с последующими 8 циклами денатурации при 98 ° C в течение 20 с, (c) отжиг при 63 ° C в течение 30 с, (d) удлинение при 72 ° C в течение 30 с и (e) окончательное удлинение при 72 ° C в течение 2 минут. Мы использовали Speed-beads (в ​​буфере PEG / NaCl) (Rohland and Reich, 2012) для очистки продуктов пост-ПЦР между каждой реакцией ПЦР и проверенных продуктов ПЦР с помощью гель-электрофореза.Концентрацию каждого очищенного продукта индексной ПЦР измеряли с использованием Qubit4 (Invitrogen, MA), и образцы объединяли вместе в эквимолярной пропорции. Мы прогнали объединенную библиотеку на системе электрофореза E-Gel Power Snap Gel Electrophoresis System (Invitrogen, MA), используя кассету с 2% агарозным гелем, и вырезали целевую полосу (~ 380 пар оснований). Библиотеку из гелевого среза экстрагировали с использованием набора для экстракции геля QIAquick (# 28704, Qiagen, MD) и разбавляли до 4 нМ. Мы использовали кПЦР в реальном времени, следуя протоколу KAPA Library Quantification Kit Illumina Platforms, чтобы подтвердить концентрацию библиотеки (KK4824, Roche Sequencing and Life Sciences, MA) после экстракции геля.Объединенную библиотеку секвенировали в двух прогонах Illumina MiSeq (химия v3: набор 2 × 300 п.н.) в Центре сохранения геномики Национального зоопарка.

    После генерации последовательности мы импортировали демультиплексированные чтения из Illumina MiSeq в R версии 3.5.0 (R Core Team, 2018). Пакет «dada2» версии 1.12 (Callahan et al., 2016) использовался для проверки химер и фильтрации низкокачественных последовательностей (maxEE> 2). Мы создали варианты последовательности ампликона (ASV) и присвоили таксономию ASV, сравнивая последовательности с обучающим набором 16S проекта базы данных рибосом (RDP) 16 / release11.5 (Wang et al., 2007). Филогенетическое дерево было построено в программе Quantitative Insights Into Microbial Ecology 2 (vQIIME2-2018.4) (Bolyen et al., 2018) с использованием алгоритма fasttree (Price et al., 2009). Мы удалили вероятные загрязняющие ASV с помощью пакета «decontam» (Davis et al., 2017) и метода Фишера с порогом 0,1, который удалил три ASV. Затем мы отфильтровали любые образцы отрицательного контроля и одиночные ASV (ASV, которые встречаются как одна последовательность в одном образце). Некоторые люди (RW2079, RW2112, RW11559 и RW2247) пожертвовали несколько образцов, и был использован генератор случайных чисел, чтобы выбрать по одному образцу от каждого человека для включения в анализ.Один человек (RW2079) сдал в общей сложности 11 образцов в течение 6 месяцев, и общий состав микробиома кишечника был одинаковым для всех образцов (дополнительные рисунки 2, 3), что дает основания для включения только одного образца от каждого человека. Различия в глубине секвенирования составляли приблизительно 8x (макс. = 35 296, мин. = 4 418) у разных индивидуумов; поэтому мы не использовали методы коррекции нормализации, следуя рекомендациям Weiss et al. (2017).

    Статистический анализ

    Все статистические анализы проводились в R версии 3.5.0 (R Core Team, 2018), а значимость была определена как p <0,05. Мы использовали структуру анализа, основанную на предыдущем исследовании (Muletz-Wolz et al., 2019a, b), чтобы изучить структуру микробиома красных волков. Мы рассмотрели два основных вопроса с помощью статистического анализа: (1) чем микробиомы кишечника красного волка различаются между консистенцией жидкого и нормального стула и (2) как тип питания соотносится с консистенцией стула и микробиомами кишечника красного волка? В качестве общей схемы анализа микробиома мы исследовали вариации в структуре микробиома на трех уровнях: (1) альфа-разнообразие, которое представляет собой вариацию внутри образца, (2) бета-разнообразие, которое представляет собой вариацию между образцами, и (3) изменения в относительной численности на уровне филума и ASV.Что касается альфа-разнообразия, мы исследовали богатство ASV и филогенетическое разнообразие (PD) Фэйта. Для бета-разнообразия мы исследовали расстояния Жаккара, Брея-Кертиса и невзвешенные расстояния Unifrac. Для анализа относительной численности мы оценили, как состав микробиома кишечника различается в зависимости от типа питания и консистенция стула на уровне филума. Чтобы определить, существует ли связь между консистенцией стула и типом питания, мы провели точный тест Фишера с использованием функции fisher.test .

    Мы исследовали, различается ли альфа-разнообразие между консистенцией стула и категориями диеты, используя два критерия: богатство ASV и филогенетическое разнообразие Веры (PD).Богатство ASV - это количество уникальных бактериальных таксонов, и Faith’s PD оценивает, насколько филогенетически разнообразно бактериальное сообщество. Мы использовали тест Шапиро-Уилка и тест Левена, чтобы убедиться, что наши данные соответствуют предположениям о нормальности и гомоскедастичности. Мы провели ANOVA с богатством ASV или PD Веры в качестве переменной ответа, консистенцией стула и типом питания в качестве независимых переменных и удобством в качестве ковариаты, используя пакет «автомобиль» (Fox and Weisberg, 2011). Мы использовали функцию TukeyHSD для выполнения апостериорных анализов .

    Для изучения бета-разнообразия мы использовали PERMANOVA (Anderson, 2017) с расстоянием Jaccard, Bray Curtis или невзвешенным расстоянием Unifrac в качестве переменной ответа, консистенцией стула и типом питания в качестве независимых переменных и возможностью в качестве ковариаты в пакете «веганский» (Oksanen и др., 2019). Объекты объясняют 19–21% вариации в наборе данных (дополнительный рисунок 1), поэтому мы хотели учесть это, однако мы хотели сосредоточиться на типе питания и консистенции стула. Расстояния Жаккара основаны на присутствии-отсутствии таксонов бактерий, Брея-Кертиса взвешены по численности, а Unifrac - на основе присутствия-отсутствия при учете филогенетических отношений.Мы изучили дисперсию микробных сообществ с помощью PERMDISP, чтобы определить, различалась ли дисперсия сообществ между типами питания и консистенцией стула отдельно.

    Мы использовали два метода для оценки бактериальных таксонов, которые различались по консистенции стула и по типам питания. Во-первых, мы использовали пакет «DAtest» для определения лучших статистических тестов, чтобы выделить бактериальные таксоны, которые являются общими для категорий консистенции стула и для разных типов питания в двух отдельных анализах (Russel et al., 2018). Мы использовали функцию preDA , чтобы отфильтровать не распространенные ASV, которые присутствовали менее чем в 12 образцах для диетического типа и менее чем в 10 образцах для консистенции стула. Мы выбрали эти параметры, потому что они удалили ASV, которые не имели достаточной общей информации среди выборок, но сохранили редкие ASV, представляющие потенциальный интерес (Russel et al., 2018). Как для консистенции стула, так и для типа диеты, на уровне ASV было проведено тестирование дифференциальной численности, чтобы проверить, были ли какие-либо конкретные ASV, общие для категорий.Кроме того, была проведена оценка тестирования дифференциальной численности на уровне филума, поскольку этот таксономический уровень часто исследовался в литературе по ВЗК собак (Kim et al., 2017; Pilla and Suchodolski, 2020). Затем мы вводим количество необработанных последовательностей отфильтрованной таблицы ASV или нефильтрованной таблицы уровней филумов. Функция testDA использовалась для выполнения различных преобразований данных по умолчанию на основе статистического теста. Три использованных дифференциальных теста численности имели самый низкий уровень ложноположительных результатов для наших данных на уровне ASV (Russel et al., 2018). Мы сообщили только о ASV или типах, которые были значимыми, по крайней мере, в двух из трех лучших тестов дифференциальной численности. Для диетического типа использовались статистические тесты: дисперсионный анализ - мультипликативная нулевая коррекция и аддитивная нормализация логарифмических соотношений (функция DA.aoa) , тест Крускала-Уоллиса (функция DA.kru) и линейная регрессия с мультипликативной нулевой- Коррекция и нормализация центрального логарифма (функция DA.lmc) . Для определения консистенции стула в качестве статистических тестов использовалась общая линейная модель Квазипуассона (функция DA.qpo) , тест Wilcox Rank Sum и Signed Rank Test (функция DA.wil) и Welch t -test (функция DA.ltt ). Кроме того, был проведен анализ видов-индикаторов с использованием пакета «indicspecies» (De Caceres and Legendre, 2009), чтобы выявить любые закономерности относительной численности на уровне ASV, связанные с типами питания или консистенцией стула. Функция multipatt использовалась для матрицы относительного содержания. ASV считался допустимым индикаторным видом, если значение p было меньше 0.05, а значение индикатора было 0,5 или больше (De Cáceres et al., 2012). Значение индикатора 1 означает, что ASV присутствует во всех выборках из одной группы и полностью отсутствует в другой группе (De Cáceres et al., 2012). Напротив, значение индикатора 0 означает, что ASV обычно обнаруживался в выборках из обеих групп (De Cáceres et al., 2012). Для обоих методов тестирования дифференциальной численности использовалась одна и та же матрица видов. Каждый метод имеет свои собственные допущения и ограничения; использование обоих позволяет лучше понять таксоны, связанные с консистенцией стула и категориями рациона, в частности, значения индикаторов в анализе индикаторных видов.

    Результаты

    Мы охарактеризовали микробиом кишечника 50 волков из 8 хозяйств (дополнительная таблица 1). Образцы от 22 волков имели нормальную консистенцию стула, а у 28 волков - жидкий стул (Таблица 1). Тридцать четыре волка были отнесены к кормовой диете, три волка - к полностью мясной диете, 10 волков - к смешанной диете и два волка - к диете (таблица 1). Не было никакой связи между консистенцией стула и типом питания (точный тест Фишера, p = 0.2198).

    Таблица 1. Количество волков в каждой категории консистенции стула и категории диетического типа.

    Мы получили 729 356 высококачественных последовательностей из 50 образцов фекалий красного волка (среднее значение = 14 693 последовательности, минимальное значение = 4 418, максимальное значение = 35 296). Всего было идентифицировано 436 ASV, принадлежащих к пяти типам бактерий: Bacteroidetes, Firmicutes, Proteobacteria, Actinobacteria и Fusobacteria. Мы изучили относительную численность каждого типа среди четырех типов питания и консистенцию стула, соответственно (рис. 1).

    Рис. 1. Относительная численность высших бактериальных типов, обнаруженных в микробиоме кишечника содержащихся в неволе и диких красных волков, в связи с категориями консистенции стула (A) , используемыми в качестве заместителя для здоровья желудочно-кишечного тракта и четырех диетических типов (B ) ; сухие корма, смешанные, цельномясные или дикие. Никакие типы существенно не различались по относительной численности между консистенцией стула или типами питания.

    Отношение микробиоты кишечника к консистенции стула

    Структура микробиома кишечника обеих категорий консистенции стула была сходной по количеству присутствующих таксонов и филогенетическому разнообразию (ANOVA богатства ASV: F stat = 0.946, p = 0,337, df = 1; ANOVA Faith's PD: F stat = 1,498, p = 0,229, df = 1), но различались по составу (Рисунок 2, PERMANOVA: Jaccard Pseudo- F = 1,7644, df = 1). , R 2 = 3%, p = 0,01; Bray Pseudo- F = 1,7373, df = 1, R 2 = 2,9%, p = 0,055; невзвешенный Unifrac Псевдо- F = 1.8595, df = 1, R 2 = 2,97%, p = 0,017). В кишечном бактериальном сообществе наблюдалась аналогичная дисперсия между категориями консистенции стула (PERMDISP: Jaccard p = 0,2889, Bray-Curtis p = 0,3628, невзвешенный Unifrac p = 0.2008).

    Рис. 2. 3D Неметрическая многомерная шкала (NMDS) структуры фекального бактериального сообщества 50 красных волков (невзвешенная матрица расстояний Unifrac) между категориями консистенции стула.Эллипсы с доверительной вероятностью 95% показаны для категорий консистенции стула, жидкого и нормального.

    Не было ASV или бактериального типа, которые были бы идентифицированы с помощью дифференциального анализа численности между категориями консистенции стула. Анализ видов-индикаторов выявил три ASV, связанных с консистенцией жидкого стула: Blautia sp. ( p = 0,022, значение показателя = 0,5), Romboutsia sp. ( p = 0,01, значение показателя = 0,623) и Fusobacterium sp.( р = 0,019, значение показателя = 0,569) (рисунок 3). Было обнаружено, что три ASV связаны с нормальной консистенцией стула: Bacteroides caprocola ( p = 0,001, значение индикатора = 0,863), Bacteroides sp. ( p = 0,001, значение индикатора = 0,859) и Ruminococcacae spp. ( р = 0,002, значение показателя = 0,693) (рисунок 3).

    Рис. 3. Тепловая карта различий относительной численности бактериальных таксонов между кишечным микробиомом красных волков с рыхлым стулом (левая группа) и нормальной консистенцией стула (правая группа) .Все таксоны идентифицированы с помощью анализа индикаторных видов.

    Микробиота кишечника по отношению к типу питания

    Тип питания влияет на количество присутствующих бактерий и филогенетическое разнообразие кишечной микробиоты. Богатство кишечных бактерий ASV значительно различается между четырьмя типами диеты (ANOVA: F stat = 3,142, p = 0,04, df = 3) (Рисунок 4), при этом люди, потребляющие диету, имеют более низкий количество бактериальных таксонов, чем у тех, кто потребляет крупную и смешанную диету (TukeyHSD: wild - kibble p = 0.02, дикий-смешанный p = 0,03). Филогенетическое разнообразие (PD Faith's PD) также различается среди диетических типов (ANOVA: F stat = 5,053, p = 0,005, df = 3), причем дикие особи имеют более низкий PD Faith по сравнению с рационом из сухих кормов, смешанная диета и диеты из цельного мяса (TukeyHSD: дикий - крупа p = 0,02, дикий - смешанный p = 0,004, дикий - цельное мясо p = 0,01).

    Рис. 4. Богатство кишечных бактериальных таксонов в четырех различных типах диеты красного волка в неволе и дикого красного волка.Микробиом кишечника дикого красного волка имел более низкое богатство бактериальных таксонов, чем микробиом кишечника красных волков, содержащихся в неволе, на кормах и смешанных диетах (верхний индекс: HSD Тьюки: дикий - крупа p = 0,02, дикий - смешанный p = 0,03).

    Мы обнаружили, что тип питания влияет на состав бактериального сообщества в желудочно-кишечном тракте красного волка (Рисунок 5, PERMANOVA: Jaccard Psuedo- F = 2,518, df = 3, R 2 = 12,9%, p = 0,001; Брей Пседо- F = 2.1454, df = 3, R 2 = 10,9%, p значение = 0,001; невзвешенный Unifrac Psuedo- F = 3,3257, df = 3, R 2 = 15,9%, p = 0,001). Кишечное бактериальное сообщество волков, которым предлагали кормовую диету, отличалось от сообщества людей, которые потребляли цельномясную диету (попарно p <0,05 для Брея-Кертиса, Жаккара, расстояние Unifrac), смешанную диету (попарно p <0,05 для Расстояние Жаккара и Унифрака) и дикая диета (попарно p <0.05 для расстояния Жаккара и Unifrac). Волки, которые потребляли смешанную диету, также отличались от цельной мясной диеты (попарно p <0,05 для расстояния Жаккара и Унифрака). Бактериальные сообщества имели разную дисперсию (PERMDISP: Jaccard p = 0,01, Bray-Curtis p = 0,01), что может быть причиной значительных различий в бактериальном сообществе между типами питания.

    Рис. 5. Неметрическая многомерная шкала (NMDS) состава кишечного микробиома 50 красных волков, отсортированных по типам питания (невзвешенная матрица расстояний Unifrac).Конкретные различия в общем составе микробиома кишечника наблюдались между крупами и смешанной диетой, смешанной и цельнозерновой диетой, гранулированной и цельной мясной диетой, а также дикими и крупными диетами. Эллипсы доверительной вероятности 95% показаны для типов питания, содержащих более 3 образцов.

    Мы обнаружили три бактериальных ASV, которые различались по относительной численности в зависимости от типа диеты, в частности, между кормовым кормом и другими типами рациона, но не было обнаружено различий в относительной численности на уровне филума. Относительная численность ASV Catenibacterium mitsuokai ( DA.aoa p = 0,003; DA.lmc p = 0,01), Holdemanella sp. ( DA.aoa p = 0,003; DA.lmc p = 0,001; DA.kru p = 0,04) и Prevotella sp. ( DA.aoa p = 0,004; DA.lma p = 0,004) были значительно выше у волков, получавших гранулированный корм, по сравнению со всеми другими типами рациона (рис. 6). Анализ видов-индикаторов выявил один ASV, связанный с типом питания в виде гранул: Holdemanella sp. ( п. = 0.029, значение показателя = 0,901) (рисунок 6). Два ASV, идентифицированных с диким диетическим типом: Clostridium XI sp. ( p = 0,002, значение показателя = 1) и Lactococcus sp. ( р = 0,002, значение показателя = 1).

    Рис. 6. Относительное количество таксонов бактерий, которые различались по микробиому кишечника красных волков, получавших четыре типа рациона; сухие корма, смешанные, цельномясные и дикие. Таксоны, идентифицированные анализом индикаторных видов и / или DA.контрольная работа.

    Обсуждение

    Кишечник наполнен большой популяцией бактерий, которые защищают от патогенов, сбраживают неперевариваемые пищевые углеводы и способствуют развитию иммунной системы (Omori et al., 2017). Диета может повлиять на присутствие и / или численность таксонов бактерий, что может негативно повлиять на здоровье желудочно-кишечного тракта собак (Suchodolski et al., 2012b; McKenzie et al., 2017). Это исследование было первым, которое охарактеризовало состав микробиома кишечника красного волка, находящегося под угрозой исчезновения псового, и его связь с диетой и консистенцией стула.Типы бактерий и их относительная численность в микробиомах кишечника красного волка были аналогичны тем, которые наблюдались у других млекопитающих (Nishida and Ochman, 2018), включая псовых (Zhang and Chen, 2010; Deng and Swanson, 2015; Suchodolski, 2016; US Fish и Служба дикой природы, 2016; Алессандри и др., 2019a). В частности, бактериальные типы Firmicutes, Bacteroidetes и Fusobacteria наиболее многочисленны в кишечнике псовых, включая красного волка.

    Мы обнаружили, что консистенция стула связана с микробным составом кишечника, что также было обнаружено в других исследованиях (Vandeputte et al., 2016; Мюллер и др., 2020). В настоящем исследовании состав кишечного микробиома различается у содержащихся в неволе красных волков с нормальной консистенцией стула по сравнению с жидким, что позволяет предположить, что здоровье желудочно-кишечного тракта, вероятно, связано с составом микробиома. Мы обнаружили значительное увеличение относительной численности Blautia sp., Fusobacterium sp. И Romboutsia sp. в кишечном микробиоме красных волков с жидким стулом по сравнению с красными волками с нормальной консистенцией стула. Blautia sp.(тип Firmicutes) связан с болезнью Крона (Tedjo et al., 2016), синдромом раздраженного кишечника с диареей (Craven et al., 2017) и более мягким стулом (Müller et al., 2020) у человека. Кроме того, относительное увеличение Blautia sp. связан с увеличением количества лимфоцитов и лейкоцитов у поросят-отъемышей (Zhu et al., 2018b). Бактерии типа Firmicutes продуцируют бутират SCFA, который может влиять на иммунный ответ на воспаление (Corthay, 2009; Gonçalves et al., 2018). Относительное увеличение этого типа может привести к избытку продукции бутирата, что может вызвать воспаление, что приведет к неправильному иммунному ответу (Ratajczak et al., 2019). Относительное увеличение бактериальных таксонов в роду Fusobacterium (тип Fusobacteria) связано с пародонтозом и болезнью Крона у людей (Allen-Vercoe et al., 2011). Хотя пародонтоз и болезнь Крона находятся в разных частях тела, эти заболевания имеют общую характеристику; повышенная чувствительность к мутуалистическим бактериям (Allen-Vercoe et al., 2011). Бактерии типа Firmicutes производят бутират SCFA, который также может влиять на способность иммунной системы хозяина распознавать комменсальные бактерии (Gonçalves et al., 2018). Относительное увеличение численности этого рода может изменить способность правильно распознавать комменсальные бактерии в кишечнике. Род Romboutsia (тип Firmicutes) - это таксон, обычно встречающийся в кишечнике млекопитающих, включая собак. Хотя эти бактерии продуцируют SCFA, такие как ацетат и лактат (Gerritsen, 2015), их роль в поддержании здоровья желудочно-кишечного тракта относительно неизвестна (Gerritsen et al., 2019).

    Мы обнаружили значительное увеличение относительной численности семейства Ruminococcacae, Bacteroides coprocola и Bacteroides sp. в кишечнике волков при нормальной консистенции стула. Семейство Ruminococcacae (тип Firmicutes) связано с производством бутирата путем ферментации углеводов в кишечнике человека (Bamberger et al., 2018). Род Bacteroides (тип Bacteroidetes) обычно встречается в кишечнике человека; у людей со здоровым кишечником относительное содержание кишечника выше, чем у лиц, страдающих ВЗК (Miyake et al., 2015). Возможно, что бактериальные таксоны, связанные с жидким стулом, могут вызывать иммунный ответ, или что бактериальные таксоны, связанные с нормальной консистенцией стула, могут поддерживать здоровую функцию кишечника у красного волка в неволе, или и то, и другое.

    Исследования на домашних кошках и собаках демонстрируют связь между типом питания и качеством стула (Suchodolski et al., 2012b). В настоящем исследовании мы не обнаружили подобной взаимосвязи между диетой и консистенцией стула у красных волков в неволе.Другие факторы, включая употребление несоответствующей пищи (Gómez-Gallego et al., 2016), появление определенных патогенов (Suchodolski et al., 2012b), заболевание кишечных паразитов и опухоли или механическая непроходимость (Dandrieux, 2016), также могут повлиять на качество стула. Присутствие диареи может быть спорадическим у собак (Gómez-Gallego et al., 2016), и для установления связи между качеством стула и диетой может потребоваться сбор продольных образцов с течением времени. Кроме того, консистенция стула - лишь один из показателей здоровья желудочно-кишечного тракта.В будущих исследованиях следует объединить другие показатели, такие как оценка состояния тела, концентрация кобаламина в сыворотке и концентрация фолиевой кислоты в сыворотке, чтобы идентифицировать волков с плохим здоровьем желудочно-кишечного тракта. Низкие концентрации кобаламина и фолиевой кислоты в сыворотке зарегистрированы у собак с проблемами желудочно-кишечного тракта (Songsasen and Rodden, 2010). Измененный микробиом кишечника и консистенция жидкого стула могут указывать на изменение в потреблении питательных веществ и воды из-за увеличения времени прохождения по желудочно-кишечному тракту (Vandeputte et al., 2016).

    Мы продемонстрировали, что изменения в структуре микробиома кишечника были связаны с диетой красного волка.Микробиом кишечника волков в неволе, которые питались гранулированной пищей, в целом отличался от всех других типов диеты и особенно отличался от животных, содержащихся в неволе, которые предлагали диету из цельного мяса. Мы ожидали, что микробиом кишечника волков, употребляющих цельномясную диету, будет иметь такой же состав, что и микробиом кишечника диких волков, однако анализ показал, что состав не был аналогичным. Хотя волки в обеих диетических категориях питаются схожими видами, возможно, что разница в составе микробиома кишечника обусловлена ​​вариациями в пропорции основных источников пищи (белохвостый олень), вторичных источников пищи (мелкие млекопитающие) и третичной пищи. источники (грызуны) потребляются.Колебания в соотношении съеденной добычи очевидны в разных стаях диких волков, причем различия обусловлены расположением территории стаи (Phillips et al., 2003; Dellinger et al., 2011). Кроме того, Деллинджер и др. (2011) сообщили о том, что дикие красные волки потребляют антропогенные отходы со свалки и туши, что является еще одной возможной причиной различий в составе микробиома кишечника. У волков, которым предлагали корм в виде гранул, наблюдалось увеличение относительной численности типа Firmicutes, в то время как у особей, которых кормили полностью мясным рационом, наблюдалось увеличение относительной численности филума Fusobacteria.Тип Firmicutes связан с диетой с высоким содержанием углеводов, тогда как тип Fusobacteria связан с диетой с высоким содержанием белка у домашних собак (Hang et al., 2012). Рацион на основе гранул содержит большое количество крахмала (30–60% сухого вещества) (Fortes et al., 2010), что, вероятно, увеличивает относительное количество Firmicutes в микробиоме кишечника красных волков в настоящем исследовании. Точно так же диета из цельного мяса богата белком, и это, вероятно, объясняет увеличение количества фузобактерий в кишечном микробиоме волков, употребляющих эту диету.Изменение относительной численности этих типов в кишечнике может влиять на концентрацию продуцируемых SCFA (den Besten et al., 2013).

    Диета может усилить функцию и структуру кишечного барьера за счет продукции SCFA (Parada Venegas et al., 2019). Однако, если структура микробиома кишечника изменяется в результате диеты, это может повлиять на количество SCFA в производимых продуктах (Ratajczak et al., 2019). Этот сдвиг в продукции SCFA может быть из-за изменения присутствия или относительной численности бактерий, продуцирующих SCFA, или понижающей регуляции рецепторов, связанных с G-белком (GPCR) (Parada Venegas et al., 2019). Эти SCFA и GPCR работают вместе, чтобы поддерживать целостность кишечного барьера, вызывая заживление слизистой оболочки и подавляя воспаление (Parada Venegas et al., 2019). Кроме того, есть доказательства того, что диета влияет на активность GPCR, в частности, экспрессия GPR43 снижается в слизистой оболочке кишечника мышей, придерживающихся диеты с высоким содержанием жиров / сахара (Parada Venegas et al., 2019). Возможно, что диета меняет состав микробиома кишечника красных волков, содержащихся в неволе, что приводит к изменению концентрации этих SCFAs.Хотя бутират, ацетат и пропионат благотворно влияют на иммунную функцию и целостность кишечного барьера, устойчиво повышенные уровни этих SCFA также могут иметь негативные последствия, такие как воспаление (Ohira et al., 2017; Ratajczak et al., 2019) . Кроме того, слишком много или слишком мало SCFAs может привести к ожирению или другим метаболическим синдромам у людей и мышей (Ohira et al., 2017; Ratajczak et al., 2019). Возможно, необходим оптимальный уровень каждой SCFA для благоприятного воздействия на кишечник красного волка.

    Мы обнаружили увеличение относительной численности бактериальных таксонов Holdemanella sp., Cantenibacterium mitsuokai и Prevotella sp. в сухих кормах по сравнению со всеми другими диетами. Holdemanella sp. (phylum Firmicutes) производят бутират, уксусную и пропионовую кислоту (De Maesschalck et al., 2014) и связаны с вариациями кишечного микробиома, вызванными диетой с высоким содержанием жиров и сахаров (Dubé et al., 2018). Cantenibacterium mitsuokai (тип Firmicutes) связан с изменениями микробиома кишечника, вызванными диетой с высоким содержанием жиров и сахара (Dubé et al., 2018), а также с ферментацией углеводов и производством пропионата у кошачьих (Butowski et al., 2019). Аналогичным образом Prevotella sp. (phylum Bacteroidetes) коррелируют с кормлением в виде гранул, ферментацией углеводов и производством пропионата у кошачьих (Butowski et al., 2019) и домашних собак (Bermingham et al., 2017). У людей и мышей с синдромом раздраженного кишечника, страдающих рецидивирующей диареей, наблюдается увеличение количества бактерий этого рода (Su et al., 2018). Мы задокументировали два таксона бактерий только в кишечном микробиоме диких волков, которых не было у содержащихся в неволе волков; Clostridium XI sp., Lactococcus sp. И Clostridium XI sp. (тип Firmicutes) обнаруживаются в микробиоме кишечника здоровых домашних кошек и собак (Handl et al., 2011; Pilla and Suchodolski, 2020) и участвуют в расщеплении желчной кислоты, переваривании пищевых жиров и жирорастворимых витаминов (Deng и Swanson, 2015). Кроме того, эти таксоны вызывают противовоспалительные реакции в кишечнике домашних собак (Pilla and Suchodolski, 2020). Lactococcus sp. (тип Firmicutes) был обнаружен в кишечнике других собак, включая арктического волка и койота (Finlayson-Trick et al., 2017), и некоторые штаммы этих таксонов используются для выращивания пробиотических молочных продуктов для людей (Cook et al. ., 2018). Возможно, что бактериальные таксоны, связанные с кормлением из гранул, присутствуют для помощи в переваривании пищевого материала, но также могут вызывать воспаление желудочно-кишечного тракта из-за их чужеродной природы и / или продуцирования SCFAs на хронически повышенных уровнях у содержащихся в неволе красных волков.

    Чтобы реинтродукция красных волков была успешной, необходимо, чтобы красные волки, содержащиеся в неволе, содержались как можно более «дикими», включая их микробиом кишечника. Микробиому кишечника нужно время, чтобы акклиматизироваться в дикой среде во время реинтродукции (Yao et al., 2019). Если животным не дать достаточно времени для полной акклиматизации кишечного микробиома к дикой окружающей среде, это может повысить их восприимчивость к патогенам, снизить выживаемость, повлиять на правильную трансформацию питательных веществ, выработку витаминов и связь между микробиотой и иммунной системой (Weiss and Hennet , 2017; Yao et al., 2019). Мы обнаружили, что бактериальное богатство микробиома кишечника диких волков было значительно ниже по сравнению с микробиомом кишечника содержащихся в неволе волков. Контакт между людьми и волками в неволе может объяснить более высокое бактериальное богатство кишечника содержащихся в неволе волков; микробы могут передаваться от человека к животным и наоборот, живя в непосредственной близости друг от друга (Trinh et al., 2018). Мы также обнаружили более высокую численность Bacteroidetes и более низкую численность Fusobacteria у содержащихся в неволе животных по сравнению с дикими волками, что наблюдается у других млекопитающих во всем мире (McKenzie et al., 2017) и полудиких волков в Китае (Wu et al., 2017). Эти изменения, вызванные неволей и различиями в диете, могут изменить общее функциональное разнообразие кишечной микробиоты, в свою очередь, влияя на функцию ЖКТ. Неестественная диета может привлечь неприродные бактерии или изменить относительную численность естественной кишечной флоры (Henson et al., 2017; Alessandri et al., 2019b).

    Наш самый убедительный вывод, имеющий значение для менеджмента, заключался в том, что диета на основе сухих кормов была связана с наиболее отчетливым микробиомом кишечника, что позволяет предположить, что подход к диете, возможно, необходимо пересмотреть.Хотя кормовая диета для домашней собаки является полноценной по питательности, она действительно содержит большое количество крахмала (Fortes et al., 2010). Хотя домашняя собака и волк тесно связаны между собой, все же существуют эволюционные различия, разделяющие эти два вида. Есть свидетельства того, что одомашнивание собаки от волка ознаменовалось увеличением способности переваривать богатую крахмалом пищу (Axelsson et al., 2013). Волки обладают значительно меньшим числом диплоидных копий и экспрессией гена AMY2B, который кодирует экспрессию амилазы в поджелудочной железе, что позволяет расщеплять крахмал, чем домашняя собака (Axelsson et al., 2013). Кроме того, Zhu et al. (2018) сообщили, что волки адаптированы к диете, основанной на мясе, что подразумевает, что мясо должно быть включено в их ежедневный рацион. На основании этих данных становится ясно, что волк не так приспособлен к этой богатой крахмалом диете, как домашняя собака. Поэтому, возможно, придется пересмотреть подход к диете, чтобы в ежедневный рацион красного волка в неволе входило цельное мясо.

    Будущие исследования, которые помогут установить связь между диетой, здоровьем желудочно-кишечного тракта и микробиомом, могут отслеживать микробиом кишечника наряду с внесением изменений в рацион.Например, цельное мясо может быть добавлено в ежедневный рацион волка, поедающего только крупы, с одновременной оценкой микробиома кишечника для отслеживания сдвигов состава в сторону структуры микробиома кишечника дикого волка. Дополнительные образцы диких красных волков улучшат понимание структуры микробиома диких животных. Если красные волки, содержащиеся в неволе, должны были быть выпущены в дикую природу, перед выпуском может потребоваться имитировать состав кишечного микробиома дикого красного волка.

    В заключение мы охарактеризовали микробиом кишечника красного волка, находящегося под угрозой исчезновения псового, который сильно страдает от проблем со здоровьем желудочно-кишечного тракта.Мы обнаружили, что на структуру микробиома кишечника влияют консистенция стула и тип питания. Волки, потребляющие диету дикого типа, имели более низкое бактериальное богатство и филогенетическое разнообразие, чем их собратья в неволе, что позволяет предположить, что неволи могут вносить новые бактерии в микробиом кишечника красного волка в неволе, изменяя его состояние из дикой природы. Возможно, что красные волки, содержащиеся в неволе, приобретают таксоны бактерий из-за их функциональной роли в переваривании пищи в неволе, однако эти бактерии не могут быть полезны для красного волка.В мире осталось около 280 красных волков, 95% особей живут в неволе. В то время как содержащаяся в неволе популяция необходима для продолжения существования вида, содержащаяся в неволе среда привносит для жизни измененные диеты и искусственные сооружения (Williams et al., 2019). Эти факторы, наряду с другими, могут вызывать изменения в микробиоме кишечника (Williams et al., 2019), негативно влияя на здоровье желудочно-кишечного тракта красного волка. Для популяции, содержащейся в неволе, важно быть здоровым, чтобы облегчить успешное возвращение этих животных в естественный ландшафт в будущем.

    Заявление о доступности данных

    Наборы данных, представленные в этом исследовании, можно найти в онлайн-репозиториях. Названия репозитория / репозиториев и номера доступа можно найти ниже: https://www.ncbi.nlm.nih.gov/, PRJNA647909.

    Заявление об этике

    Исследование на животных было рассмотрено и одобрено IACUC - Университетом Джорджа Мейсона и IACUC - Смитсоновским институтом.

    Авторские взносы

    MB, EF, NS и CM-W запланировали исследование и экспериментальный план.MB и NS способствовали отбору проб на объектах. МБ выполнил выделение ДНК, подготовку библиотеки амплификации и секвенирование и написал рукопись. CM-W предоставил МБ руководство по лабораторным методам. MB и CM-W провели анализ и интерпретировали результаты. Рукопись редактировали EF, NS, HL и CM-W. Все авторы внесли свой вклад в статью и одобрили представленную версию.

    Финансирование

    Эта работа была поддержана Фондом охраны природы доктора Холли Рида зоопарка Пойнт-Дефаенс и аквариума.

    Конфликт интересов

    Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

    Благодарности

    Мы хотели бы поблагодарить все учреждения, которые участвовали в этом исследовании; Центр дикой природы Fossil Rim, Центр охраны волков Нью-Йорка, Музей жизни и науки Северной Каролины, Зоопарк Северо-Восточного Висконсина, Зоопарк и аквариум Пойнт-Дефайенс, Сэнди-Ридж, Зоопарк Тревора, Американская группа восстановления рыб и дикой природы Red Wolf и Международная организация Wolf Haven International.

    Дополнительные материалы

    Дополнительные материалы к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/articles/10.3389/fmicb.2020.5/full#supplementary-material

    Список литературы

    Эктон А. Э., Мансон Л. и Уодделл В. Т. (2000). Исследование результатов аутопсии красных волков (Canis Rufus), содержащихся в неволе, 1992-1996 гг. J. Zoo Wildl. Med. 31, 2–8. DOI: 10.1638 / 1042-7260 (2000) 031 [0002: sonric] 2.0.co; 2

    CrossRef Полный текст | Google Scholar

    Алессандри, Г., Milani, C., Mancabelli, L., Mangifesta, M., Lugli, G.A., Viappiani, A., et al. (2019a). Метагеномная диссекция микробиоты кишечника собак: понимание таксономических, метаболических и пищевых особенностей. Environ. Microbiol. 21, 1331–1343. DOI: 10.1111 / 1462-2920.14540

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Алессандри, Г., Милани, К., Манкабелли, Л., Мангифеста, М., Лугли, Г. А., Виаппиани, А., и др. (2019b). Влияние отбора при содействии человека на микробиоту кишечника домашних млекопитающих. FEMS Microbiol. Ecol. 95: физ121. DOI: 10.1093 / фемсек / физ121

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Амато, К. Р., Меткалф, Дж. Л., Сонг, С. Дж., Хейл, В. Л., Клейтон, Дж., Акерманн, Г. и др. (2016). Использование микробиоты кишечника в качестве нового инструмента для исследования здоровья желудочно-кишечного тракта колобина. Glob. Ecol. Консерв. 7, 225–237. DOI: 10.1016 / j.gecco.2016.06.004

    CrossRef Полный текст | Google Scholar

    Андерсон, М. Дж.(2017). «Пермутационный многомерный дисперсионный анализ (ПЕРМАНОВА)», в Wiley StatsRef: Statistics Reference Online , ed. W. StatsRef (Хобокен, Нью-Йорк: John Wiley & Sons), 1–15. DOI: 10.1002 / 9781118445112.stat07841

    CrossRef Полный текст | Google Scholar

    Ассоциация зоопарков и аквариумов Консультативная группа по таксономии собак. (2012). Руководство по уходу за крупными псовыми (Canidae). Сильвер-Спринг, Мэриленд: Ассоциация зоопарков и аквариумов.

    Google Scholar

    Аксельссон, Э., Ratnakumar, A., Arendt, M.-L., Maqbool, K., Webster, M.T., Perloski, M., et al. (2013). Геномный признак одомашнивания собак свидетельствует об их адаптации к диете, богатой крахмалом. Nature 495, 360–364. DOI: 10.1038 / природа11837

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Азиз К., Доре Дж., Эммануэль А., Гварнер Ф. и Куигли Э. М. М. (2013). Микробиота кишечника и здоровье желудочно-кишечного тракта: современные концепции и направления на будущее. Нейрогастроэнтерол.Мотил. 25, 4–15. DOI: 10.1111 / nmo.12046

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Bamberger, C., Rossmeier, A., Lechner, K., Wu, L., Waldmann, E., Fischer, S., et al. (2018). Обогащенная грецкими орехами диета влияет на микробиом кишечника у здоровых людей европеоидной расы: рандомизированное контролируемое исследование. Питательные вещества 10: 244. DOI: 10.3390 / nu10020244

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Бермингем, Э. Н., Маклин, П., Томас, Д. Г., Кейв, Н. Дж., И Янг, В. (2017). Ключевые семейства бактерий (Clostridiaceae, Erysipelotrichaceae и Bacteroidaceae) связаны с перевариванием белка и энергии у собак. PeerJ 5: e3019. DOI: 10.7717 / peerj.3019

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Bolyen, E., Rideout, J. R., Dillon, M. R., Bokulich, N.A., Abnet, C., Al-Ghalith, G.A., et al. (2018). QIIME 2: воспроизводимая, интерактивная, масштабируемая и расширяемая наука о данных микробиома. PeerJ Inc 6: e27295v2. DOI: 10.7287 / peerj.preprints.27295v2

    CrossRef Полный текст | Google Scholar

    Бутовски, К. Ф., Томас, Д. Г., Янг, В., Кейв, Н. Дж., Маккензи, К. М., Розендейл, Д. И. и др. (2019). Добавление растительных пищевых волокон к сырому красному мясу с высоким содержанием белка и жирами изменяет фекальный бактериом и профили органических кислот домашней кошки (Felis catus). PLoS One 14: e0216072. DOI: 10.1371 / journal.pone.0216072

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Каллахан, Б.Дж., Мак-Мерди, П. Дж., Розен, М. Дж., Хан, А. У., Джонсон, А. Дж. А., и Холмс, С. П. (2016). DADA2: вывод образца с высоким разрешением из данных ампликона Illumina. Nat. Методы 13, 581–583. DOI: 10.1038 / nmeth.3869

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Чемберс, Э. С., Престон, Т., Фрост, Г., и Моррисон, Д. Дж. (2018). Роль короткоцепочечных жирных кислот, генерируемых кишечной микробиотой, в метаболическом и сердечно-сосудистом здоровье. Curr. Nutr. Rep. 7, 198–206.DOI: 10.1007 / s13668-018-0248-8

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Core Team, R. (2018). R: язык и среда для статистических вычислений. Вена: Фонд R для статистических вычислений.

    Google Scholar

    Крейвен, Л. Дж., Сильверман, М., Бертон, Дж. П. (2017). Перенос измененного поведения и синдрома раздраженного кишечника с диареей (СРК-Д) через трансплантацию фекальной микробиоты на мышиной модели указывает на необходимость более строгих критериев скрининга доноров. Ann. Пер. Med. 5: 490. DOI: 10.21037 / атм.2017.10.03

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Дэвис, Н. М., Проктор, Д., Холмс, С. П., Релман, Д. А., и Каллахан, Б. Дж. (2017). Простая статистическая идентификация и удаление загрязняющих последовательностей в данных маркера-гена и метагеномики. Микробиом 6: 226.

    Google Scholar

    Де Касерес, М., Лежандр, П. (2009). Связи между видами и группами сайтов: индексы и статистический вывод. Экология 90, 3566–3574. DOI: 10.1890 / 08-1823.1

    CrossRef Полный текст | Google Scholar

    Де Касерес, М., Лежандр, П., Вайзер, С. К., и Бротон, Л. (2012). Использование комбинаций видов в анализе значения индикатора. Methods Ecol. Evol. 3, 973–982. DOI: 10.1111 / j.2041-210X.2012.00246.x

    CrossRef Полный текст | Google Scholar

    De Maesschalck, C., Van Immerseel, F., Eeckhaut, V., De Baere, S., Cnockaert, M., Croubels, S., et al.(2014). Faecalicoccus acidiformans gen. nov., sp. nov., выделенный из слепой кишки цыпленка, и реклассификация Streptococcus pleomorphus (Barnes et al. 1977), Eubacterium biforme (Eggerth 1935) и Eubacterium cylindroides (Cato et al. 1974) как Faecalicoccus pleomorphus comb. nov., Holdemanella biformis gen. нов., гребешок. ноя и Faecalitalea cylindroides gen. нов., гребешок. nov., соответственно, в семействе Erysipelotrichaceae. Внутр. J. Syst. Evol. Microbiol. 64, 3877–3884. DOI: 10.1099 / ijs.0.064626-0

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Деллинджер, Дж. А., Ортман, Б. Л., Стери, Т. Д., Болинг, Дж., И Уэйтс, Л. П. (2011). Пищевые привычки красных волков в период выращивания детенышей. Юго-восток. Nat. 10, 731–740. DOI: 10.1656 / 058.010.0412

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    den Besten, G., Bleeker, A., Gerding, A., van Eunen, K., Havea, R., van Dijk, T.H., et al. (2015). Короткоцепочечные жирные кислоты защищают от ожирения, вызванного диетой с высоким содержанием жиров, посредством PPARγ-зависимого перехода от липогенеза к окислению жира. Диабет 64, 2398–2408. DOI: 10.2337 / db14-1213

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    den Besten, G., van Eunen, K., Groen, A. K., Venema, K., Reijngoud, D.-J., and Bakker, B.M (2013). Роль короткоцепочечных жирных кислот во взаимодействии между диетой, кишечной микробиотой и энергетическим обменом хозяина. J. Lipid Res. 54, 2325–2340. DOI: 10.1194 / мл. R036012

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Дэн, П., и Суонсон, К.С. (2015). Микробиота кишечника людей, собак и кошек: текущие знания и будущие возможности и проблемы. Br. J. Nutr. 113, S6 – S17. DOI: 10.1017 / S0007114514002943

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Дханасири, А.К.С., Брунвольд, Л., Бринчманн, М.Ф., Корснес, К., Берг, Ø, и Кирон, В. (2011). Изменения кишечной микробиоты дикой атлантической трески ( Gadus morhua ) L. при выращивании в неволе. Microb.Ecol. 61, 20–30. DOI: 10.1007 / s00248-010-9673-y

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Дубэ, М. П., Парк, С. Ю., Росс, Х., Лав, Т. М. Т., Моррис, С. Р., и Ли, Х. Ю. (2018). Ежедневная доконтактная профилактика ВИЧ (ДКП) тенофовир дизопроксил фумарат-эмтрицитабин уменьшала количество Streptococcus и увеличивала количество Erysipelotrichaceae в микробиоте прямой кишки. Sci. Отчет 8: 15212. DOI: 10.1038 / s41598-018-33524-6

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Фалони, Г., Vandeputte, D., Caenepeel, C., Vieira-Silva, S., Daryoush, T., Vermeire, S., et al. (2019). Человеческий микробиом в здоровье и болезни: шумиха или надежда. Acta. Clin. Бельг. 74, 53–64. DOI: 10.1080 / 17843286.2019.1583782

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Финлейсон-Трик, Э. С. Л., Гетц, Л. Дж., Слейн, П. Д., Торнбери, М., Ламурё, Э., Кук, Дж. И др. (2017). Таксономические различия микробиомов кишечника определяют целлюлолитический ферментативный потенциал у млекопитающих, ферментирующих задний кишечник. PLoS One 12: e0189404. DOI: 10.1371 / journal.pone.0189404

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Фортес, К. М. Л. С., Карчиофи, А. К., Сакомура, Н. К., Каваучи, И. М., и Васконселлос, Р. С. (2010). Усвояемость и метаболическая энергия некоторых источников углеводов для собак. Anim. Feed Sci. Tech. 156, 121–125. DOI: 10.1016 / j.anifeedsci.2010.01.009

    CrossRef Полный текст | Google Scholar

    Фокс, Дж., И Вайсберг, С.(2011). Приложение {R} к прикладной регрессии, второе издание. Таузенд-Оукс, Калифорния: Сейдж.

    Google Scholar

    Герритсен Дж. (2015). Род Romboutsia: геномная и функциональная характеристика новых бактерий, предназначенных для жизни в кишечном тракте. Вагенинген: Университет Вагенингена.

    Google Scholar

    Герритсен, Дж., Хорнунг, Б., Ритари, Дж., Паулин, Л., Райкерс, Г. Т., Шаап, П. Дж. И др. (2019). Сравнительный и функциональный анализ геномики рода Romboutsia дает представление об адаптации к кишечному образу жизни. bioRxiv [Препринт] doi: 10.1101 / 845511

    CrossRef Полный текст | Google Scholar

    Gómez-Gallego, C., Junnila, J., Männikkö, S., Hämeenoja, P., Valtonen, E., Salminen, S., et al. (2016). Пробиотический продукт для собак при лечении острой или перемежающейся диареи у собак: двойное слепое плацебо-контролируемое исследование эффективности. Вет. Microbiol. 197, 122–128. DOI: 10.1016 / j.vetmic.2016.11.015

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Гонсалвес, П., Араужо, Дж. Р., и Ди Санто, П. Дж. (2018). Взаимодействие между короткоцепочечными жирными кислотами, полученными из микробиоты, и иммунной системой слизистой оболочки хозяина регулирует гомеостаз кишечника и воспалительное заболевание кишечника. Inflamm. Кишечник. 24, 558–572. DOI: 10.1093 / ibd / izx029

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Хандл, С., Дауд, С. Э., Гарсия-Мазкорро, Дж. Ф., Штайнер, Дж. М., и Суходольски, Дж. С. (2011). Массивное параллельное пиросеквенирование гена 16S рРНК выявляет очень разнообразные фекальные бактериальные и грибковые сообщества у здоровых собак и кошек. FEMS Microbiol. Ecol. 76, 301–310. DOI: 10.1111 / j.1574-6941.2011.01058.x

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Hang, I., Rinttila, T., Zentek, J., Kettunen, A., Alaja, S., Apajalahti, J., et al. (2012). Влияние высокого содержания белка или углеводов животного происхождения в фекальной микробиоте собак. BMC Vet. Res. 8:90. DOI: 10.1186 / 1746-6148-8-90

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Хенсон, Л.Х., Сонгсасен, Н., Уодделл, В., Вольф, К. Н., Эммонс, Л., Гонсалес, С. и др. (2017). Характеристика генетической изменчивости и основы воспалительного заболевания кишечника в гене Toll-подобного рецептора 5 красного волка и гривистого волка. Опасность. Виды Res. 32, 135–144. DOI: 10.3354 / esr00790

    CrossRef Полный текст | Google Scholar

    Хинтон, Дж. У., Чемберлен, М. Дж., И Рабон, Д. Р. (2013). Красный волк ( Canis rufus ) восстановление: обзор с предложениями для будущих исследований. Животные 3, 722–744. DOI: 10.3390 / ani3030722

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Джандхьяла С. М., Талукдар Р., Субраманьям К., Вуйюру Х., Сасикала М. и Редди Д. Н. (2015). Роль нормальной микробиоты кишечника. Мир. J. Gastroenterol. 21, 8787–8803. DOI: 10.3748 / wjg.v21.i29.8787

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Jergens, A. E., Schreiner, C. A., Frank, D. E., Niyo, Y., Аренс, Ф. Э., Экерсалл, П. Д. и др. (2003). Индекс оценки активности заболевания при воспалительном заболевании кишечника у собак. J. Vet. Междунар. Med. 17, 291–297. DOI: 10.1111 / j.1939-1676.2003.tb02450.x

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Кару, Н., Дэн, Л., Слэ, М., Го, А.С., Саджед, Т., Хюин, Х. и др. (2018). Обзор метаболомики фекалий человека: методы, применения и база данных метаболомов фекалий человека. Анал. Чим. Acta 1030, 1–24.DOI: 10.1016 / j.aca.2018.05.031

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ким, Дж., Ан, Дж .- У., Ким, В., Ли, С., и Чо, С. (2017). Платформа Illumina MiSeq обнаружила различия в микробиоте кишечника собак ( Canis lupus knownis ), получавших естественный или коммерческий корм. Кишечные патогены 9:68. DOI: 10.1186 / s13099-017-0218-5

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Марчези, Дж. Р., Адамс, Д.Х., Фава, Ф., Гермес, Г. Д. А., Хиршфилд, Г. М., Холд, Г. и др. (2016). Микробиота кишечника и здоровье хозяина: новый клинический рубеж. Кишечник 65, 330–339. DOI: 10.1136 / gutjnl-2015-309990

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Маккензи, В. Дж., Сонг, С. Дж., Делсук, Ф., Перст, Т. Л., Оливеро, А. М., Корпита, Т. М., и др. (2017). Влияние неволи на микробиом кишечника млекопитающих. Integr. Комп. Биол. 57, 690–704. DOI: 10.1093 / icb / icx090

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Маквей, Дж. М., Кобб, Д. Т., Пауэлл, Р. А., Стоскопф, М. К., Болинг, Дж. Х., Уэйтс, Л. П. и др. (2013). Рационы симпатичных красных волков и койотов на северо-востоке Северной Каролины. J. Mammal 94, 1141–1148. DOI: 10.1644 / 13-MAMM-A-109.1

    CrossRef Полный текст | Google Scholar

    Минамото, Ю., Отони, К. К., Стилман, С. М., Бюйюклеблебичи, О., Штайнер, Дж. М., Джергенс, А.E., et al. (2015). Изменение фекальной микробиоты и профилей метаболитов в сыворотке крови у собак с идиопатическим воспалительным заболеванием кишечника. Кишечные микробы 6, 33–47. DOI: 10.1080 / 194.2014.997612

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Мияке С., Ким С., Суда В., Осима К., Накамура М., Мацуока Т. и др. (2015). Дисбактериоз микробиоты кишечника пациентов с рассеянным склерозом с поразительным истощением видов, принадлежащих к кластерам клостридий XIVa и IV. PLoS One 10: e0137429. DOI: 10.1371 / journal.pone.0137429

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Мулец-Вольц, К. Р., Флейшер, Р. К., и Липс, К. Р. (2019a). Грибковые заболевания и температура изменяют структуру микробиома кожи в экспериментальной системе саламандры. Мол. Ecol. 28, 2917–2931. DOI: 10.1111 / mec.15122

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Muletz-Wolz, C.R., Kurata, N.P., Himschoot, E.A., Wenker, E. S., Quinn, E. A., Hinde, K., et al. (2019b). Разнообразие и временная динамика микробиомов молока приматов. Am. J. Primatol. 81: e22994. DOI: 10.1002 / ajp.22994

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Мюллер М., Гермес, Г. Д. А., Канфора, Э. Э., Смидт, Х., Маскли, А. А. М., Зетендал, Э. Г. и др. (2020). Дистальный толстокишечный транзит связан с разнообразием кишечной микробиоты и микробной ферментацией у людей с медленным толстым транзитом. Am. J. of Physiol. Гастроинтест. Liver Physiol. 318, G361 – G369. DOI: 10.1152 / ajpgi.00283.2019

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Нельсон Т. М., Роджерс Т. Л., Карлини А. Р. и Браун М. В. (2013). Диета и филогения формируют микробиоту кишечника антарктических тюленей: сравнение диких и содержащихся в неволе животных. Environ. Microbiol. 15, 1132–1145. DOI: 10.1111 / 1462-2920.12022

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Охира, Х., Цуцуи, В., Фудзиока, Ю. (2017). Являются ли короткоцепочечные жирные кислоты защитными игроками микробиоты кишечника от воспаления и атеросклероза? J. Atheroscler. Тромб. 24, 660–672. DOI: 10.5551 / jat.RV17006

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Oksanen, J., Guillaume Blanchet, F., Friendly, M., Kindt, R., Legendre, P., McGlinn, D., et al. (2019). Vegan: Пакет «Экология сообщества». Пакет R версии 2.5-5. Доступно на сайте: https: // CRAN.R-project.org/package=vegan (по состоянию на 1 сентября 2019 г.).

    Google Scholar

    Омори, М., Маэда, С., Игараси, Х., Оно, К., Сакаи, К., Ёнедзава, Т. и др. (2017). Микробиом кала у собак с воспалительным заболеванием кишечника и лимфомой кишечника. J. Vet. Med. Sci. 79, 1840–1847. DOI: 10.1292 / jvms.17-0045

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Парада Венегас, Д., Де ла Фуэнте, М. К., Ландскрон, Г., Гонсалес, М. Дж., Кера, Р., Дейкстра Г. и др. (2019). Короткоцепочечные жирные кислоты (SCFA), опосредуемые эпителиальной и иммунной регуляцией кишечника, и ее значение при воспалительных заболеваниях кишечника. Фронт. Иммунол 10: 277. DOI: 10.3389 / fimmu.2019.00277

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Филлипс, М. К., Генри, В. Г., и Келли, Б. Т. (2003). Восстановление красного волка в волков: поведение, экология и охрана. Чикаго, Иллинойс: University of Chicago Press, 272–288.

    Google Scholar

    Пилла Р., Суходольски Дж. С. (2020). Роль микробиома и метаболома кишечника собак в здоровье и желудочно-кишечных заболеваниях. Фронт. Вет. Sci. 6: 498. DOI: 10.3389 / fvets.2019.00498

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Покер, С. А. Т. М. (2019). На пути к пониманию модулирующего потенциала пищевых волокон на кишечную микробиоту с использованием новой модели кишечной ферментации человека и мыши. Цюрих: ETH Zurich. Докторская диссертация.

    Google Scholar

    Прайс, М. Н., Дехал, П. С., Аркин, А. П. (2009). FastTree: вычисление больших деревьев минимальной эволюции с профилями вместо матрицы расстояний. Мол. Биол. Evol. 26, 1641–1650. DOI: 10.1093 / molbev / msp077

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ратайчак, В., Рыл, А., Мизерский, А., Вальчакевич, К., Сипак, О., и Лащинска, М. (2019). Иммуномодулирующий потенциал короткоцепочечных жирных кислот (SCFA), полученных из микробиома кишечника. Acta Biochim. Pol. 66, 1–12. DOI: 10.18388 / abp.2018_2648

    CrossRef Полный текст | Google Scholar

    Риос-Ковиан, Д., Руас-Мадиедо, П., Марголлес, А., Геймонде, М., де лос Рейес-Гавилан, К. Г. и Салазар, Н. (2016). Короткоцепочечные жирные кислоты кишечника и их связь с питанием и здоровьем человека. Фронт. Microbiol. 7: 185. DOI: 10.3389 / fmicb.2016.00185

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Рист, В. Т. С., Вайс, Э., Эклунд, М., Мозентин, Р. (2013). Влияние диетического белка на состав и активность микробиоты в желудочно-кишечном тракте поросят в отношении здоровья кишечника: обзор. Животное 7, 1067–1078. DOI: 10.1017 / S1751731113000062

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Рассел, Дж., Торсен, Дж., Брейнрод, А. Д., Бисгаард, Х., Соренсен, С., и Бермолле, М. (2018). DAtest: основа для выбора метода дифференциальной численности или экспрессии. bioRxiv [Препринт] doi: 10.1101 / 241802

    CrossRef Полный текст | Google Scholar

    Сили К. Э., Гарнер М. М., Уодделл В. Т. и Вольф К. Н. (2016). Обзор болезней красных волков (Canis rufus), содержащихся в неволе, 1997–2012 гг. J. Zoo Wildlife Med. 47, 83–90. DOI: 10.1638 / 2014-0198.1

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Сонгсасен, Н., Родден, М. Д. (2010). Роль Плана выживания видов в сохранении гривистого волка ( Chrysocyon brachyurus ). Внутр. Зоопарк Ыб. 44, 136–148. DOI: 10.1111 / j.1748-1090.2009.00093.x

    CrossRef Полный текст | Google Scholar

    Су, Т., Лю, Р., Ли, А., Лонг, Ю., Ду, Л., Лай, С. и др. (2018). Изменение кишечной микробиоты с повышенным содержанием Prevotella связано с высоким риском синдрома раздраженного кишечника с преобладанием диареи. Гастроент. Res. Практик. 2018: 6961783. DOI: 10.1155 / 2018/6961783

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Suchodolski, J.С., Дауд, С. Е., Вилке, В., Штайнер, Дж. М., и Джергенс, А. Е. (2012a). Пиросеквенирование гена 16S рРНК выявляет бактериальный дисбиоз двенадцатиперстной кишки у собак с идиопатическим воспалительным заболеванием кишечника. PLoS One 7: e39333. DOI: 10.1371 / journal.pone.0039333

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Suchodolski, J. S., Markel, M. E., Garcia-Mazcorro, J. F., Unterer, S., Heilmann, R.M., Dowd, S. E., et al. (2012b). Микробиом фекалий у собак с острой диареей и идиопатическим воспалительным заболеванием кишечника. PLoS One 7: e51907. DOI: 10.1371 / journal.pone.0051907

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Теджо, Д. И., Смолинска, А., Савелкул, П. Х., Маскли, А. А., ван Скутен, Ф. Дж., Пиерик, М. Дж. И др. (2016). Фекальная микробиота как биомаркер активности болезни Крона. Sci. Отчет 6: 35216. DOI: 10.1038 / srep35216

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Trinh, P., Zaneveld, J.Р., Сафранек, С., Рабиновиц, П. М. (2018). Единые отношения здоровья между микробиомами человека, животных и окружающей среды: мини-обзор. Фронт. Общественное здравоохранение 6: 235. DOI: 10.3389 / fpubh.2018.00235

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    van der Beek, C. M., Canfora, E. E., Lenaerts, K., Troost, F. J., Olde Damink, S. W. M., Holst, J. J., et al. (2016). Дистальные, а не проксимальные инфузии ацетата толстой кишки способствуют окислению жиров и улучшают метаболические маркеры у мужчин с избыточным весом / ожирением. Clin. Sci. (Лондон). 130, 2073–2082. DOI: 10.1042 / CS20160263

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Вандепутте, Д., Фалони, Г., Виейра-Силва, С., Тито, Р. Ю., Йоосенс, М., и Раес, Дж. (2016). Консистенция стула тесно связана с богатством и составом кишечной микробиоты, энтеротипами и скоростью роста бактерий. Кишечник 65, 57–62. DOI: 10.1136 / gutjnl-2015-309618

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ван, К., Гаррити, Г. М., Тидже, Дж. М., и Коул, Дж. Р. (2007). Наивный байесовский классификатор для быстрого отнесения последовательностей рРНК к новой бактериальной таксономии. Заявл. Environ. Microbiol. 73, 5261–5267. DOI: 10.1128 / AEM.00062-07

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Weiss, S., Xu, Z. Z., Peddada, S., Amir, A., Bittinger, K., Gonzalez, A., et al. (2017). Стратегии нормализации и дифференциальной численности микробов зависят от характеристик данных. Микробиом 5:27. DOI: 10.1186 / s40168-017-0237-y

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Уильямс К. Л., Карабальо-Родригес А. М., Аллабанд К., Зарринпар А., Найт Р. и Гауглиц Дж. М. (2019). Взаимодействие между дикой природой и микробиомом и болезни: изучение возможностей смягчения последствий болезней в экологических масштабах. Drug Discov. Сегодня: Дис. Модели 28, 105–115. DOI: 10.1016 / j.ddmod.2019.08.012

    CrossRef Полный текст | Google Scholar

    Вольф, К.(2019). «Обновленная информация ветеринарной службы о популяции SSP», в протоколе «Протоколы выживания видов красных волков», заседание (Олбани, Джорджия).

    Google Scholar

    Wu, X., Zhang, H., Chen, J., Shang, S., Yan, J., Chen, Y., et al. (2017). Анализ и сравнение микробиома волка при различных факторах окружающей среды с использованием трех различных данных секвенирования следующего поколения. Sci. Отчет 7: 11332. DOI: 10.1038 / s41598-017-11770-4

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Ксеноулис, П.Г., Палкуликт, Б., Алленспах, К., Штайнер, Дж. М., Хаус, В. М. А., Суходольски, Дж. С. (2008). Молекулярно-филогенетическая характеристика дисбаланса микробных сообществ в тонком кишечнике собак с воспалительным заболеванием кишечника. FEMS Microbiol. Ecol. 66, 579–589. DOI: 10.1111 / j.1574-6941.2008.00556.x

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Xu, J., Verbrugghe, A., Lourenço, M., Janssens, G.P.J., Liu, D.J. X., Van de Wiele, T., et al.(2016). Влияет ли воспалительное заболевание кишечника у собак на микробный профиль кишечника и метаболизм хозяина? BMC Vet. Res. 12: 114. DOI: 10.1186 / s12917-016-0736-2

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Янг Т., Сантистебан М. М., Родригес В., Ли Э., Ахмари Н., Карвахал Дж. М. и др. (2015). Дисбактериоз кишечника связан с новизной и значимостью гипертонии. Гипертония 65, 1331–1340. DOI: 10.1161 / HYPERTENSIONAHA.115.05315

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Яо, Р., Xu, L., Hu, T., Chen, H., Qi, D., Gu, X., et al. (2019). «Дикие» микробиома кишечника гигантской панды и его значение для эффективной транслокации. Glob. Ecol. Консерв 18: e00644. DOI: 10.1016 / j.gecco.2019.e00644

    CrossRef Полный текст | Google Scholar

    Чжан Х. и Чен Л. (2010). Филогенетический анализ последовательностей гена 16S рРНК выявляет бактериальное разнообразие дистальных отделов кишечника у диких волков ( Canis lupus ). Мол. Биол. Rep. 37, 4013–4022.DOI: 10.1007 / s11033-010-0060-z

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Чжу, Дж., Гао, М., Сун, X., Чжао, Л., Ли, Ю. и Хао, З. (2018b). Изменения бактериального разнообразия и состава фекалий и толстой кишки поросят-отъемышей после кормления ферментированным соевым шротом. J. Med.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *