Гемолитический стафилококк что это такое: Гемолитический стафилококк: защита – иммунитет

Содержание

Гемолитический стафилококк: защита – иммунитет

Стафилококк – наиболее распространенный микроб на земле. Носителями этой бактерии является большинство жителей планеты. Как правило, присутствие стафилококка в организме ничем себя не проявляет. Однако, при антисанитарных условиях, перенаселенности, нездоровой пище стафилококк начинает свое негативное воздействие. При пониженном иммунитете стафилококк в носоглотке или на кожных покровах, особенно у детей, — это риск возникновения серьезных заболеваний. Стафилококк способен вырабатывать токсины, тем самым, нарушая жизнедеятельность клеток слизистых и кожи. Зачастую именно со стафилококковой инфекции начинаются опаснейшие заболевания, в том числе сепсис, воспаление легких, гнойные заболевания кожи, тяжелая интоксикация организма.

Наиболее распространены следующие патогенные стафилококки:

· сапрофитный стафилококк;

· золотистый стафилококк;

· эпидермальный стафилококк;

· гемолитический стафилококк.

По оценке специалистов, чаще всего стафилококк поражает слизистые дыхательных путей. К примеру, гемолитический стафилококк – возбудитель ангины (острого тонзиллита). Он обнаруживается при бактериологических исследованиях выделений из зева больных ангиной в 70% случаях. Поэтому многие врачи рассматривают ангину или воспаление миндалин как разновидность стафилококковой инфекции. У больных ангиной в несколько раз чаще, нежели у здоровых людей, обнаруживается повышение уровня стафилококковых антител. При хроническом тонзиллите гемолитический стафилококк высевается примерно в 50% случаев.

Основными типичными проявлениями наличия стафилококковой инфекции в горле становятся увеличение и гиперемия (покраснение) миндалин, а также боль при глотании. В детском возрасте поражение миндалин, вызванное гемолитическим стрептококком, может осложняться отитом, воспалением шейных лимфоузлов и скарлатиной.

Передача стафилококковой инфекции происходит контактным путем. Кстати, стоит отметить, что гемолитический стафилококк достаточно устойчив. Встречаются случаи, когда бактерии сохраняются на миндалинах и в носоглотке в спящем состоянии даже после курса лечения гемолитического стафилококка, и, соответственно, могут передаваться наиболее восприимчивым людям. Инкубационный (скрытый) период болезни продолжается около двух дней.

Последовательное лечение стафилококка гемолитического гарантирует отсутствие последующих серьезных осложнений (ревматизма, нефрита, сепсиса и ряда других опасных болезней).

Сам процесс лечения гемолитического стафилококка непрост, но излечение вполне реально, стоит лишь позаботиться о том, чтобы не развилась устойчивость бактерии к применяемому антибиотику. Назначив анализ на чувствительность к антибиотикам, доктор, скорее всего, порекомендует системное лечение гемолитического стафилококка в комплексе с антибиотиками, иммуномодулирующими средствами и препаратами, восстанавливающими нормальную микрофлору в организме.

Все препараты, назначенные врачом по схеме, необходимо обязательно пропить. Кроме того, важно, чтобы курс лечения был пройден полностью. Иначе оставшиеся гемолитические стафилококки становятся устойчивы к антибиотикам и практически неуязвимы к стандартному антибактериальному лечению. И только пройдя полный курс терапии, пересдав анализы, можно быть уверенным, что борьба с бактериями завершена, и организм здоров. Помните, главный принцип терапии гемолитического стафилококка – повышение иммунитета.

Берегите себя, закаляйте организм, полноценно питайтесь, занимайтесь спортом, отдыхайте на свежем воздухе. Крепкий иммунитет – надежный защитник от любых бактерий.

Гемолитический стафилококк: лечение бактериальных болезней

Стафилококки относятся к болезнетворным микроорганизмам и вызывают множество инфекционных заболеваний.

Существует много видов этой бактерии, и сейчас рассмотрим причины, признаки и лечение гемолитического стафилококка.

Содержание

Характеристика и описание вируса

Гемолитический стафилококк представляет собой бактерию, которая своим развитием провоцирует воспалительные процессы в организме. Название пошло от возможности гемолиза, то есть разрушения тканей и вызывания гнойных процессов.

Данные бактерии, как и многие другие микроорганизмы, живут колониями, которые под микроскоп напоминают гроздь винограда. На теле чаще живут в паховой области, подмышками. Основная особенность этого вида бактерии – это устойчивость к антибактериальным препаратам разных видов.

Причины развития заболеваний

Так как стафилококк живет прям на кожных покровах, то в организм он проникает через кожные повреждения – ссадины, царапины, ушибы, порезы и т. д. Также он может попасть и другими распространенными путями:

  • Фекально-оральным, когда человек употребляет зараженные продукты питания. Также можно «подцепить» заболевание при несоблюдении правил личной гигиены.
  • Воздушно-капельным путем большой риск заразиться в зимний период. Кроме этого, стафилококки в больших количествах содержатся в пыли, поэтому можно заразиться в загрязненных местах.
  • Бытовым путем, во время контакта зараженного человека со здоровым. Через рукопожатия, использования одной и той же посуды или средств личной гигиены.
  • Медицинским, если врач применяет некачественно обработанные инструменты для осмотра.

Зная способы заражения, необходимо принимать меры профилактики и предосторожности. Соблюдать чистоту дома и личную гигиену. Не использовать совместно с кем-то личные вещи, посуду, расчески и т. д.

Симптомы

Здоровая и крепкая иммунная система отлично борется с гемолитическим стафилококком.

Но только иммунитет ослабевает, бактерия может поселиться в организме и начать интенсивно развиваться. Как правило, это чревато следующими симптомами:

  • Боль в горле, образование белого налета на миндалинах, возможен гной на задней стенке горла, насморк, гайморит, головные боли, кашель, повышение температуры могут свидетельствовать о попадании гемолитического стафилококка на слизистую оболочку верхних дыхательных путей.
  • Появление чирок, фурункулов, гнойников и прочих высыпаний на кожном покрове «говорят» о заражении эпидермиса. То есть, бактерия вероятнее всего попала через микроскопическое повреждение в эпидермисе и начала развиваться в глубоких слоях кожи, вызывая тем самым нарыв или нагноение.
  • При заражении нижних дыхательных путей может проявляться сильный кашель с отхождением мокроты из бронхов или воспалением легких.
  • Если инфекция попадает в пищеварительную систему, тогда возникает патология желудочно-кишечного тракта. Тим заболевания и воспаления зависит от локализации стафилококка. Среди основных симптомов – вздутие живота, диарея, тошнота, рвота, легкая дрожь по телу, температура, непереносимость запахов.
  • Эндокардит – это воспалительный процесс, поражающий сердечную мышцу, проявляется болью в груди и затруднением дыхания.
  • Если гемолитический стафилококк поселится в мочеполовой системе, появляется воспалительный процесс мочевого пузыря, уретрит или воспаление яичников у представительниц прекрасного пола. Проявляются заболевания ложными позывами к мочеиспусканию, примесями крови в моче, болью внизу живота, жжением во время туалета.
  • При поражении костно-хрящевой ткани возникает суставная боль. При этом человек чувствует скованность в движениях, быструю утомляемостьи боль в суставах, в зависимости от локации стафилококка.

Нужно знать, что стафилококки поражают не только людей, но и животных, поэтому важно соблюдать правила поведения с домашними питомцами.

Очень важно следить за гигиеной ребенка, после игры с животными и также нельзя допускать, чтобы малыши обнимались и целовались с бродячими котами и собаками, так как гемолитический стафилококк – это малость того, чем от них можно заразиться.

Лечение антибиотиками

Гемолитический стафилококк характеризуется устойчивостью к некоторым антибактериальным препаратам. Поэтому первым шагом в процессе лечения является установление чувствительности бактерий к лекарственным средствам. Если же болезнь находится на пике, и нет времени на лабораторные исследования, то врач назначает пенициллиновые антибиотики.

Обычно антибактериальные таблетки назначают в комплексе с клавулановой кислотой, что позволяет преодолеть стойкость бактерий к лекарствам.

После получения результатов из лаборатории, возможно, врач заменит препарат на другой, который будет действовать эффективнее и быстрее. То есть, курс лечения назначается индивидуально для каждого пациента, отталкиваясь от многих факторов -анамнеза, наличия или отсутствия хронических заболеваний, общего состояния здоровья и места локализации заболевания.

Самыми распространенными антибиотиками для борьбы с данной группой микроорганизмов принято считать на основе следующих активных компонентов:

  • амоксициллин обладает способностью подавлять колонии стафилококков и дезинфицировать организм, препятствуя повторному их появлению
  • ванкомицин принимается внутривенно и разрушает верхнюю мембрану бактерии, вызывая тем самым ее гибель
  • оксациллин блокирует клетки стафилококка и постепенно их разрушает, не давая возможности им выживать и размножаться
  • банеоцин выпускается в форме мазей и применяется наружно, при поражении кожных покровов
  • цефалотин снимает воспаление и ускоряет выздоровление

Все эти препараты действуют по одному принципу – они разрушают клетки стафилококка, подавляя в них устойчивость к препаратам. В результате они гибнут, а место поражения быстро восстанавливается.
Внимание: нельзя самостоятельно использовать антибактериальные препараты, так как кроме патогенной микрофлоры они нарушают естественную, убивая «полезные» бактерии.

Народные способы

Наряду с медикаментозной терапией допустимо в домашних условиях использовать способы народных целителей.

Самые популярные и эффективные рецепты, которые можно приготовить самостоятельно для борьбы с бактериями стафилококка:

  • Черная смородина считается одним из самых сильных средств. В день необходимо съедать по одному стакану трижды – утром, в обед и вечером. Доказано, что вещества, входящие в химический состав ягод способны разрушать блокажу золотистого и гемолитического стафилококка.
  • Отвар из лопуха и окопника. Сухие и измельченные листья в равных количествах заливаются кипятком и настаиваются в течение 15-20 минут. Настой нужно пить по три раза в сутки до полного выздоровления. Его можно использовать вместо чая. При поражении эпидермиса из этого же отвара можно делать примочки и компрессы.
  • При поражении верхних дыхательных путей необходимо полоскание и ингаляции (если нет температуры). Для этого подойдет сбор из календулы, шалфея и ромашки. Так же для таких целей используется раствор соли и соды. Такие же средства можно использовать для подмывания при поражении мочеполовой системы.

Прежде чем использовать тот или иной метод, рекомендуется посоветоваться со специалистом.

Когда не нужно лечить стафилококк — рассказывает доктор Комаровский на видео:

Гемолитический стафилококк у мужчин и способы борьбы с ним

Гемолитический стафилококк у мужчин вызывает множество заболеваний. Патологии, вызванные стафилококком, протекают у человека в скрытой форме. Выявить заболевание на ранних стадиях можно при прохождении медицинского обследования. Лечение стафилококка необходимо проводить на раннем развитии, чтобы избежать появление осложнений.

Как выглядит бактерия

Гемолитический стафилококк представляет собой микроорганизм шаровидной формы. Размер взрослой бактерии достигает 1,2 мкм. Микроорганизмы селятся небольшими колониями. Под микроскопом колония выглядит как гроздь винограда. Гемолитический стафилококк относится к классу бактерий, отряду бацилл. Бактерия является патогенной микрофлорой мужского организма.

На быстрый рост колонии влияет иммунная система. При снижении местного иммунитета стафилококк начинает активно размножаться и питаться тканями на поврежденном участке. Гемолитический стафилококк вызывает некроз тканей и заражение кровеносной системы. Бактерия обладает высокой устойчивостью ко многим антибиотикам, хорошо переносит перепады температур. При повышении температуры окружающей среды до 70 градусов стафилококк способен жить до 12 часов. Благодаря устойчивости бактерии к антибиотической терапии заболевание является трудноизлечимым.

Патологии, указывающие на наличие бактерии

Гемолитический стафилококк выявить самостоятельно невозможно. Распознать бактерию можно только при наличии следующих заболеваний у мужчин:

  • Появление фурункулов на разных участках кожи;
  • Наличие гнойного абсцесса в гортани;
  • Экземы различной этиологии;
  • Кожный нейродермит;
  • Блефарическое поражение глаза;
  • Развитие пневмонии при поражении легких;
  • Воспалительные процессы в волосяных фолликулах;
  • Некроз почек и желчного пузыря;
  • Гнойное воспаление ткани головного мозга;
  • Септическое заражение крови.

Бактерия влияет на появление осложнений. При поражении стафилококком ушей у мужчины возникает гнойный отит. Если бактерия попала на слизистую оболочку носа и глотки, могут возникнуть гнойные ангины и гаймориты. Опасность бактерии заключается в развитии гнойной инфекции и устойчивость к антибиотикам. Самой тяжелой патологией, вызванной гемолитическим стафилококком, является сепсис. Если своевременно не обратиться за амбулаторным лечением, мужчина может погибнуть.

Причины развития бактериальной инфекции

На развитие колоний бактерий влияет снижение иммунной системы мужчины. Стафилококк может вызвать вторичное инфицирование ткани. Так, при появлении ран на теле бактерия провоцирует образование нагноения в ткани. В пораженном органе или ткани бактерия поселяется на место погибшей микрофлоры. Так как микроорганизм способен вызывать некроз, то клетки на пораженном участке отмирают и появляется гнойное воспаление. Стафилококк вызывает сильное отравление поврежденной ткани благодаря экзотоксину, который он вырабатывает.

У мужчин на появление инфекции влияют следующие причины:

  1. Несоблюдение правил личной гигиены;
  2. Наличие на теле различных травм;
  3. Ослабление иммунной системы;
  4. Инфекционные заболевания различной этиологии.

Гемолитический стафилококк вызывает инфекционное поражение мочеполовой системы у мужчин. В мочевыводящий канал бактерия попадает из внешней среды. Стафилококк вызывает циститы, гнойные уретриты. У некоторых мужчин стафилококк вызывает гнойное поражение наружных половых органов. Причиной инфекции мочеполовой системы чаще всего является тесное нательное белье.

Методы борьбы с бактерией

Гемолитический стафилококк трудно поддается лечению. Связано это с некоторыми особенностями микроорганизма.

Бактерия обладает высокой жизнестойкостью. Микроорганизм способен пережить многократное замораживание и оттаивание. Солнечное освещение не оказывает пагубного воздействия на стафилококк. Бактерии хорошо переносят высушивание в медицинских печах. После высушивания бактерия сохраняет жизнедеятельность в течение пяти месяцев. Гибель микроорганизмов возникает при кипячении и воздействии на них 5% раствора фенола. Стафилококк полностью пропадает при местном применении бриллиантовой зелени.

Для лечения инфекций, вызванных гемолитическим стафилококком, применяют узкий ряд антибиотических лекарственных веществ и специальный препарат, содержащий бактериофаг. Быстрых положительных результатов в терапии помогает достичь прием иммунных лекарственных веществ.

Уничтожение инфекции бактериофагом

Высокой активностью против стафилококка имеют бактериофагические препараты. Для терапии используют бактерию, питающуюся стафилококком. Для назначения бактериофага необходимо выяснить штамм стафилококка, вызвавшего инфекцию. После точного определения заболевания мужчине вводят препарат. Методы ввода бактериофага разнообразны и зависят от места локализации колоний. Положительные результаты бактериофагическое лечение показало при следующих патологиях:

  • Отиты, гнойные поражения глотки и гаймориты;
  • Гнойные абсцессы;
  • Стафилококковое поражение кишечника;
  • Мочеполовые заболевания;
  • Фурункулез мягких тканей;
  • Фолликулиты.

Для терапии отитов используется разведенный жидкий бактериофаг. Препарат употребляется капельно в ушную раковину. Процедура проводится в пятидневный период с ежедневным закапыванием бактериофага.

При гнойной ангине применяют жизнеспособные бактерии в чистом виде. Препаратом орошают полость глотки и рта. Терапия длится 10 дней. Орошение проводится двукратно в течение дня. После приема препарата не следует принимать пищу и воду в течение часа.

При дисбактериозе кишечника и инфекциях желудочно-кишечного тракта бактериофаг применяется в виде таблеток. Таблетированная форма имеет кишечнорастворимую оболочку. Оболочка при попадании в кишечник растворяется, и бактерия попадает на слизистую ткань. Длительность лечения зависит от степени поражения желудочно-кишечного тракта, но не превышает двухнедельного срока. При проникновении стафилококка в толстый кишечник мужчине назначается применение клизм с раствором лекарственного вещества.

Для лечения стафилококка в мочеполовой системе применяют жидкий раствор бактерий в чистом виде. Лекарственное средство вводят через специальный катетер. Лечение необходимо провести в стационаре. Гибель микроорганизма наступает на третьи сутки лечения бактериофагом. При инфекции наружных половых органов у мужчин используют примочки. Если на пораженном участке имеется нагноение, то совместно с бактериофагом наносится бриллиантовая зелень.

Фолликулярное нагноение и фурункулез требует сложного лечения. Мужчине назначается прием препарата внутрь и инъекции бактериофагом. Пораженный участок обкалывают препаратом местно. Для быстрого лечения необходимо провести пять процедур. Местное обкалывание проводят через день в больнице. Прием бактериофага помогает убить стафилококк изнутри.

Абсцесс может обрабатывать только специалист. Для начала процедуры с области, пораженной абсцессом, снимают гнойную пленку и убирают всю жидкость. Если нагноение находится глубоко в гортани, чистку раны проводят при помощи катетера. После тщательной просушки раны наносится раствор бактериофага. Если до пораженного участка невозможно добраться, то проводят внутривенное вливание препарата. Лекарство вводится через систему в течение 3–5 дней.

Медикаментозная терапия

Стафилококк тяжело поддается лечению антибиотическими лекарственными средствами. Если при бактериальном посеве микроорганизм показывает активность по отношению к широкому спектру антибиотиков, то при применении стафилококк может и не погибнуть. В современной фарминдустрии разработали три антибиотика, которые эффективны против стафилококковой инфекции у мужчин:

  • Ванкомицин в виде раствора для внутривенного введения;
  • Даптомицин;
  • Линезолид.

Ванкомицин обладает широким спектром действия. Эффективность препарата связана с механизмом его действия. Лекарственное вещество влияет на мембрану бактерии, способен изменить структуру РНК, делает стафилококк неактивным. Для лечения применяют порошок для приготовления раствора. Препарат следует готовить непосредственно перед процедурой. Применение ванкомицина не всегда целесообразно. У мужчины могут иметься в анамнезе противопоказания к применению. Так, препарат не назначается при неврите слухового прохода, наличии почечной недостаточности. Перед использованием ванкомицина у мужчины проводят тест на восприимчивость. Антибиотик является высокотоксичным и плохо переносится. Лечение стафилококка ванкомицином занимает пять дней.

Даптомицин разработан относительно недавно. Препарат относится к циклическим липопептидам. Лекарственное вещество применяется в виде систем. Даптомицин вызывает деполяризационный процесс в клеточной мембране стафилококка. При быстром ингибировании синтеза пептида микроорганизм погибает. Лечение антибиотиком проводят в стационаре, так как препарат вызывает различные побочные эффекты. Препарат не используют у мужчин, имеющих токсичные поражения почек. Терапия даптомицином проводится в течение пяти дней и вызывает полную гибель бактерии. Так как препарат обладает узким спектром действия, имеет высокую стоимость. Цена за один флакон даптомицина достегает 7100 р.

Линезолид назначается мужчине, если применение ванкомицина оказалось неэффективным. Лекарство выпускается в виде растворов для внутривенного введения и пилюль. Для терапии гемолитического стафилококка у мужчин применяется внутривенный раствор. Терапию проводят в пятидневный период. Инфузия ставится разово в сутки. Капельница проводится медленно и должна проходить не менее 30 минут. Лизенолид используют для лечения инфекций, вызванных грамположительными бактериями. Препарат имеет высокую стоимость. Один флакон медикамента может стоить 4 тыс. р. Лекарственное вещество взаимодействует с тиролом. Запрещается принимать пивные напитки и копченые продукты в течение всего лечения.

Самостоятельное применение антибиотиков может привести к осложнениям.

Мужчине необходимо знать наличие хронических заболеваний и патологических процессов в организме. Все препараты являются токсичными для почек. Если проводить терапию без врачебного контроля, у мужчины может возникнуть некроз почечной ткани.

Профилактика заболевания

Заражение гемолитическим стафилококком можно избежать. Мужчине необходимо строго соблюдать правила личной гигиены. При обнаружении ран и травм кожи необходимо незамедлительно использовать антибактериальный раствор или зеленку. При посещении общественных мест следует использовать влажные антибактериальные салфетки. Если в доме проживает мужчина, имеющий стафилококковую инфекцию, всем членам семьи следует пользоваться индивидуальными полотенцами и посудой. Нательное белье мужчине необходимо выбирать не тесное, произведенное из натуральных материалов. Для мытья тела можно применять антибактериальный гель или мыло. После посещения улицы следует мыть руки, и обязательно проверять наличие ран и ссадин на теле.


Если мужчина обратил внимание на частые гнойные заболевания, то ему необходимо обратиться к специалисту за консультацией. Бактериальный посев поможет выявить причину заболевания.

какие заболевания способен вызывать, методы борьбы с бактериями

Одной из крупных групп патогенных бактерий являются стафилококки. Ученые насчитывают их около 30 видов. Самым известным называют гемолитический стафилококк. Он опасен тем, что является причиной нагноений в организме, негативно влияет на клеточную структуру, приводит к воспалительным заболеваниям дыхательной системы. Лечение осложняется устойчивостью бактерии ко многим антибиотикам, поэтому подбор лекарственного средства проводят в лабораторных условиях. Избавиться от болезни можно только при правильно подобранной комплексной терапии.

Особенности гемолитического стафилококка

Бактерия Staphylocooccus Haemolyticus так названа из-за способности разрушать эритроциты. Ученые признали ее условно-патогенной для организма человека. Размеры бактерий в среднем 1,3 мкм, и для них характерно групповое скопление в определенных местах: в подмышечных впадинах, паху, промежности. Заражено стафилококком 3/4 населения на планете.

Микроб поражает преимущественно органы дыхания, поэтому у пациентов диагностируется фарингит, бронхит, ангина и прочие.

Самыми уязвимыми считаются дети, пожилые люди, беременные женщины и люди с ослабленным иммунитетом.

Стафилококк, проникая в организм человека, начинает продуцировать токсины, нарушающие обмен веществ и вызывающие различные виды невралгии.

Факторы, влияющие на активность гемолитического стафилококка

После проникновения в организм возбудитель не сразу себя проявляет. Активное развитие стафилококка начинается после:

  • стрессовых ситуаций;
  • ведения пассивного образа жизни;
  • некачественного питания;
  • авитаминоза;
  • ухудшения экологии;
  • обострения хронических заболеваний.

Лучшей мерой борьбы с гемолитическим стафилококком считается устранение причины возникновения заболевания. Для этого важно знать, где и как можно заразиться бактерией.

Пути заражения и распространения инфекции

Первыми признаками заболевания считается поражение слизистых оболочек верхних дыхательных путей. Проявляется это кашлем, насморком и признаками, похожими на ОРВИ или грипп.

Чаще всего гемолитическим стафилококком заражаются дети. Родители принимают заболевание за типичную вирусную инфекцию и приступают к самолечению лекарственными препаратами, активирующими иммунитет. Но правильное лечение можно назначить только после диагностики, поэтому нужно вовремя обратиться к врачу. Метод лечения избирается исходя из варианта проникновения инфекции в организм.

Врачи выделяют несколько путей заражения:

  1. Воздушно-капельный. Проникновение в организм бактерии особенно высокое в холодное время года. В этот период люди чаще находятся в закрытых помещениях, мало проветривают их и поэтому быстро заражаются.
  2. Фекально-оральный. Этот путь характерен для людей, не соблюдающих гигиену тела и употребляющих в пищу некачественные продукты.
  3. Контактно-бытовой. Наиболее вероятный способ проникновения бактерии при совместном проживании с инфицированным больным, где пользуются общими средствами гигиены, бельем и полотенцами. При нарушении целостности кожного покрова риск заражения в разы возрастает.
  4. Медицинский. Хирургическое вмешательство или обследование с помощью плохо обработанных инструментов приводит к заражению пациента.

Самый распространенный способ заражения – контактно-бытовой, так как кожные повреждения считаются благоприятной средой для развития инфекции.

Заболевания, вызываемые гемолитическим стафилококком

Стафилококк поражает в первую очередь слизистые органов дыхания, поэтому большинство болезней, которые им вызваны, связаны с этой системой. К ним относятся:

  • ангина;
  • фарингит;
  • пневмония;
  • бронхит.

Среди прочих заболеваний часто встречаются:

  • кожные – импетиго, рожистые проявления;
  • урологические – цистит, уретрит;
  • септическое поражение в послеродовой период;
  • скарлатина;
  • эндокардит.

Импетиго

Симптомы заболеваний проявляются не сразу, так как здоровая иммунная система легко справляется с проблемой в начале ее возникновения. При лабораторных исследованиях в этот период стафилококк не обнаруживается или выявляется в минимальных количествах. Ослабление защитных сил организма провоцирует активное размножение бактерий и расширение области поражения. Гемолиз наблюдается в случае проникновения стафилококка в кровеносное русло.

Лабораторная диагностика стафилококка

Малая активность бактерии в начале проникновения в организм стала причиной лабораторной диагностики болезней. Обнаружить микробы можно несколькими способами, которые отличаются между собой вариантом посева:

  1. Урогенитальный мазок. Для анализа берут микрофлору слизистой оболочки уретры. Образец располагают в специальной емкости с подготовленной средой, благоприятной для размножения. Оценка результата проводится на 7 день.
  2. Кожный мазок. Биоматериал берется из очага гнойного воспаления. Образец кладут в стерильную чашку. Результат анализируют на 6-7 день.
  3. Анализ мочи. Для исследования берут среднюю порцию мочи.
  4. Мазки из носоглотки и полости рта. Нос и рот перед забором анализа следует промыть. Биоматериал берут с утра натощак или не ранее трех часов после еды.
  5. Грудное молоко. Для анализа берется сцеженное молоко. На анализ идут не первые, а последующее капли молока, отдельно из каждой железы. Перед сцеживанием ареолу соска обрабатывают спиртовым раствором.
  6. Цервикальный мазок. Анализ берут из шейки матки у беременных. Оценивают не позже седьмого дня.
  7. Анализ кала. Забор делают из унитаза, предварительно застелив его плотной бумагой, либо из другой емкости, которая промыта заранее мыльным раствором.

При обнаружении в мазке патогенной микрофлоры сразу начинают лечение.

Лечение гемолитического стафилококка

Из-за высокой устойчивости к антибиотикам уничтожить микроорганизмы можно тщательно подобранными лекарствами. Эффективно воздействуют на микроорганизмы Амоксициллин, Кларитромицин, мазь Банеоцин, инъекции Ванкомицина и другие. Действие лекарств направлено на предотвращение процесса размножения бактерий, а также на уменьшение степени риска осложнений. Антибиотики подбираются врачом, который и контролирует их применение.

Существует специальное средство, содержащее бактериофаг, которое применяют для уничтожения инфекции в ЖКТ и мочеполовой системе. Метод лечения хорош тем, что бактериофаг, поселяясь в организме, начинает питаться стафилококком. При поражении кишечника очень эффективны лекарственные клизмы.

Беременным женщинам строго запрещена антибактериальная терапия, поэтому лечение для них заключается в ликвидации признаков заболевания. По рекомендации лечащего врача медикаментозное воздействие можно дополнить народными средствами и физиотерапевтическими процедурами.

Народные средства борьбы со стафилококком

Комплексный подход в лечении – наиболее правильный метод борьбы с заболеванием. Народные средства используют для повышения иммунитета, угнетения патогенной микрофлоры. Основными считаются:

  1. Медный купорос – применяется при кожных проблемах, а также в качестве профилактического средства.
  2. Хлорофиллипт в спиртовом и масляном растворах – используется при фарингитах, ангине, тонзиллите.
  3. Черная смородина – рекомендуется в качестве народного антибактериального средства, которое укрепляет защитные функции организма и пагубно влияет на возбудителей инфекции.
  4. Настойка лопуха и окопника в равных пропорциях – употребляется не менее трех раз в день, чтобы уничтожить бактерии.
  5. Мякоть абрикоса – применяется наружно в качестве антисептика или употребляется внутрь для уничтожения микроорганизмов.
  6. Уксус яблочный – помогает бороться с локальными повреждениями кожного покрова, используется в виде компрессов или ванн.
  7. Прополис – не вызывает привыкания у стафилококка и является антисептиком, поэтому часто используется в борьбе с заболеваниями полости рта, пищеварительной системы и органов дыхания.

Применяя народные средства, следует быть внимательнее к своему организму, так как может возникнуть аллергическая реакция.

Профилактика заболевания

Для предотвращения заражения стафилококком и блокировки дальнейшего его размножения в организме нужно проводить профилактические мероприятия. К ним относятся:

  1. Своевременная диагностика и правильное лечение болезни.
  2. Соблюдение правил личной гигиены.
  3. Лечение хронических заболеваний организма, которые ослабляют защитный барьер.
  4. Запрет на самолечение антибиотиками.
  5. Употребление витаминных добавок по согласованию с врачом.
  6. Поддержание чистоты в доме и регулярное проветривание помещений, особенно при большой численности людей.

Профилактика стафилококковой инфекции важна для женщин в период вынашивания ребенка. В это время существует много ограничений по приему медикаментов, поэтому лучше придерживаться основных правил профилактики, чем подвергать риску себя и будущего ребенка. Для этого мать должна правильно организовать питание, поддерживать режим сна и отдыха, избегать переохлаждения, стрессов и перенапряжения.

Стафилококковая лихорадка со скарлатиноподобным синдромом или как правильно обработать рану


Возбудителем стафилококковой  лихорадки является гемолитический стафилококк, обладающий дополнительными факторами агрессии. Он продуцирует эритрогенный стафилококковый токсин, который внедряется в организм не через носоглотку, а через поврежденную кожу!

Важным симптомом заболевания является мелкоточечная сыпь со сгущением возле очага инфекции (участка поврежденной кожи). Со временем сыпь  распространяется по всему телу.  При осмотре обращает на себя  внимание лишь легкое сгущение сыпи внизу живота и на бедрах. Появляется сыпь чаще на высоте лихорадки, но иногда уже при спаде температуры. Наблюдаются также положительные симптомы жгута и щипка:  появление мелких петехий при сдавливании кожи. На 5-7 день обычно возникает массивное крупнопластинчатое  шелушение кожи в местах высыпания. 

При возникновении лихорадки, сопровождающейся сыпью, обращение к врачу обязательно. Врач возьмет посев из раны для определения возбудителя заболевания, назначит антибактериальную терапию, руководствуясь  чувствительностью микроорганизма к антибиотикам. Возможно, понадобится посев крови, так как стафилококковая лихорадка  может осложниться сепсисом.

Но всего этого можно избежать,  если  вовремя и правильно обработать рану.

Важно: рану нужно помыть с мылом проточной водой (при этом из раны удаляются  микроорганизмы и инородные тела)
Важно: рану и область около раны не трогать руками без стерильных перчаток (во избежание инфицирования)
Важно: следует обрабатывать рану (не царапину) только антисептическими растворами ( хлор, не порошками, кремами, мазями

Порошки потом затруднят диагностику повреждений врачом при первичной хирургической обработки, мази бесполезны и чаще вредны

Важно: 3% перекись водорода нельзя лить в рану, только наносить марлевой салфеткой, иначе выделяющиеся пузырьки кислорода могут вызвать эмболию.

Важно: Рану следует прикрыть стерильной салфеткой и закрыть бинтом, или воздухопроницаемым пластырем. При отсутствии стерильной салфетки  имеющуюся чистую ткань прогладить с 2-х сторон утюгом

Квалифицированные врачи-дерматологи СЕМЕЙНОЙ КЛИНИКИ проконсультируют Вас по всем вопросам, связанным с кожными заболеваниями, и назначат необходимое лечение, которое, несомненно, приведет к выздоровлению.

Характеристика гемолизинов штаммов стафилококков, выделенных от человека и крупного рогатого скота, южный Иран

Иран J Vet Res. 2014 Осень; 15(4): 326–330.

Z Moraveji

1 DVM Студент факультета ветеринарной медицины Ширазского университета, Шираз, Иран;

M Tabatabaei

2 Кафедра патобиологии, Школа ветеринарной медицины и Институт биотехнологии, Ширазский университет, Шираз, Иран;

Х Ширзад Аски

3 Тел.D. Студент бактериологии, кафедра патобиологии, школа ветеринарной медицины, Ширазский университет, Шираз, Иран;

R Khoshbakht

4 Окончил Школу ветеринарной медицины Ширазского университета, Шираз, Иран

1 Студент DVM, Факультет ветеринарной медицины, Ширазский университет, Шираз, Иран;

2 Кафедра патобиологии, Школа ветеринарной медицины и Институт биотехнологии, Ширазский университет, Шираз, Иран;

3 Тел. D. Студент бактериологии, кафедра патобиологии, школа ветеринарной медицины, Ширазский университет, Шираз, Иран;

4 Окончил факультет ветеринарной медицины Ширазского университета, Шираз, Иран

* Для переписки: М. Табатабаи, кафедра патобиологии, факультет ветеринарной медицины, Ширазский университет, Шираз, Иран. Электронная почта: [email protected]

Поступила в редакцию 5 ноября 2013 г.; Пересмотрено 20 мая 2014 г .; Принято 18 июня 2014 г.

Эта статья была процитирована другими статьями в PMC.

Abstract

Стафилококки являются важными патогенными бактериями, вызывающими различные инфекции у животных и человека. Гемолизин является одним из факторов вирулентности коагулазоположительных (КПС) и коагулазоотрицательных стафилококков (КНС). Цель исследования состояла в том, чтобы охарактеризовать гемолизины Staphylococcus spp. выделены от человека и крупного рогатого скота, фенотипически и генотипически. Характеристика гемолизина фенотипически на основе картины гемолиза Staphylococcus spp. проводили на чашках с овечьим, лошадиным и кроличьим кровяным агаром. Гены, кодирующие гемолизин, амплифицировали со специфическими праймерами с использованием метода полимеразной цепной реакции (ПЦР). Гемолитическая активность фенотипически определялась у 60 и 90% всех изолятов крупного рогатого скота и человека соответственно. Все негемолитические изоляты были ЦНС (P≤0,05). Во всех изолятах методом ПЦР определяли генов hla и hld . Ни один из бычьих и человеческих изолятов не показал фенотипически и генотипически гамма-гемолизин.Результаты этого исследования позволяют предположить, что, в соответствии с общепринятым мнением, существуют некоторые различия в типах гемолизина среди штаммов Staphylococcus бычьего и человеческого происхождения. Кроме того, это исследование показало, что ЦНС может быть важным в качестве новых патогенов.

Ключевые слова: Staphylococcus spp., гемолизин, изоляты человека и крупного рогатого скота, ПЦР

Введение

Стафилококки хорошо известны как бактериальные патогены, вызывающие множественные типы инфекций как у людей, так и у животных (Le Loir et al. , 2003 ▶; Salasia et al., 2004 ▶). При диагностике инфекции стафилококки делятся на коагулазоположительные (CPS) и коагулазоотрицательные стафилококки (CNS) на основании способности коагулировать кроличью плазму. Как правило, Staphylococcus aureus является коагулазо-положительным, хотя встречаются и коагулазо-отрицательные изоляты S. aureus (Fox et al., 1996 ▶). Хотя S. aureus считается патогеном, наиболее часто выделяют ЦНС, особенно при гнойных инфекциях человека и субклиническом мастите у коров, овец и коз (Le Loir et al., 2003 ▶; Саласия и др., 2004 ▶; да Силва и др., 2005 ▶). Некоторые виды этого рода, особенно S. aureus , вызывают различные заболевания за счет продукции ряда ферментов и токсинов, инвазии клеток-хозяев, таких как гемолизины (da Silva et al., 2005 ▶). В настоящее время гемолизины стафилококков подразделяются на четыре различных типа, включая альфа (α), бета (β), гамма (γ) и дельта (δ) (Aarestrup et al., 1999 ▶). Альфа-токсин представляет собой гептамерный порообразующий экзотоксин, который лизирует преимущественно кроличьи эритроциты, но токсичен для эпителиальных клеток человека (Gouaux et al. , 1994 ▶). Бета-гемолизин представляет собой сфингомиелиназу, обладающую высокой активностью в отношении эритроцитов овец и быков (Larsen et al., 2002 ▶). Бета-токсин также известен как «горячий-холодный» токсин из-за его уникальной активности на чашках с агаром с овечьей кровью. При 37°С бета-токсин взаимодействует с эритроцитами барана, но не лизирует их. Если эритроциты затем поместить при 4°C, клетки лизируются; это наблюдается как отсутствие гемолиза на чашках с кровяным агаром при 37°C, а затем полный гемолиз при 4°C (Huseby et al., 2007 ▶).Гамма-токсин представляет собой двухкомпонентный экзотоксин, содержащий не менее шести различных комбинаций белков, одной из которых является лейкоцидин, поражающий эритроциты лошади (Dinges et al., 2000 ▶). Дельта-токсин представляет собой низкомолекулярный экзотоксин, который образует мультимерные структуры со способностью лизировать многие типы клеток (Novick et al., 2003 ▶). Несколько исследований показали, что гемолизины S. aureus хорошо коррелируют с инфекциями у людей и животных (Tackeuchi et al. , 2001 ▶; Larsen et al., 2002 ▶). Однако имеется мало информации о продукции гемолизинов ЦНС, выделенной при маститах животных и инфекциях человека, особенно в Иране. Генотипические различия между S. aureus , выделенными от человека и крупного рогатого скота, наблюдались многими авторами (Zadoks et al., 2000 ▶; Reinoso et al., 2004 ▶). Одной из ключевых характеристик, используемых для различения штаммов человека и крупного рогатого скота, является характер гемолиза. Таким образом, сообщалось, что большинство изолятов CPS крупного рогатого скота продуцируют бета-гемолизин и являются вариабельными продуцентами альфа-гемолизина, в то время как большинство изолятов CPS человека продуцируют альфа-гемолизин, но лишь ограниченное число продуцирует бета-гемолизин (Hummel et al., 1992 ▶; Aarestrup et al., 1999 ▶). На сегодняшний день имеется мало информации о характере гемолиза в ЦНС. Таким образом, целью настоящего исследования было определение и сравнение встречаемости гемолитических стафилококков, выделенных от крупного рогатого скота и человека, как фенотипическими, так и генотипическими методами.

Кроме того, мы продемонстрировали гемолитическую способность ЦНС, выделенной от мастита животных и инфекций человека в Ширазе, на юге Ирана.

Материалы и методы

Бактериальные изоляты

Всего 40 Staphylococcus spp.выделены от инфекций человека (n=20) и коровьего мастита (n=20), а также 9 референтных штаммов (IROST) Staphylococcus spp. были использованы в настоящем исследовании. Образцы Staphylococcus spp. были получены из кожных инфекций пациентов в больнице Намази и маститного молока 20 молочных коров из 15 ферм, расположенных в Ширазе, на юге Ирана. Во-первых, различные изоляты были идентифицированы как CPS и CNS на основании окрашивания по Граму, теста на коагулазу и каталазу, восстановления теллурита, активности лецитиназы и ферментации маннита на маннит-солевом агаре (MSA).Кроме того, изоляты идентифицировали с помощью родовой ПЦР-амплификации гена 16S рРНК (данные не представлены).

Характеристика гемолизинов

Типы гемолизинов охарактеризованы по зоне лизиса каждого стафилококкового изолята на тройных чашках с кровяным агаром с добавлением 5% овечьей, лошадиной и кроличьей крови после 24 и 48 ч инкубации при 37°С. Чтобы удалить любые возможные антигемолизиновые соединения, присутствующие в сыворотке, эритроциты промывали стерильным физиологическим раствором и ресуспендировали в физиологическом растворе до исходного объема крови (Ebrahimi et al., 2009 ▶). Гены, кодирующие гемолизины Staphylococcus spp. проводили путем амплификации генов hla , hlb , hld и hlg альфа-, бета-, дельта- и гамма-гемолизина с использованием метода ПЦР соответственно. Программы ПЦР и последовательности праймеров перечислены в .

Таблица 1

Таблица 1

Нуклеотидные последовательности, используемые в качестве праймеров для обнаружения генов гемолизена

MPHLG-2
Название праймера Последовательность (5-3) Целевой ген Температура отжига
(° C)
Размер изделия
(bp)
Артикул
HLA-1 CTGATTACTATCCAAGAAATTCGATTG хла 58 209 Жарро и др. ., 2002
HLA-2 CTTTTCAGCCCCTTTTTTTTATCAGT
HLB-1 GTGCacttactgacaatagtgtgctgct глб 58 309 Жарро и др., 2002
Эйч-2 GTTGATGAGTAGCTACCTTCAGT
ДВУ-1 AAGAATTTTTATCTTAATTAAGGAAGGAGTG холд 58 111 Жарро и др. ., 2002
HLD-2 TTAGTGAATTTTGTTCACTGTGTCGA
MPHLG-1 GTCAYAGAGTCCATATGCATTTAA глг 58 58 535 Jarraud et al ., 2002
CACLG-2 CACCAAATGTATAGCCTAAAGTG

Подготовка ДНК и ПЦР-анализ

Геномную ДНК бактерий экстрагировали из ночных культур изолятов с использованием процедуры, описанной ранее (Ahmadi et al. , 2010 ▶). Чистоту и концентрацию ДНК оценивали спектрофотометрически при 260 и 280 нм. После гена 16S рРНК была проведена ПЦР для идентификации Staphylococcus spp. и для обнаружения генов гемолизина, перечисленных в для каждого подтвержденного изолята. Амплификацию бактериальной ДНК проводили в общем реакционном объеме 25 мкл, содержащем 2 мкл матрицы ДНК из чистых культур. Реакционная смесь состояла из 2,5 мкл 10-кратного ПЦР-буфера (75 мМ Tris-HCl, pH 9,0, 2 мМ MgCl 2 , 50 мМ KCl, 20 мМ [NH 4 ] 2 SO 4 ), (CinnaGen, Иран), 1 мкл dNTP (50 мкМ), (CinnaGen), 1 мкл (1 ЕД ДНК-полимеразы Ampli Taq), (CinnaGen), 1 мкл (25 пмоль) прямого и обратного праймеров (CinnaGen), показано в , а объемы реакционных смесей достигали 25 мкл при использовании дистиллированной деионизированной воды.Матричную ДНК первоначально денатурировали при 94°С в течение 7 мин. В дальнейшем было проведено 35 циклов амплификации в программируемом термоциклере (MJ mini, BioRad, США). Каждый цикл состоял из денатурации в течение 1 мин при 94°С, отжига праймеров в течение 1 мин при 58°С и удлинения в течение 1 мин при 72°С. За последним циклом следовало окончательное удлинение при 72°С в течение 7 мин, после чего продукты ПЦР оставались в термоциклере при 4°С до их сбора. В каждый эксперимент был включен отрицательный контроль, содержащий воду.Продукты ПЦР разделяли электрофорезом в 1,5%-ном агарозном геле и визуализировали окрашиванием бромистым этидием и УФ-трансиллюминацией (BTS-20, Япония). В качестве маркера молекулярного размера использовали 100-пн ДНК-лестницу (CinnaGen, Иран).

Электрофорез в агарозном геле продуктов ПЦР генов гемолизина Staphylococcus spp. Дорожка M: ДНК-маркер длиной 100 п.н. (CinnaGen, Иран). Дорожка 1: отрицательный образец, дорожка 2: hla (209 п.н.), дорожка 3: hlb (309 п.н.), дорожка 4: hlg (535 п.н.) [нет положительного результата], и дорожка 5: hld (111 п.н.)

Статистический анализ

Для статистического анализа был проведен критерий хи-квадрат для анализа ассоциации генов гемолизина в образцах человека и крупного рогатого скота. Значение p ≤0,05 считалось статистически значимым.

Результаты

По результатам культуральных и биохимических свойств, а также амплификации 16S рРНК все исследованные в настоящем исследовании изоляты были идентифицированы как Staphylococcus . Всего 5 и 8 из 20 изолятов крупного рогатого скота и человека были CPS соответственно. Фенотипическая активность гемолизина обнаружена у 60 и 90% всех изолятов крупного рогатого скота и человека. Наличие негемолитических изолятов значительно отличалось среди ЦНС и ХПС, и все негемолитические изоляты принадлежали к ЦНС (P≤0.05). На чашках с агаром с овечьей кровью большинство Staphylococcus , выделенных от крупного рогатого скота, показали дельта-гемолизин, в то время как большинство изолятов человека продуцировали альфа-гемолизин. Из 20 изолятов человека 10 (50%) продуцировали двойной гемолизин (ДГ), но изоляты крупного рогатого скота показали значительно низкий коэффициент ДГ (1 из 20) (P≤0,05). Путем ПЦР-амплификации гена, кодирующего гемолизин Staphylococcus spp. со специфическими праймерами можно было наблюдать, что гены hla и hld присутствовали во всех изолятах.Также в сочетании с hla и hld ген hlb был обнаружен в 3 (15%) из 20 изолятов Staphylococcus , собранных от крупного рогатого скота, в 8 (40%) из 20 изолятов, собранных от крупного рогатого скота. люди, которые значительно отличались (P≤0,05), и 4 (44,4%) из 9 эталонных штаммов. Ни один из изолятов человека и крупного рогатого скота не обнаруживал фенотипически и генотипически гамма-гемолизин. Распределение различных генов гемолизина среди Staphylococcus spp.исследованных в настоящем исследовании показано в .

Таблица 2

Таблица 2

Характеристика гемолисанов Staphylococcus Штаммы

1 Бычий 9014 5 δ 90 145 NC
Штаммы Coagulase Test Фенотипическая характеристика
Генотипическая характеристика
Showing BA BA BA
S. saprophyticus PTCC 1440 NC NC NC α, δ
С.xylosus PTCC 1444 NC NC β α, β, δ
S. simulans PTCC 1442 δ δ β α, β, δ
S. chromogenes PTCC 1433 NC NC NC α, δ
S. intermedius PTCC 1438 + α α β α, β, δ
С.haemolyticus PTCC 1437 α α α α, δ
S. epidermidis PTCC 1436 α α β α, β, δ
S. sciuri PTCC 1441 δ δ δ α, δ
золотистого стафилококка PTCC 1764 + NC α α α, & delta;
NC NC NC α, & delta;
бычий 2 NC NC NC α, δ
бычий 3 δ δ δ α, δ
бычий 4 + NC α β α, β, δ
бычий 5 б б δ α, & delta;
бычий 6 NC NC NC α, δ
бычий 7 δ δ δ α, & delta;
бычьего 8 δ δ α, & delta;
Бычий 9 δ δ δ α, & delta;
бычьей 10 NC NC NC α, & delta;
бычьей 11 δ δ δ & alpha;, δ
бычий 12 + δ δ DH & alpha; , β, δ
Bovine 13 NC NC NC α, δ α, δ
Bovine 14 NC NC NC α, Δ
бычий 15 + NC α β α, β, δ
бычий 16 δ δ δ α, δ
Бычий 17 + NC δ δ α, & delta;
Бычий 18 + δ δ δ α, δ
Бычий 19 NC NC NC α, & delta;
бычий 20 NC NC NC α, δ
Человек 1 + NC α dh α, β, δ
человека 2 + NC α DH α, δ
человека 3 + α α DH α, β, δ
человека 4 + + NC α DH α, β, δ
человека 5 δ δ δ α, & delta;
Человека 6 NC α α α, & delta;
Человека 7 NC α DH α , δ
человека 8 α α α α α, δ
человека 9 NC NC NC α, δ
человека 10 α α α α α α человека 11 Δ δ Δ α, δ
δ δ δ α, & delta;
Человек 13 + NC α DH a, δ
Человек 14 + α DH α α, β, δ
человека 15 δ δ Δ α, β, δ
человека 16 NC α α α α α, β, Δ
человека 17 NC NC NC α, δ
Δ Δ Δ Δ δ α, δ
человека 19 NC NC α DH α, β, Δ
человека 20 + NC α DH α, β, δ

Обсуждение

Стафилококки чаще всего выделяют при маститах крупного рогатого скота и инфекциях человека. Болезни, вызванные этим родом, являются результатом синтеза нескольких факторов вирулентности, включая различные гемолизины, которые важны для вирулентности S. aureus и других стафилококков (da Silva et al., 2005 ▶). На сегодняшний день роль ЦНС как причины мастита крупного рогатого скота и инфекций человека и их гемолизиновых факторов до конца не ясна. Итак, в этом исследовании мы исследовали распределение четырех гемолизинов в изолятах ЦНС и ЦНС крупного рогатого скота и человека, фенотипически и генотипически.В этом исследовании, помимо образцов CPS (5 и 8 изолятов крупного рогатого скота и человека), использовали 15 и 12 образцов ЦНС, выделенных от инфекций крупного рогатого скота и человека. Мы обнаружили относительно большие различия в распространенности гемолизинов в изолятах Staphylococcus человека и крупного рогатого скота. Все выделенные CPS проявляли гемолитическую активность как по отдельности, так и в комбинированных формах, тогда как 25% штаммов CNS не были гемолитическими. Аналогичное исследование маститного козьего молока в бразильских молочных стадах показало высокие уровни одиночных или комбинированных типов гемолизина, продуцируемых S.aureus и ЦНС (da Silva et al., 2005 ▶). Аналогичные результаты были описаны Watts and Owens (1987) ▶ которые наблюдали выработку гемолизина S. xylosus и S. sciuri . Фенотипически большинство бычьих изолятов демонстрировали дельта-гемолиз на агаре с овечьей, лошадиной и кроличьей кровью, в то время как человеческие изоляты давали альфа-гемолиз, который, согласно многим исследованиям, показал различия между гемолизинами, продуцируемыми штаммом S. aureus , выделенным при мастите крупного рогатого скота, и от инфекции человека (Silva and Cardoso, 2000 ▶; Larsen et al., 2002 ▶). Тодар в 2005 году предположил, что большая часть S. aureus , выделенных от человека, обычно имеет бета-гемолитический характер, поскольку тромбоциты и моноциты человека более чувствительны к альфа-токсину, а большинство человеческих изолятов S. aureus не экспрессируют ß-токсин. Известно, что лизогенный бактериофаг кодирует токсин. CPS, выделенные от животных, в основном продуцируют охарактеризованный бета-токсин из-за чувствительности эритроцитов животных к этому токсину, но в этом исследовании большинство изолятов CNS крупного рогатого скота продуцировали дельта-гемолизин, что может быть связано с различиями в продукции гемотоксина у CNS и CPS. штаммы крупного рогатого скота.Кроме того, в этом исследовании двойной гемолизин, наблюдаемый у изолятов человека, был значительно выше, чем у изолятов крупного рогатого скота (P≤0,05). Возможно, это может указывать на то, что человеческие штаммы более патогенны, однако для подтверждения этой гипотезы необходимы дальнейшие исследования. Как показано на рисунке, все 49 CNS, CPS и эталонных штаммов, протестированных с помощью ПЦР, были положительными в отношении генов альфа- и дельта-гемолизина. Эти показатели встречаемости соответствуют данным других авторов (Silva and Cardoso, 2000 ▶; Larsen et al. , 2002 ▶; Эбрахими и др., 2009 ▶). Также в сочетании с альфа- и дельта бета-гемолизин наблюдался у 40% человеческих штаммов, что значительно выше, чем у бычьих изолятов (P≤0,05), что также подтверждает гипотезу о большей патогенности человеческих штаммов. В настоящем исследовании у всех изолятов отсутствовала экспрессия гамма-гемолизина. Генотипы гемолизина ЦНС и ЦПС в этом исследовании, по-видимому, не имели корреляции с экспрессией их фенотипов. На него могут влиять многие факторы на уровне генетики или фенотипа.

Существование генов hla и hld у S. aureus и CNS важно для этих изолятов, связанных со случаями стафилококковой инфекции, вызывающей заболевания животных и человека (Ariyanti et al., 2011 ▶). Это исследование показало, что гены hla и hld широко распространены среди S. aureus и ЦНС, выделенных у крупного рогатого скота и человека. Кроме того, результаты этого исследования позволяют предположить, что, в соответствии с общепринятым мнением, существуют некоторые различия в типах гемолизина среди штаммов Staphylococcus бычьего и человеческого происхождения. Кроме того, это исследование показало, что ЦНС продуцирует гемотоксины, и это может иметь важное значение в качестве нового патогена.

Благодарности

Работа выполнена при поддержке Школы ветеринарной медицины Ширазского университета, Иран. Кроме того, авторы хотели бы поблагодарить участников исследования за их вклад в исследование, а также нынешних и бывших исследователей и сотрудников. Авторы особенно хотели бы поблагодарить А. Шахед за лабораторную помощь.

Ссылки

  • Aarestrup, FM, Larsen, HD, Eriksen, NH, Elsberg, CS, Jensen, NE.Частота альфа- и бета-гемолизина у золотистого стафилококка крупного рогатого скота и человека. Сравнение между фено- и генотипом и изменением фенотипического выражения. . АПМИС. 1999;107:425–430. [PubMed] [Google Scholar]
  • Ahmadi, M, Rohani, SMR, Ayremlou, N. Обнаружение Staphylococcus aureus в молоке с помощью ПЦР. Комп. клин. Патол. 2010;19:91–94. [Google Scholar]
  • Ариянти Д., Саласия С.И.О., Тато С. Характеристика гемолизина золотистого стафилококка, выделенного из продуктов животного происхождения.Индонезийский J. biotech. 2011;16:32–37. [Google Scholar]
  • Da Silva, ER, Boechat, JUD, Martins, JCD, Ferreira, WPB, Siqueira, AP, da Silva, N. Производство гемолизина видами Staphylococcus aureus, выделенными из маститного козьего молока в бразильских молочных стадах. Маленький ром. Рез. 2005; 56: 271–275. [Google Scholar]
  • Динджес, М.М., Орвин, П.М., Шливерт, П.М. Экзотоксины золотистого стафилококка. клин. микробиол. 2000; 13:16–34. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Ebrahimi, A, Akhavan, TM.Характеристики стафилококков, выделенных от коров с клиническим и субклиническим маститом в Шахрекорде, Иран. Иранский Дж. Вет. Рез. 2009; 10: 273–277. [Google Scholar]
  • Фокс Л.К., Бессер Т.Е., Джексон С.М. Оценка коагулазонегативного варианта Staphylococcus aureus как причины внутригрудных инфекций в стаде молочного скота. Варенье. Вет. Мед. доц. 1996; 209:1143–1146. [PubMed] [Google Scholar]
  • Gouaux, JE, Braha, O, Hobaugh, MR, Song, L, Cheley, S, Shustak, C, Bayley, H.Субъединичная стехиометрия стафилококкового альфа-гемолизина в кристаллах и на мембранах: гептамерная трансмембранная пора. проц. Натл. акад. науч. США. 1994; 91:12828–12831. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Hummel, R, Devriese, LA, Lehmann, G. Характеристики бычьего Staphylococcus aureus с особым учетом активности фактора слипания. Междунар. Дж. Мед. микробиол. Вирол. Паразитол. Заразить. Дис. 1992; 276: 487–492. [PubMed] [Google Scholar]
  • Хасеби, М., Ши, К., Браун, К.К., Дигре, Дж., Менгисту, Ф., Сео, К.С., Бохач, Г.А., Шливерт, П.М., Олендорф, Д.Х., Эрхарт, Калифорния.Структура и биологическая активность бета-токсина золотистого стафилококка. Дж. Бактериол. 2007; 189:8719–8726. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Jarraud, S, Mougel, C, Thioulouse, J, Lina, G, Meugnier, H, Forey, F, Nesme, X, Etienne, J, Vandenesch, F. Взаимосвязь между генетическим фоном золотистого стафилококка, факторами вирулентности, группами agr (аллелями) и заболеванием человека. Заразить. Иммун. 2002; 70: 631–641. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Larsen, HD, Aarestrup, FM, Jensen, NE.Географическая изменчивость в присутствии генов, кодирующих суперантигенные экзотоксины и бета-гемолизин, среди золотистого стафилококка, выделенного при мастите крупного рогатого скота в Европе и США. Вет. микробиол. 2002; 85: 61–67. [PubMed] [Google Scholar]
  • Le Loir, Y, Baron, F, Gautier, M. Staphylococcus aureus и пищевое отравление. Жене. Мол. Рез. 2003; 2: 63–76. [PubMed] [Google Scholar]
  • Novick, RP. Автоиндукция и сигнальная трансдукция в регуляции вирулентности стафилококков. Мол. микробиол.2003; 48: 1429–1449. [PubMed] [Google Scholar]
  • Reinoso, E, Bettera, S, Frigerio, C, DiRenzo, M, Calzolari, A, Bogni, C. RAPD-ПЦР-анализ штаммов Staphylococcus aureus, выделенных из бычьих и человеческих хозяев. микробиол. Рез. 2004; 159: 245–255. [PubMed] [Google Scholar]
  • Salasia, SIO, Khusnan, Z, Lämmler, C, Zschöck, M. Сравнительные исследования фено- и генотипических свойств Staphylococcus aureus, выделенного из коровьего субклинического мастита в Центральной Яве в Индонезии и Гессе в Германия.Дж. Вет. науч. 2004; 5: 103–109. [PubMed] [Google Scholar]
  • Сильва, Нда, Кардосо, HFT. Производство гемолитических токсинов с помощью изолятов Staphylococcus aureus, выделяемых при мастите крупного рогатого скота. Вет. Новости. 2000; 6: 63–67. [Google Scholar]
  • Такеучи С., Маэда Т., Хашимото Н., Имаидзуми К., Кайдох Т., Хаякава Ю. Вариации локуса agr в изолятах Staphylococcusaureus от коров, больных маститом. Вет. микробиол. 2001; 79: 267–274. [PubMed] [Google Scholar]
  • Тодар, К. Тодар Онлайн-учебник по бактериологии.Стафилококк. Кафедра бактериологии, Университет Винкосин-Мэдисон; 2055. www.textbookofbacteriology.net/staph.html. [Google Scholar]
  • Watts, JL, Owens, WE. Синергетический гемолиз, связанный с коагулазонегативными стафилококками, выделенными из бычьих молочных желез. Дж. Клин. микробиол. 1987; 25:2037–2039. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Zadoks, R, van Leeuwen, W, Barkema, H, Sampimon, O, Verbrugh, H, Schukken, Y, van Belkum, A. Применение геля импульсного поля электрофорез и бинарное типирование как инструменты ветеринарной клинической микробиологии и молекулярно-эпидемиологического анализа изолятов золотистого стафилококка крупного рогатого скота и человека.Дж. Клин. микробиол. 2000; 38: 1931–1939. [Бесплатная статья PMC] [PubMed] [Google Scholar]

Характеристика гемолизинов штаммов стафилококков, выделенных из человека и крупного рогатого скота, южный Иран

Iran J Vet Res. 2014 Осень; 15(4): 326–330.

Z Moraveji

1 DVM Студент факультета ветеринарной медицины Ширазского университета, Шираз, Иран;

M Tabatabaei

2 Кафедра патобиологии, Школа ветеринарной медицины и Институт биотехнологии, Ширазский университет, Шираз, Иран;

Х Ширзад Аски

3 Тел. D. Студент бактериологии, кафедра патобиологии, школа ветеринарной медицины, Ширазский университет, Шираз, Иран;

R Khoshbakht

4 Окончил Школу ветеринарной медицины Ширазского университета, Шираз, Иран

1 Студент DVM, Факультет ветеринарной медицины, Ширазский университет, Шираз, Иран;

2 Кафедра патобиологии, Школа ветеринарной медицины и Институт биотехнологии, Ширазский университет, Шираз, Иран;

3 Тел.D. Студент бактериологии, кафедра патобиологии, школа ветеринарной медицины, Ширазский университет, Шираз, Иран;

4 Окончил факультет ветеринарной медицины Ширазского университета, Шираз, Иран

* Для переписки: М. Табатабаи, кафедра патобиологии, факультет ветеринарной медицины, Ширазский университет, Шираз, Иран. Электронная почта: [email protected]

Поступила в редакцию 5 ноября 2013 г.; Пересмотрено 20 мая 2014 г .; Принято 18 июня 2014 г.

Эта статья была процитирована другими статьями в PMC.

Abstract

Стафилококки являются важными патогенными бактериями, вызывающими различные инфекции у животных и человека. Гемолизин является одним из факторов вирулентности коагулазоположительных (КПС) и коагулазоотрицательных стафилококков (КНС). Цель исследования состояла в том, чтобы охарактеризовать гемолизины Staphylococcus spp. выделены от человека и крупного рогатого скота, фенотипически и генотипически. Характеристика гемолизина фенотипически на основе картины гемолиза Staphylococcus spp.проводили на чашках с овечьим, лошадиным и кроличьим кровяным агаром. Гены, кодирующие гемолизин, амплифицировали со специфическими праймерами с использованием метода полимеразной цепной реакции (ПЦР). Гемолитическая активность фенотипически определялась у 60 и 90% всех изолятов крупного рогатого скота и человека соответственно. Все негемолитические изоляты были ЦНС (P≤0,05). Во всех изолятах методом ПЦР определяли генов hla и hld . Ни один из бычьих и человеческих изолятов не показал фенотипически и генотипически гамма-гемолизин.Результаты этого исследования позволяют предположить, что, в соответствии с общепринятым мнением, существуют некоторые различия в типах гемолизина среди штаммов Staphylococcus бычьего и человеческого происхождения. Кроме того, это исследование показало, что ЦНС может быть важным в качестве новых патогенов.

Ключевые слова: Staphylococcus spp., гемолизин, изоляты человека и крупного рогатого скота, ПЦР

Введение

Стафилококки хорошо известны как бактериальные патогены, вызывающие множественные типы инфекций как у людей, так и у животных (Le Loir et al., 2003 ▶; Salasia et al., 2004 ▶). При диагностике инфекции стафилококки делятся на коагулазоположительные (CPS) и коагулазоотрицательные стафилококки (CNS) на основании способности коагулировать кроличью плазму. Как правило, Staphylococcus aureus является коагулазо-положительным, хотя встречаются и коагулазо-отрицательные изоляты S. aureus (Fox et al., 1996 ▶). Хотя S. aureus считается патогеном, наиболее часто выделяют ЦНС, особенно при гнойных инфекциях человека и субклиническом мастите у коров, овец и коз (Le Loir et al., 2003 ▶; Саласия и др., 2004 ▶; да Силва и др., 2005 ▶). Некоторые виды этого рода, особенно S. aureus , вызывают различные заболевания за счет продукции ряда ферментов и токсинов, инвазии клеток-хозяев, таких как гемолизины (da Silva et al., 2005 ▶). В настоящее время гемолизины стафилококков подразделяются на четыре различных типа, включая альфа (α), бета (β), гамма (γ) и дельта (δ) (Aarestrup et al., 1999 ▶). Альфа-токсин представляет собой гептамерный порообразующий экзотоксин, который лизирует преимущественно кроличьи эритроциты, но токсичен для эпителиальных клеток человека (Gouaux et al., 1994 ▶). Бета-гемолизин представляет собой сфингомиелиназу, обладающую высокой активностью в отношении эритроцитов овец и быков (Larsen et al., 2002 ▶). Бета-токсин также известен как «горячий-холодный» токсин из-за его уникальной активности на чашках с агаром с овечьей кровью. При 37°С бета-токсин взаимодействует с эритроцитами барана, но не лизирует их. Если эритроциты затем поместить при 4°C, клетки лизируются; это наблюдается как отсутствие гемолиза на чашках с кровяным агаром при 37°C, а затем полный гемолиз при 4°C (Huseby et al., 2007 ▶).Гамма-токсин представляет собой двухкомпонентный экзотоксин, содержащий не менее шести различных комбинаций белков, одной из которых является лейкоцидин, поражающий эритроциты лошади (Dinges et al., 2000 ▶). Дельта-токсин представляет собой низкомолекулярный экзотоксин, который образует мультимерные структуры со способностью лизировать многие типы клеток (Novick et al., 2003 ▶). Несколько исследований показали, что гемолизины S. aureus хорошо коррелируют с инфекциями у людей и животных (Tackeuchi et al., 2001 ▶; Larsen et al., 2002 ▶). Однако имеется мало информации о продукции гемолизинов ЦНС, выделенной при маститах животных и инфекциях человека, особенно в Иране. Генотипические различия между S. aureus , выделенными от человека и крупного рогатого скота, наблюдались многими авторами (Zadoks et al. , 2000 ▶; Reinoso et al., 2004 ▶). Одной из ключевых характеристик, используемых для различения штаммов человека и крупного рогатого скота, является характер гемолиза. Таким образом, сообщалось, что большинство изолятов CPS крупного рогатого скота продуцируют бета-гемолизин и являются вариабельными продуцентами альфа-гемолизина, в то время как большинство изолятов CPS человека продуцируют альфа-гемолизин, но лишь ограниченное число продуцирует бета-гемолизин (Hummel et al., 1992 ▶; Aarestrup et al., 1999 ▶). На сегодняшний день имеется мало информации о характере гемолиза в ЦНС. Таким образом, целью настоящего исследования было определение и сравнение встречаемости гемолитических стафилококков, выделенных от крупного рогатого скота и человека, как фенотипическими, так и генотипическими методами.

Кроме того, мы продемонстрировали гемолитическую способность ЦНС, выделенной от мастита животных и инфекций человека в Ширазе, на юге Ирана.

Материалы и методы

Бактериальные изоляты

Всего 40 Staphylococcus spp. выделены от инфекций человека (n=20) и коровьего мастита (n=20), а также 9 референтных штаммов (IROST) Staphylococcus spp. были использованы в настоящем исследовании. Образцы Staphylococcus spp. были получены из кожных инфекций пациентов в больнице Намази и маститного молока 20 молочных коров из 15 ферм, расположенных в Ширазе, на юге Ирана. Во-первых, различные изоляты были идентифицированы как CPS и CNS на основании окрашивания по Граму, теста на коагулазу и каталазу, восстановления теллурита, активности лецитиназы и ферментации маннита на маннит-солевом агаре (MSA).Кроме того, изоляты идентифицировали с помощью родовой ПЦР-амплификации гена 16S рРНК (данные не представлены).

Характеристика гемолизинов

Типы гемолизинов охарактеризованы по зоне лизиса каждого стафилококкового изолята на тройных чашках с кровяным агаром с добавлением 5% овечьей, лошадиной и кроличьей крови после 24 и 48 ч инкубации при 37°С. Чтобы удалить любые возможные антигемолизиновые соединения, присутствующие в сыворотке, эритроциты промывали стерильным физиологическим раствором и ресуспендировали в физиологическом растворе до исходного объема крови (Ebrahimi et al. , 2009 ▶). Гены, кодирующие гемолизины Staphylococcus spp. проводили путем амплификации генов hla , hlb , hld и hlg альфа-, бета-, дельта- и гамма-гемолизина с использованием метода ПЦР соответственно. Программы ПЦР и последовательности праймеров перечислены в .

Таблица 1

Таблица 1

Нуклеотидные последовательности, используемые в качестве праймеров для обнаружения генов гемолизена

MPHLG-2
Название праймера Последовательность (5-3) Целевой ген Температура отжига
(° C)
Размер изделия
(bp)
Артикул
HLA-1 CTGATTACTATCCAAGAAATTCGATTG хла 58 209 Жарро и др. ., 2002
HLA-2 CTTTTCAGCCCCTTTTTTTTATCAGT
HLB-1 GTGCacttactgacaatagtgtgctgct глб 58 309 Жарро и др., 2002
Эйч-2 GTTGATGAGTAGCTACCTTCAGT
ДВУ-1 AAGAATTTTTATCTTAATTAAGGAAGGAGTG холд 58 111 Жарро и др. ., 2002
HLD-2 TTAGTGAATTTTGTTCACTGTGTCGA
MPHLG-1 GTCAYAGAGTCCATATGCATTTAA глг 58 58 535 Jarraud et al ., 2002
CACLG-2 CACCAAATGTATAGCCTAAAGTG

Подготовка ДНК и ПЦР-анализ

Геномную ДНК бактерий экстрагировали из ночных культур изолятов с использованием процедуры, описанной ранее (Ahmadi et al. , 2010 ▶). Чистоту и концентрацию ДНК оценивали спектрофотометрически при 260 и 280 нм. После гена 16S рРНК была проведена ПЦР для идентификации Staphylococcus spp. и для обнаружения генов гемолизина, перечисленных в для каждого подтвержденного изолята. Амплификацию бактериальной ДНК проводили в общем реакционном объеме 25 мкл, содержащем 2 мкл матрицы ДНК из чистых культур. Реакционная смесь состояла из 2,5 мкл 10-кратного ПЦР-буфера (75 мМ Tris-HCl, pH 9,0, 2 мМ MgCl 2 , 50 мМ KCl, 20 мМ [NH 4 ] 2 SO 4 ), (CinnaGen, Иран), 1 мкл dNTP (50 мкМ), (CinnaGen), 1 мкл (1 ЕД ДНК-полимеразы Ampli Taq), (CinnaGen), 1 мкл (25 пмоль) прямого и обратного праймеров (CinnaGen), показано в , а объемы реакционных смесей достигали 25 мкл при использовании дистиллированной деионизированной воды.Матричную ДНК первоначально денатурировали при 94°С в течение 7 мин. В дальнейшем было проведено 35 циклов амплификации в программируемом термоциклере (MJ mini, BioRad, США). Каждый цикл состоял из денатурации в течение 1 мин при 94°С, отжига праймеров в течение 1 мин при 58°С и удлинения в течение 1 мин при 72°С. За последним циклом следовало окончательное удлинение при 72°С в течение 7 мин, после чего продукты ПЦР оставались в термоциклере при 4°С до их сбора. В каждый эксперимент был включен отрицательный контроль, содержащий воду.Продукты ПЦР разделяли электрофорезом в 1,5%-ном агарозном геле и визуализировали окрашиванием бромистым этидием и УФ-трансиллюминацией (BTS-20, Япония). В качестве маркера молекулярного размера использовали 100-пн ДНК-лестницу (CinnaGen, Иран).

Электрофорез в агарозном геле продуктов ПЦР генов гемолизина Staphylococcus spp. Дорожка M: ДНК-маркер длиной 100 п.н. (CinnaGen, Иран). Дорожка 1: отрицательный образец, дорожка 2: hla (209 п.н.), дорожка 3: hlb (309 п.н.), дорожка 4: hlg (535 п.н.) [нет положительного результата], и дорожка 5: hld (111 п.н.)

Статистический анализ

Для статистического анализа был проведен критерий хи-квадрат для анализа ассоциации генов гемолизина в образцах человека и крупного рогатого скота. Значение p ≤0,05 считалось статистически значимым.

Результаты

По результатам культуральных и биохимических свойств, а также амплификации 16S рРНК все исследованные в настоящем исследовании изоляты были идентифицированы как Staphylococcus . Всего 5 и 8 из 20 изолятов крупного рогатого скота и человека были CPS соответственно. Фенотипическая активность гемолизина обнаружена у 60 и 90% всех изолятов крупного рогатого скота и человека. Наличие негемолитических изолятов значительно отличалось среди ЦНС и ХПС, и все негемолитические изоляты принадлежали к ЦНС (P≤0.05). На чашках с агаром с овечьей кровью большинство Staphylococcus , выделенных от крупного рогатого скота, показали дельта-гемолизин, в то время как большинство изолятов человека продуцировали альфа-гемолизин. Из 20 изолятов человека 10 (50%) продуцировали двойной гемолизин (ДГ), но изоляты крупного рогатого скота показали значительно низкий коэффициент ДГ (1 из 20) (P≤0,05). Путем ПЦР-амплификации гена, кодирующего гемолизин Staphylococcus spp. со специфическими праймерами можно было наблюдать, что гены hla и hld присутствовали во всех изолятах.Также в сочетании с hla и hld ген hlb был обнаружен в 3 (15%) из 20 изолятов Staphylococcus , собранных от крупного рогатого скота, в 8 (40%) из 20 изолятов, собранных от крупного рогатого скота. люди, которые значительно отличались (P≤0,05), и 4 (44,4%) из 9 эталонных штаммов. Ни один из изолятов человека и крупного рогатого скота не обнаруживал фенотипически и генотипически гамма-гемолизин. Распределение различных генов гемолизина среди Staphylococcus spp.исследованных в настоящем исследовании показано в .

Таблица 2

Таблица 2

Характеристика гемолисанов Staphylococcus Штаммы

1 Бычий 9014 5 δ 90 145 NC
Штаммы Coagulase Test Фенотипическая характеристика
Генотипическая характеристика
Showing BA BA BA
S. saprophyticus PTCC 1440 NC NC NC α, δ
С.xylosus PTCC 1444 NC NC β α, β, δ
S. simulans PTCC 1442 δ δ β α, β, δ
S. chromogenes PTCC 1433 NC NC NC α, δ
S. intermedius PTCC 1438 + α α β α, β, δ
С.haemolyticus PTCC 1437 α α α α, δ
S. epidermidis PTCC 1436 α α β α, β, δ
S. sciuri PTCC 1441 δ δ δ α, δ
золотистого стафилококка PTCC 1764 + NC α α α, & delta;
NC NC NC α, & delta;
бычий 2 NC NC NC α, δ
бычий 3 δ δ δ α, δ
бычий 4 + NC α β α, β, δ
бычий 5 б б δ α, & delta;
бычий 6 NC NC NC α, δ
бычий 7 δ δ δ α, & delta;
бычьего 8 δ δ α, & delta;
Бычий 9 δ δ δ α, & delta;
бычьей 10 NC NC NC α, & delta;
бычьей 11 δ δ δ & alpha;, δ
бычий 12 + δ δ DH & alpha; , β, δ
Bovine 13 NC NC NC α, δ α, δ
Bovine 14 NC NC NC α, Δ
бычий 15 + NC α β α, β, δ
бычий 16 δ δ δ α, δ
Бычий 17 + NC δ δ α, & delta;
Бычий 18 + δ δ δ α, δ
Бычий 19 NC NC NC α, & delta;
бычий 20 NC NC NC α, δ
Человек 1 + NC α dh α, β, δ
человека 2 + NC α DH α, δ
человека 3 + α α DH α, β, δ
человека 4 + + NC α DH α, β, δ
человека 5 δ δ δ α, & delta;
Человека 6 NC α α α, & delta;
Человека 7 NC α DH α , δ
человека 8 α α α α α, δ
человека 9 NC NC NC α, δ
человека 10 α α α α α α человека 11 Δ δ Δ α, δ
δ δ δ α, & delta;
Человек 13 + NC α DH a, δ
Человек 14 + α DH α α, β, δ
человека 15 δ δ Δ α, β, δ
человека 16 NC α α α α α, β, Δ
человека 17 NC NC NC α, δ
Δ Δ Δ Δ δ α, δ
человека 19 NC NC α DH α, β, Δ
человека 20 + NC α DH α, β, δ

Обсуждение

Стафилококки чаще всего выделяют при маститах крупного рогатого скота и инфекциях человека. Болезни, вызванные этим родом, являются результатом синтеза нескольких факторов вирулентности, включая различные гемолизины, которые важны для вирулентности S. aureus и других стафилококков (da Silva et al., 2005 ▶). На сегодняшний день роль ЦНС как причины мастита крупного рогатого скота и инфекций человека и их гемолизиновых факторов до конца не ясна. Итак, в этом исследовании мы исследовали распределение четырех гемолизинов в изолятах ЦНС и ЦНС крупного рогатого скота и человека, фенотипически и генотипически.В этом исследовании, помимо образцов CPS (5 и 8 изолятов крупного рогатого скота и человека), использовали 15 и 12 образцов ЦНС, выделенных от инфекций крупного рогатого скота и человека. Мы обнаружили относительно большие различия в распространенности гемолизинов в изолятах Staphylococcus человека и крупного рогатого скота. Все выделенные CPS проявляли гемолитическую активность как по отдельности, так и в комбинированных формах, тогда как 25% штаммов CNS не были гемолитическими. Аналогичное исследование маститного козьего молока в бразильских молочных стадах показало высокие уровни одиночных или комбинированных типов гемолизина, продуцируемых S.aureus и ЦНС (da Silva et al., 2005 ▶). Аналогичные результаты были описаны Watts and Owens (1987) ▶ которые наблюдали выработку гемолизина S. xylosus и S. sciuri . Фенотипически большинство бычьих изолятов демонстрировали дельта-гемолиз на агаре с овечьей, лошадиной и кроличьей кровью, в то время как человеческие изоляты давали альфа-гемолиз, который, согласно многим исследованиям, показал различия между гемолизинами, продуцируемыми штаммом S. aureus , выделенным при мастите крупного рогатого скота, и от инфекции человека (Silva and Cardoso, 2000 ▶; Larsen et al., 2002 ▶). Тодар в 2005 году предположил, что большая часть S. aureus , выделенных от человека, обычно имеет бета-гемолитический характер, поскольку тромбоциты и моноциты человека более чувствительны к альфа-токсину, а большинство человеческих изолятов S. aureus не экспрессируют ß-токсин. Известно, что лизогенный бактериофаг кодирует токсин. CPS, выделенные от животных, в основном продуцируют охарактеризованный бета-токсин из-за чувствительности эритроцитов животных к этому токсину, но в этом исследовании большинство изолятов CNS крупного рогатого скота продуцировали дельта-гемолизин, что может быть связано с различиями в продукции гемотоксина у CNS и CPS. штаммы крупного рогатого скота.Кроме того, в этом исследовании двойной гемолизин, наблюдаемый у изолятов человека, был значительно выше, чем у изолятов крупного рогатого скота (P≤0,05). Возможно, это может указывать на то, что человеческие штаммы более патогенны, однако для подтверждения этой гипотезы необходимы дальнейшие исследования. Как показано на рисунке, все 49 CNS, CPS и эталонных штаммов, протестированных с помощью ПЦР, были положительными в отношении генов альфа- и дельта-гемолизина. Эти показатели встречаемости соответствуют данным других авторов (Silva and Cardoso, 2000 ▶; Larsen et al. , 2002 ▶; Эбрахими и др., 2009 ▶). Также в сочетании с альфа- и дельта бета-гемолизин наблюдался у 40% человеческих штаммов, что значительно выше, чем у бычьих изолятов (P≤0,05), что также подтверждает гипотезу о большей патогенности человеческих штаммов. В настоящем исследовании у всех изолятов отсутствовала экспрессия гамма-гемолизина. Генотипы гемолизина ЦНС и ЦПС в этом исследовании, по-видимому, не имели корреляции с экспрессией их фенотипов. На него могут влиять многие факторы на уровне генетики или фенотипа.

Существование генов hla и hld у S. aureus и CNS важно для этих изолятов, связанных со случаями стафилококковой инфекции, вызывающей заболевания животных и человека (Ariyanti et al., 2011 ▶). Это исследование показало, что гены hla и hld широко распространены среди S. aureus и ЦНС, выделенных у крупного рогатого скота и человека. Кроме того, результаты этого исследования позволяют предположить, что, в соответствии с общепринятым мнением, существуют некоторые различия в типах гемолизина среди штаммов Staphylococcus бычьего и человеческого происхождения. Кроме того, это исследование показало, что ЦНС продуцирует гемотоксины, и это может иметь важное значение в качестве нового патогена.

Благодарности

Работа выполнена при поддержке Школы ветеринарной медицины Ширазского университета, Иран. Кроме того, авторы хотели бы поблагодарить участников исследования за их вклад в исследование, а также нынешних и бывших исследователей и сотрудников. Авторы особенно хотели бы поблагодарить А. Шахед за лабораторную помощь.

Ссылки

  • Aarestrup, FM, Larsen, HD, Eriksen, NH, Elsberg, CS, Jensen, NE.Частота альфа- и бета-гемолизина у золотистого стафилококка крупного рогатого скота и человека. Сравнение между фено- и генотипом и изменением фенотипического выражения. . АПМИС. 1999;107:425–430. [PubMed] [Google Scholar]
  • Ahmadi, M, Rohani, SMR, Ayremlou, N. Обнаружение Staphylococcus aureus в молоке с помощью ПЦР. Комп. клин. Патол. 2010;19:91–94. [Google Scholar]
  • Ариянти Д., Саласия С.И.О., Тато С. Характеристика гемолизина золотистого стафилококка, выделенного из продуктов животного происхождения.Индонезийский J. biotech. 2011;16:32–37. [Google Scholar]
  • Da Silva, ER, Boechat, JUD, Martins, JCD, Ferreira, WPB, Siqueira, AP, da Silva, N. Производство гемолизина видами Staphylococcus aureus, выделенными из маститного козьего молока в бразильских молочных стадах. Маленький ром. Рез. 2005; 56: 271–275. [Google Scholar]
  • Динджес, М.М., Орвин, П.М., Шливерт, П.М. Экзотоксины золотистого стафилококка. клин. микробиол. 2000; 13:16–34. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Ebrahimi, A, Akhavan, TM.Характеристики стафилококков, выделенных от коров с клиническим и субклиническим маститом в Шахрекорде, Иран. Иранский Дж. Вет. Рез. 2009; 10: 273–277. [Google Scholar]
  • Фокс Л.К., Бессер Т.Е., Джексон С.М. Оценка коагулазонегативного варианта Staphylococcus aureus как причины внутригрудных инфекций в стаде молочного скота. Варенье. Вет. Мед. доц. 1996; 209:1143–1146. [PubMed] [Google Scholar]
  • Gouaux, JE, Braha, O, Hobaugh, MR, Song, L, Cheley, S, Shustak, C, Bayley, H.Субъединичная стехиометрия стафилококкового альфа-гемолизина в кристаллах и на мембранах: гептамерная трансмембранная пора. проц. Натл. акад. науч. США. 1994; 91:12828–12831. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Hummel, R, Devriese, LA, Lehmann, G. Характеристики бычьего Staphylococcus aureus с особым учетом активности фактора слипания. Междунар. Дж. Мед. микробиол. Вирол. Паразитол. Заразить. Дис. 1992; 276: 487–492. [PubMed] [Google Scholar]
  • Хасеби, М., Ши, К., Браун, К.К., Дигре, Дж., Менгисту, Ф., Сео, К.С., Бохач, Г.А., Шливерт, П.М., Олендорф, Д.Х., Эрхарт, Калифорния.Структура и биологическая активность бета-токсина золотистого стафилококка. Дж. Бактериол. 2007; 189:8719–8726. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Jarraud, S, Mougel, C, Thioulouse, J, Lina, G, Meugnier, H, Forey, F, Nesme, X, Etienne, J, Vandenesch, F. Взаимосвязь между генетическим фоном золотистого стафилококка, факторами вирулентности, группами agr (аллелями) и заболеванием человека. Заразить. Иммун. 2002; 70: 631–641. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Larsen, HD, Aarestrup, FM, Jensen, NE.Географическая изменчивость в присутствии генов, кодирующих суперантигенные экзотоксины и бета-гемолизин, среди золотистого стафилококка, выделенного при мастите крупного рогатого скота в Европе и США. Вет. микробиол. 2002; 85: 61–67. [PubMed] [Google Scholar]
  • Le Loir, Y, Baron, F, Gautier, M. Staphylococcus aureus и пищевое отравление. Жене. Мол. Рез. 2003; 2: 63–76. [PubMed] [Google Scholar]
  • Novick, RP. Автоиндукция и сигнальная трансдукция в регуляции вирулентности стафилококков. Мол. микробиол.2003; 48: 1429–1449. [PubMed] [Google Scholar]
  • Reinoso, E, Bettera, S, Frigerio, C, DiRenzo, M, Calzolari, A, Bogni, C. RAPD-ПЦР-анализ штаммов Staphylococcus aureus, выделенных из бычьих и человеческих хозяев. микробиол. Рез. 2004; 159: 245–255. [PubMed] [Google Scholar]
  • Salasia, SIO, Khusnan, Z, Lämmler, C, Zschöck, M. Сравнительные исследования фено- и генотипических свойств Staphylococcus aureus, выделенного из коровьего субклинического мастита в Центральной Яве в Индонезии и Гессе в Германия.Дж. Вет. науч. 2004; 5: 103–109. [PubMed] [Google Scholar]
  • Сильва, Нда, Кардосо, HFT. Производство гемолитических токсинов с помощью изолятов Staphylococcus aureus, выделяемых при мастите крупного рогатого скота. Вет. Новости. 2000; 6: 63–67. [Google Scholar]
  • Такеучи С., Маэда Т., Хашимото Н., Имаидзуми К., Кайдох Т., Хаякава Ю. Вариации локуса agr в изолятах Staphylococcusaureus от коров, больных маститом. Вет. микробиол. 2001; 79: 267–274. [PubMed] [Google Scholar]
  • Тодар, К. Тодар Онлайн-учебник по бактериологии.Стафилококк. Кафедра бактериологии, Университет Винкосин-Мэдисон; 2055. www.textbookofbacteriology.net/staph.html. [Google Scholar]
  • Watts, JL, Owens, WE. Синергетический гемолиз, связанный с коагулазонегативными стафилококками, выделенными из бычьих молочных желез. Дж. Клин. микробиол. 1987; 25:2037–2039. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Zadoks, R, van Leeuwen, W, Barkema, H, Sampimon, O, Verbrugh, H, Schukken, Y, van Belkum, A. Применение геля импульсного поля электрофорез и бинарное типирование как инструменты ветеринарной клинической микробиологии и молекулярно-эпидемиологического анализа изолятов золотистого стафилококка крупного рогатого скота и человека.Дж. Клин. микробиол. 2000; 38: 1931–1939. [Бесплатная статья PMC] [PubMed] [Google Scholar]

Характеристика гемолизинов штаммов стафилококков, выделенных из человека и крупного рогатого скота, южный Иран

Iran J Vet Res. 2014 Осень; 15(4): 326–330.

Z Moraveji

1 DVM Студент факультета ветеринарной медицины Ширазского университета, Шираз, Иран;

M Tabatabaei

2 Кафедра патобиологии, Школа ветеринарной медицины и Институт биотехнологии, Ширазский университет, Шираз, Иран;

Х Ширзад Аски

3 Тел. D. Студент бактериологии, кафедра патобиологии, школа ветеринарной медицины, Ширазский университет, Шираз, Иран;

R Khoshbakht

4 Окончил Школу ветеринарной медицины Ширазского университета, Шираз, Иран

1 Студент DVM, Факультет ветеринарной медицины, Ширазский университет, Шираз, Иран;

2 Кафедра патобиологии, Школа ветеринарной медицины и Институт биотехнологии, Ширазский университет, Шираз, Иран;

3 Тел.D. Студент бактериологии, кафедра патобиологии, школа ветеринарной медицины, Ширазский университет, Шираз, Иран;

4 Окончил факультет ветеринарной медицины Ширазского университета, Шираз, Иран

* Для переписки: М. Табатабаи, кафедра патобиологии, факультет ветеринарной медицины, Ширазский университет, Шираз, Иран. Электронная почта: [email protected]

Поступила в редакцию 5 ноября 2013 г.; Пересмотрено 20 мая 2014 г .; Принято 18 июня 2014 г.

Эта статья была процитирована другими статьями в PMC.

Abstract

Стафилококки являются важными патогенными бактериями, вызывающими различные инфекции у животных и человека. Гемолизин является одним из факторов вирулентности коагулазоположительных (КПС) и коагулазоотрицательных стафилококков (КНС). Цель исследования состояла в том, чтобы охарактеризовать гемолизины Staphylococcus spp. выделены от человека и крупного рогатого скота, фенотипически и генотипически. Характеристика гемолизина фенотипически на основе картины гемолиза Staphylococcus spp.проводили на чашках с овечьим, лошадиным и кроличьим кровяным агаром. Гены, кодирующие гемолизин, амплифицировали со специфическими праймерами с использованием метода полимеразной цепной реакции (ПЦР). Гемолитическая активность фенотипически определялась у 60 и 90% всех изолятов крупного рогатого скота и человека соответственно. Все негемолитические изоляты были ЦНС (P≤0,05). Во всех изолятах методом ПЦР определяли генов hla и hld . Ни один из бычьих и человеческих изолятов не показал фенотипически и генотипически гамма-гемолизин.Результаты этого исследования позволяют предположить, что, в соответствии с общепринятым мнением, существуют некоторые различия в типах гемолизина среди штаммов Staphylococcus бычьего и человеческого происхождения. Кроме того, это исследование показало, что ЦНС может быть важным в качестве новых патогенов.

Ключевые слова: Staphylococcus spp., гемолизин, изоляты человека и крупного рогатого скота, ПЦР

Введение

Стафилококки хорошо известны как бактериальные патогены, вызывающие множественные типы инфекций как у людей, так и у животных (Le Loir et al., 2003 ▶; Salasia et al., 2004 ▶). При диагностике инфекции стафилококки делятся на коагулазоположительные (CPS) и коагулазоотрицательные стафилококки (CNS) на основании способности коагулировать кроличью плазму. Как правило, Staphylococcus aureus является коагулазо-положительным, хотя встречаются и коагулазо-отрицательные изоляты S. aureus (Fox et al., 1996 ▶). Хотя S. aureus считается патогеном, наиболее часто выделяют ЦНС, особенно при гнойных инфекциях человека и субклиническом мастите у коров, овец и коз (Le Loir et al., 2003 ▶; Саласия и др., 2004 ▶; да Силва и др., 2005 ▶). Некоторые виды этого рода, особенно S. aureus , вызывают различные заболевания за счет продукции ряда ферментов и токсинов, инвазии клеток-хозяев, таких как гемолизины (da Silva et al., 2005 ▶). В настоящее время гемолизины стафилококков подразделяются на четыре различных типа, включая альфа (α), бета (β), гамма (γ) и дельта (δ) (Aarestrup et al., 1999 ▶). Альфа-токсин представляет собой гептамерный порообразующий экзотоксин, который лизирует преимущественно кроличьи эритроциты, но токсичен для эпителиальных клеток человека (Gouaux et al., 1994 ▶). Бета-гемолизин представляет собой сфингомиелиназу, обладающую высокой активностью в отношении эритроцитов овец и быков (Larsen et al., 2002 ▶). Бета-токсин также известен как «горячий-холодный» токсин из-за его уникальной активности на чашках с агаром с овечьей кровью. При 37°С бета-токсин взаимодействует с эритроцитами барана, но не лизирует их. Если эритроциты затем поместить при 4°C, клетки лизируются; это наблюдается как отсутствие гемолиза на чашках с кровяным агаром при 37°C, а затем полный гемолиз при 4°C (Huseby et al., 2007 ▶).Гамма-токсин представляет собой двухкомпонентный экзотоксин, содержащий не менее шести различных комбинаций белков, одной из которых является лейкоцидин, поражающий эритроциты лошади (Dinges et al., 2000 ▶). Дельта-токсин представляет собой низкомолекулярный экзотоксин, который образует мультимерные структуры со способностью лизировать многие типы клеток (Novick et al., 2003 ▶). Несколько исследований показали, что гемолизины S. aureus хорошо коррелируют с инфекциями у людей и животных (Tackeuchi et al., 2001 ▶; Larsen et al., 2002 ▶). Однако имеется мало информации о продукции гемолизинов ЦНС, выделенной при маститах животных и инфекциях человека, особенно в Иране. Генотипические различия между S. aureus , выделенными от человека и крупного рогатого скота, наблюдались многими авторами (Zadoks et al. , 2000 ▶; Reinoso et al., 2004 ▶). Одной из ключевых характеристик, используемых для различения штаммов человека и крупного рогатого скота, является характер гемолиза. Таким образом, сообщалось, что большинство изолятов CPS крупного рогатого скота продуцируют бета-гемолизин и являются вариабельными продуцентами альфа-гемолизина, в то время как большинство изолятов CPS человека продуцируют альфа-гемолизин, но лишь ограниченное число продуцирует бета-гемолизин (Hummel et al., 1992 ▶; Aarestrup et al., 1999 ▶). На сегодняшний день имеется мало информации о характере гемолиза в ЦНС. Таким образом, целью настоящего исследования было определение и сравнение встречаемости гемолитических стафилококков, выделенных от крупного рогатого скота и человека, как фенотипическими, так и генотипическими методами.

Кроме того, мы продемонстрировали гемолитическую способность ЦНС, выделенной от мастита животных и инфекций человека в Ширазе, на юге Ирана.

Материалы и методы

Бактериальные изоляты

Всего 40 Staphylococcus spp. выделены от инфекций человека (n=20) и коровьего мастита (n=20), а также 9 референтных штаммов (IROST) Staphylococcus spp. были использованы в настоящем исследовании. Образцы Staphylococcus spp. были получены из кожных инфекций пациентов в больнице Намази и маститного молока 20 молочных коров из 15 ферм, расположенных в Ширазе, на юге Ирана. Во-первых, различные изоляты были идентифицированы как CPS и CNS на основании окрашивания по Граму, теста на коагулазу и каталазу, восстановления теллурита, активности лецитиназы и ферментации маннита на маннит-солевом агаре (MSA).Кроме того, изоляты идентифицировали с помощью родовой ПЦР-амплификации гена 16S рРНК (данные не представлены).

Характеристика гемолизинов

Типы гемолизинов охарактеризованы по зоне лизиса каждого стафилококкового изолята на тройных чашках с кровяным агаром с добавлением 5% овечьей, лошадиной и кроличьей крови после 24 и 48 ч инкубации при 37°С. Чтобы удалить любые возможные антигемолизиновые соединения, присутствующие в сыворотке, эритроциты промывали стерильным физиологическим раствором и ресуспендировали в физиологическом растворе до исходного объема крови (Ebrahimi et al. , 2009 ▶). Гены, кодирующие гемолизины Staphylococcus spp. проводили путем амплификации генов hla , hlb , hld и hlg альфа-, бета-, дельта- и гамма-гемолизина с использованием метода ПЦР соответственно. Программы ПЦР и последовательности праймеров перечислены в .

Таблица 1

Таблица 1

Нуклеотидные последовательности, используемые в качестве праймеров для обнаружения генов гемолизена

MPHLG-2
Название праймера Последовательность (5-3) Целевой ген Температура отжига
(° C)
Размер изделия
(bp)
Артикул
HLA-1 CTGATTACTATCCAAGAAATTCGATTG хла 58 209 Жарро и др. ., 2002
HLA-2 CTTTTCAGCCCCTTTTTTTTATCAGT
HLB-1 GTGCacttactgacaatagtgtgctgct глб 58 309 Жарро и др., 2002
Эйч-2 GTTGATGAGTAGCTACCTTCAGT
ДВУ-1 AAGAATTTTTATCTTAATTAAGGAAGGAGTG холд 58 111 Жарро и др. ., 2002
HLD-2 TTAGTGAATTTTGTTCACTGTGTCGA
MPHLG-1 GTCAYAGAGTCCATATGCATTTAA глг 58 58 535 Jarraud et al ., 2002
CACLG-2 CACCAAATGTATAGCCTAAAGTG

Подготовка ДНК и ПЦР-анализ

Геномную ДНК бактерий экстрагировали из ночных культур изолятов с использованием процедуры, описанной ранее (Ahmadi et al. , 2010 ▶). Чистоту и концентрацию ДНК оценивали спектрофотометрически при 260 и 280 нм. После гена 16S рРНК была проведена ПЦР для идентификации Staphylococcus spp. и для обнаружения генов гемолизина, перечисленных в для каждого подтвержденного изолята. Амплификацию бактериальной ДНК проводили в общем реакционном объеме 25 мкл, содержащем 2 мкл матрицы ДНК из чистых культур. Реакционная смесь состояла из 2,5 мкл 10-кратного ПЦР-буфера (75 мМ Tris-HCl, pH 9,0, 2 мМ MgCl 2 , 50 мМ KCl, 20 мМ [NH 4 ] 2 SO 4 ), (CinnaGen, Иран), 1 мкл dNTP (50 мкМ), (CinnaGen), 1 мкл (1 ЕД ДНК-полимеразы Ampli Taq), (CinnaGen), 1 мкл (25 пмоль) прямого и обратного праймеров (CinnaGen), показано в , а объемы реакционных смесей достигали 25 мкл при использовании дистиллированной деионизированной воды.Матричную ДНК первоначально денатурировали при 94°С в течение 7 мин. В дальнейшем было проведено 35 циклов амплификации в программируемом термоциклере (MJ mini, BioRad, США). Каждый цикл состоял из денатурации в течение 1 мин при 94°С, отжига праймеров в течение 1 мин при 58°С и удлинения в течение 1 мин при 72°С. За последним циклом следовало окончательное удлинение при 72°С в течение 7 мин, после чего продукты ПЦР оставались в термоциклере при 4°С до их сбора. В каждый эксперимент был включен отрицательный контроль, содержащий воду.Продукты ПЦР разделяли электрофорезом в 1,5%-ном агарозном геле и визуализировали окрашиванием бромистым этидием и УФ-трансиллюминацией (BTS-20, Япония). В качестве маркера молекулярного размера использовали 100-пн ДНК-лестницу (CinnaGen, Иран).

Электрофорез в агарозном геле продуктов ПЦР генов гемолизина Staphylococcus spp. Дорожка M: ДНК-маркер длиной 100 п.н. (CinnaGen, Иран). Дорожка 1: отрицательный образец, дорожка 2: hla (209 п.н.), дорожка 3: hlb (309 п.н.), дорожка 4: hlg (535 п.н.) [нет положительного результата], и дорожка 5: hld (111 п.н.)

Статистический анализ

Для статистического анализа был проведен критерий хи-квадрат для анализа ассоциации генов гемолизина в образцах человека и крупного рогатого скота. Значение p ≤0,05 считалось статистически значимым.

Результаты

По результатам культуральных и биохимических свойств, а также амплификации 16S рРНК все исследованные в настоящем исследовании изоляты были идентифицированы как Staphylococcus . Всего 5 и 8 из 20 изолятов крупного рогатого скота и человека были CPS соответственно. Фенотипическая активность гемолизина обнаружена у 60 и 90% всех изолятов крупного рогатого скота и человека. Наличие негемолитических изолятов значительно отличалось среди ЦНС и ХПС, и все негемолитические изоляты принадлежали к ЦНС (P≤0.05). На чашках с агаром с овечьей кровью большинство Staphylococcus , выделенных от крупного рогатого скота, показали дельта-гемолизин, в то время как большинство изолятов человека продуцировали альфа-гемолизин. Из 20 изолятов человека 10 (50%) продуцировали двойной гемолизин (ДГ), но изоляты крупного рогатого скота показали значительно низкий коэффициент ДГ (1 из 20) (P≤0,05). Путем ПЦР-амплификации гена, кодирующего гемолизин Staphylococcus spp. со специфическими праймерами можно было наблюдать, что гены hla и hld присутствовали во всех изолятах.Также в сочетании с hla и hld ген hlb был обнаружен в 3 (15%) из 20 изолятов Staphylococcus , собранных от крупного рогатого скота, в 8 (40%) из 20 изолятов, собранных от крупного рогатого скота. люди, которые значительно отличались (P≤0,05), и 4 (44,4%) из 9 эталонных штаммов. Ни один из изолятов человека и крупного рогатого скота не обнаруживал фенотипически и генотипически гамма-гемолизин. Распределение различных генов гемолизина среди Staphylococcus spp.исследованных в настоящем исследовании показано в .

Таблица 2

Таблица 2

Характеристика гемолисанов Staphylococcus Штаммы

1 Бычий 9014 5 δ 90 145 NC
Штаммы Coagulase Test Фенотипическая характеристика
Генотипическая характеристика
Showing BA BA BA
S. saprophyticus PTCC 1440 NC NC NC α, δ
С.xylosus PTCC 1444 NC NC β α, β, δ
S. simulans PTCC 1442 δ δ β α, β, δ
S. chromogenes PTCC 1433 NC NC NC α, δ
S. intermedius PTCC 1438 + α α β α, β, δ
С.haemolyticus PTCC 1437 α α α α, δ
S. epidermidis PTCC 1436 α α β α, β, δ
S. sciuri PTCC 1441 δ δ δ α, δ
золотистого стафилококка PTCC 1764 + NC α α α, & delta;
NC NC NC α, & delta;
бычий 2 NC NC NC α, δ
бычий 3 δ δ δ α, δ
бычий 4 + NC α β α, β, δ
бычий 5 б б δ α, & delta;
бычий 6 NC NC NC α, δ
бычий 7 δ δ δ α, & delta;
бычьего 8 δ δ α, & delta;
Бычий 9 δ δ δ α, & delta;
бычьей 10 NC NC NC α, & delta;
бычьей 11 δ δ δ & alpha;, δ
бычий 12 + δ δ DH & alpha; , β, δ
Bovine 13 NC NC NC α, δ α, δ
Bovine 14 NC NC NC α, Δ
бычий 15 + NC α β α, β, δ
бычий 16 δ δ δ α, δ
Бычий 17 + NC δ δ α, & delta;
Бычий 18 + δ δ δ α, δ
Бычий 19 NC NC NC α, & delta;
бычий 20 NC NC NC α, δ
Человек 1 + NC α dh α, β, δ
человека 2 + NC α DH α, δ
человека 3 + α α DH α, β, δ
человека 4 + + NC α DH α, β, δ
человека 5 δ δ δ α, & delta;
Человека 6 NC α α α, & delta;
Человека 7 NC α DH α , δ
человека 8 α α α α α, δ
человека 9 NC NC NC α, δ
человека 10 α α α α α α человека 11 Δ δ Δ α, δ
δ δ δ α, & delta;
Человек 13 + NC α DH a, δ
Человек 14 + α DH α α, β, δ
человека 15 δ δ Δ α, β, δ
человека 16 NC α α α α α, β, Δ
человека 17 NC NC NC α, δ
Δ Δ Δ Δ δ α, δ
человека 19 NC NC α DH α, β, Δ
человека 20 + NC α DH α, β, δ

Обсуждение

Стафилококки чаще всего выделяют при маститах крупного рогатого скота и инфекциях человека. Болезни, вызванные этим родом, являются результатом синтеза нескольких факторов вирулентности, включая различные гемолизины, которые важны для вирулентности S. aureus и других стафилококков (da Silva et al., 2005 ▶). На сегодняшний день роль ЦНС как причины мастита крупного рогатого скота и инфекций человека и их гемолизиновых факторов до конца не ясна. Итак, в этом исследовании мы исследовали распределение четырех гемолизинов в изолятах ЦНС и ЦНС крупного рогатого скота и человека, фенотипически и генотипически.В этом исследовании, помимо образцов CPS (5 и 8 изолятов крупного рогатого скота и человека), использовали 15 и 12 образцов ЦНС, выделенных от инфекций крупного рогатого скота и человека. Мы обнаружили относительно большие различия в распространенности гемолизинов в изолятах Staphylococcus человека и крупного рогатого скота. Все выделенные CPS проявляли гемолитическую активность как по отдельности, так и в комбинированных формах, тогда как 25% штаммов CNS не были гемолитическими. Аналогичное исследование маститного козьего молока в бразильских молочных стадах показало высокие уровни одиночных или комбинированных типов гемолизина, продуцируемых S.aureus и ЦНС (da Silva et al., 2005 ▶). Аналогичные результаты были описаны Watts and Owens (1987) ▶ которые наблюдали выработку гемолизина S. xylosus и S. sciuri . Фенотипически большинство бычьих изолятов демонстрировали дельта-гемолиз на агаре с овечьей, лошадиной и кроличьей кровью, в то время как человеческие изоляты давали альфа-гемолиз, который, согласно многим исследованиям, показал различия между гемолизинами, продуцируемыми штаммом S. aureus , выделенным при мастите крупного рогатого скота, и от инфекции человека (Silva and Cardoso, 2000 ▶; Larsen et al., 2002 ▶). Тодар в 2005 году предположил, что большая часть S. aureus , выделенных от человека, обычно имеет бета-гемолитический характер, поскольку тромбоциты и моноциты человека более чувствительны к альфа-токсину, а большинство человеческих изолятов S. aureus не экспрессируют ß-токсин. Известно, что лизогенный бактериофаг кодирует токсин. CPS, выделенные от животных, в основном продуцируют охарактеризованный бета-токсин из-за чувствительности эритроцитов животных к этому токсину, но в этом исследовании большинство изолятов CNS крупного рогатого скота продуцировали дельта-гемолизин, что может быть связано с различиями в продукции гемотоксина у CNS и CPS. штаммы крупного рогатого скота.Кроме того, в этом исследовании двойной гемолизин, наблюдаемый у изолятов человека, был значительно выше, чем у изолятов крупного рогатого скота (P≤0,05). Возможно, это может указывать на то, что человеческие штаммы более патогенны, однако для подтверждения этой гипотезы необходимы дальнейшие исследования. Как показано на рисунке, все 49 CNS, CPS и эталонных штаммов, протестированных с помощью ПЦР, были положительными в отношении генов альфа- и дельта-гемолизина. Эти показатели встречаемости соответствуют данным других авторов (Silva and Cardoso, 2000 ▶; Larsen et al. , 2002 ▶; Эбрахими и др., 2009 ▶). Также в сочетании с альфа- и дельта бета-гемолизин наблюдался у 40% человеческих штаммов, что значительно выше, чем у бычьих изолятов (P≤0,05), что также подтверждает гипотезу о большей патогенности человеческих штаммов. В настоящем исследовании у всех изолятов отсутствовала экспрессия гамма-гемолизина. Генотипы гемолизина ЦНС и ЦПС в этом исследовании, по-видимому, не имели корреляции с экспрессией их фенотипов. На него могут влиять многие факторы на уровне генетики или фенотипа.

Существование генов hla и hld у S. aureus и CNS важно для этих изолятов, связанных со случаями стафилококковой инфекции, вызывающей заболевания животных и человека (Ariyanti et al., 2011 ▶). Это исследование показало, что гены hla и hld широко распространены среди S. aureus и ЦНС, выделенных у крупного рогатого скота и человека. Кроме того, результаты этого исследования позволяют предположить, что, в соответствии с общепринятым мнением, существуют некоторые различия в типах гемолизина среди штаммов Staphylococcus бычьего и человеческого происхождения. Кроме того, это исследование показало, что ЦНС продуцирует гемотоксины, и это может иметь важное значение в качестве нового патогена.

Благодарности

Работа выполнена при поддержке Школы ветеринарной медицины Ширазского университета, Иран. Кроме того, авторы хотели бы поблагодарить участников исследования за их вклад в исследование, а также нынешних и бывших исследователей и сотрудников. Авторы особенно хотели бы поблагодарить А. Шахед за лабораторную помощь.

Ссылки

  • Aarestrup, FM, Larsen, HD, Eriksen, NH, Elsberg, CS, Jensen, NE.Частота альфа- и бета-гемолизина у золотистого стафилококка крупного рогатого скота и человека. Сравнение между фено- и генотипом и изменением фенотипического выражения. . АПМИС. 1999;107:425–430. [PubMed] [Google Scholar]
  • Ahmadi, M, Rohani, SMR, Ayremlou, N. Обнаружение Staphylococcus aureus в молоке с помощью ПЦР. Комп. клин. Патол. 2010;19:91–94. [Google Scholar]
  • Ариянти Д., Саласия С.И.О., Тато С. Характеристика гемолизина золотистого стафилококка, выделенного из продуктов животного происхождения.Индонезийский J. biotech. 2011;16:32–37. [Google Scholar]
  • Da Silva, ER, Boechat, JUD, Martins, JCD, Ferreira, WPB, Siqueira, AP, da Silva, N. Производство гемолизина видами Staphylococcus aureus, выделенными из маститного козьего молока в бразильских молочных стадах. Маленький ром. Рез. 2005; 56: 271–275. [Google Scholar]
  • Динджес, М.М., Орвин, П.М., Шливерт, П.М. Экзотоксины золотистого стафилококка. клин. микробиол. 2000; 13:16–34. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Ebrahimi, A, Akhavan, TM.Характеристики стафилококков, выделенных от коров с клиническим и субклиническим маститом в Шахрекорде, Иран. Иранский Дж. Вет. Рез. 2009; 10: 273–277. [Google Scholar]
  • Фокс Л.К., Бессер Т.Е., Джексон С.М. Оценка коагулазонегативного варианта Staphylococcus aureus как причины внутригрудных инфекций в стаде молочного скота. Варенье. Вет. Мед. доц. 1996; 209:1143–1146. [PubMed] [Google Scholar]
  • Gouaux, JE, Braha, O, Hobaugh, MR, Song, L, Cheley, S, Shustak, C, Bayley, H.Субъединичная стехиометрия стафилококкового альфа-гемолизина в кристаллах и на мембранах: гептамерная трансмембранная пора. проц. Натл. акад. науч. США. 1994; 91:12828–12831. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Hummel, R, Devriese, LA, Lehmann, G. Характеристики бычьего Staphylococcus aureus с особым учетом активности фактора слипания. Междунар. Дж. Мед. микробиол. Вирол. Паразитол. Заразить. Дис. 1992; 276: 487–492. [PubMed] [Google Scholar]
  • Хасеби, М., Ши, К., Браун, К.К., Дигре, Дж., Менгисту, Ф., Сео, К.С., Бохач, Г.А., Шливерт, П.М., Олендорф, Д.Х., Эрхарт, Калифорния.Структура и биологическая активность бета-токсина золотистого стафилококка. Дж. Бактериол. 2007; 189:8719–8726. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Jarraud, S, Mougel, C, Thioulouse, J, Lina, G, Meugnier, H, Forey, F, Nesme, X, Etienne, J, Vandenesch, F. Взаимосвязь между генетическим фоном золотистого стафилококка, факторами вирулентности, группами agr (аллелями) и заболеванием человека. Заразить. Иммун. 2002; 70: 631–641. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Larsen, HD, Aarestrup, FM, Jensen, NE.Географическая изменчивость в присутствии генов, кодирующих суперантигенные экзотоксины и бета-гемолизин, среди золотистого стафилококка, выделенного при мастите крупного рогатого скота в Европе и США. Вет. микробиол. 2002; 85: 61–67. [PubMed] [Google Scholar]
  • Le Loir, Y, Baron, F, Gautier, M. Staphylococcus aureus и пищевое отравление. Жене. Мол. Рез. 2003; 2: 63–76. [PubMed] [Google Scholar]
  • Novick, RP. Автоиндукция и сигнальная трансдукция в регуляции вирулентности стафилококков. Мол. микробиол.2003; 48: 1429–1449. [PubMed] [Google Scholar]
  • Reinoso, E, Bettera, S, Frigerio, C, DiRenzo, M, Calzolari, A, Bogni, C. RAPD-ПЦР-анализ штаммов Staphylococcus aureus, выделенных из бычьих и человеческих хозяев. микробиол. Рез. 2004; 159: 245–255. [PubMed] [Google Scholar]
  • Salasia, SIO, Khusnan, Z, Lämmler, C, Zschöck, M. Сравнительные исследования фено- и генотипических свойств Staphylococcus aureus, выделенного из коровьего субклинического мастита в Центральной Яве в Индонезии и Гессе в Германия.Дж. Вет. науч. 2004; 5: 103–109. [PubMed] [Google Scholar]
  • Сильва, Нда, Кардосо, HFT. Производство гемолитических токсинов с помощью изолятов Staphylococcus aureus, выделяемых при мастите крупного рогатого скота. Вет. Новости. 2000; 6: 63–67. [Google Scholar]
  • Такеучи С., Маэда Т., Хашимото Н., Имаидзуми К., Кайдох Т., Хаякава Ю. Вариации локуса agr в изолятах Staphylococcusaureus от коров, больных маститом. Вет. микробиол. 2001; 79: 267–274. [PubMed] [Google Scholar]
  • Тодар, К. Тодар Онлайн-учебник по бактериологии.Стафилококк. Кафедра бактериологии, Университет Винкосин-Мэдисон; 2055. www.textbookofbacteriology.net/staph.html. [Google Scholar]
  • Watts, JL, Owens, WE. Синергетический гемолиз, связанный с коагулазонегативными стафилококками, выделенными из бычьих молочных желез. Дж. Клин. микробиол. 1987; 25:2037–2039. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Zadoks, R, van Leeuwen, W, Barkema, H, Sampimon, O, Verbrugh, H, Schukken, Y, van Belkum, A. Применение геля импульсного поля электрофорез и бинарное типирование как инструменты ветеринарной клинической микробиологии и молекулярно-эпидемиологического анализа изолятов золотистого стафилококка крупного рогатого скота и человека.Дж. Клин. микробиол. 2000; 38: 1931–1939. [Бесплатная статья PMC] [PubMed] [Google Scholar]

Характеристика гемолизинов штаммов стафилококков, выделенных из человека и крупного рогатого скота, южный Иран

Iran J Vet Res. 2014 Осень; 15(4): 326–330.

Z Moraveji

1 DVM Студент факультета ветеринарной медицины Ширазского университета, Шираз, Иран;

M Tabatabaei

2 Кафедра патобиологии, Школа ветеринарной медицины и Институт биотехнологии, Ширазский университет, Шираз, Иран;

Х Ширзад Аски

3 Тел. D. Студент бактериологии, кафедра патобиологии, школа ветеринарной медицины, Ширазский университет, Шираз, Иран;

R Khoshbakht

4 Окончил Школу ветеринарной медицины Ширазского университета, Шираз, Иран

1 Студент DVM, Факультет ветеринарной медицины, Ширазский университет, Шираз, Иран;

2 Кафедра патобиологии, Школа ветеринарной медицины и Институт биотехнологии, Ширазский университет, Шираз, Иран;

3 Тел.D. Студент бактериологии, кафедра патобиологии, школа ветеринарной медицины, Ширазский университет, Шираз, Иран;

4 Окончил факультет ветеринарной медицины Ширазского университета, Шираз, Иран

* Для переписки: М. Табатабаи, кафедра патобиологии, факультет ветеринарной медицины, Ширазский университет, Шираз, Иран. Электронная почта: [email protected]

Поступила в редакцию 5 ноября 2013 г.; Пересмотрено 20 мая 2014 г .; Принято 18 июня 2014 г.

Эта статья была процитирована другими статьями в PMC.

Abstract

Стафилококки являются важными патогенными бактериями, вызывающими различные инфекции у животных и человека. Гемолизин является одним из факторов вирулентности коагулазоположительных (КПС) и коагулазоотрицательных стафилококков (КНС). Цель исследования состояла в том, чтобы охарактеризовать гемолизины Staphylococcus spp. выделены от человека и крупного рогатого скота, фенотипически и генотипически. Характеристика гемолизина фенотипически на основе картины гемолиза Staphylococcus spp.проводили на чашках с овечьим, лошадиным и кроличьим кровяным агаром. Гены, кодирующие гемолизин, амплифицировали со специфическими праймерами с использованием метода полимеразной цепной реакции (ПЦР). Гемолитическая активность фенотипически определялась у 60 и 90% всех изолятов крупного рогатого скота и человека соответственно. Все негемолитические изоляты были ЦНС (P≤0,05). Во всех изолятах методом ПЦР определяли генов hla и hld . Ни один из бычьих и человеческих изолятов не показал фенотипически и генотипически гамма-гемолизин.Результаты этого исследования позволяют предположить, что, в соответствии с общепринятым мнением, существуют некоторые различия в типах гемолизина среди штаммов Staphylococcus бычьего и человеческого происхождения. Кроме того, это исследование показало, что ЦНС может быть важным в качестве новых патогенов.

Ключевые слова: Staphylococcus spp., гемолизин, изоляты человека и крупного рогатого скота, ПЦР

Введение

Стафилококки хорошо известны как бактериальные патогены, вызывающие множественные типы инфекций как у людей, так и у животных (Le Loir et al., 2003 ▶; Salasia et al., 2004 ▶). При диагностике инфекции стафилококки делятся на коагулазоположительные (CPS) и коагулазоотрицательные стафилококки (CNS) на основании способности коагулировать кроличью плазму. Как правило, Staphylococcus aureus является коагулазо-положительным, хотя встречаются и коагулазо-отрицательные изоляты S. aureus (Fox et al., 1996 ▶). Хотя S. aureus считается патогеном, наиболее часто выделяют ЦНС, особенно при гнойных инфекциях человека и субклиническом мастите у коров, овец и коз (Le Loir et al., 2003 ▶; Саласия и др., 2004 ▶; да Силва и др., 2005 ▶). Некоторые виды этого рода, особенно S. aureus , вызывают различные заболевания за счет продукции ряда ферментов и токсинов, инвазии клеток-хозяев, таких как гемолизины (da Silva et al., 2005 ▶). В настоящее время гемолизины стафилококков подразделяются на четыре различных типа, включая альфа (α), бета (β), гамма (γ) и дельта (δ) (Aarestrup et al., 1999 ▶). Альфа-токсин представляет собой гептамерный порообразующий экзотоксин, который лизирует преимущественно кроличьи эритроциты, но токсичен для эпителиальных клеток человека (Gouaux et al., 1994 ▶). Бета-гемолизин представляет собой сфингомиелиназу, обладающую высокой активностью в отношении эритроцитов овец и быков (Larsen et al., 2002 ▶). Бета-токсин также известен как «горячий-холодный» токсин из-за его уникальной активности на чашках с агаром с овечьей кровью. При 37°С бета-токсин взаимодействует с эритроцитами барана, но не лизирует их. Если эритроциты затем поместить при 4°C, клетки лизируются; это наблюдается как отсутствие гемолиза на чашках с кровяным агаром при 37°C, а затем полный гемолиз при 4°C (Huseby et al., 2007 ▶).Гамма-токсин представляет собой двухкомпонентный экзотоксин, содержащий не менее шести различных комбинаций белков, одной из которых является лейкоцидин, поражающий эритроциты лошади (Dinges et al., 2000 ▶). Дельта-токсин представляет собой низкомолекулярный экзотоксин, который образует мультимерные структуры со способностью лизировать многие типы клеток (Novick et al., 2003 ▶). Несколько исследований показали, что гемолизины S. aureus хорошо коррелируют с инфекциями у людей и животных (Tackeuchi et al., 2001 ▶; Larsen et al., 2002 ▶). Однако имеется мало информации о продукции гемолизинов ЦНС, выделенной при маститах животных и инфекциях человека, особенно в Иране. Генотипические различия между S. aureus , выделенными от человека и крупного рогатого скота, наблюдались многими авторами (Zadoks et al. , 2000 ▶; Reinoso et al., 2004 ▶). Одной из ключевых характеристик, используемых для различения штаммов человека и крупного рогатого скота, является характер гемолиза. Таким образом, сообщалось, что большинство изолятов CPS крупного рогатого скота продуцируют бета-гемолизин и являются вариабельными продуцентами альфа-гемолизина, в то время как большинство изолятов CPS человека продуцируют альфа-гемолизин, но лишь ограниченное число продуцирует бета-гемолизин (Hummel et al., 1992 ▶; Aarestrup et al., 1999 ▶). На сегодняшний день имеется мало информации о характере гемолиза в ЦНС. Таким образом, целью настоящего исследования было определение и сравнение встречаемости гемолитических стафилококков, выделенных от крупного рогатого скота и человека, как фенотипическими, так и генотипическими методами.

Кроме того, мы продемонстрировали гемолитическую способность ЦНС, выделенной от мастита животных и инфекций человека в Ширазе, на юге Ирана.

Материалы и методы

Бактериальные изоляты

Всего 40 Staphylococcus spp. выделены от инфекций человека (n=20) и коровьего мастита (n=20), а также 9 референтных штаммов (IROST) Staphylococcus spp. были использованы в настоящем исследовании. Образцы Staphylococcus spp. были получены из кожных инфекций пациентов в больнице Намази и маститного молока 20 молочных коров из 15 ферм, расположенных в Ширазе, на юге Ирана. Во-первых, различные изоляты были идентифицированы как CPS и CNS на основании окрашивания по Граму, теста на коагулазу и каталазу, восстановления теллурита, активности лецитиназы и ферментации маннита на маннит-солевом агаре (MSA).Кроме того, изоляты идентифицировали с помощью родовой ПЦР-амплификации гена 16S рРНК (данные не представлены).

Характеристика гемолизинов

Типы гемолизинов охарактеризованы по зоне лизиса каждого стафилококкового изолята на тройных чашках с кровяным агаром с добавлением 5% овечьей, лошадиной и кроличьей крови после 24 и 48 ч инкубации при 37°С. Чтобы удалить любые возможные антигемолизиновые соединения, присутствующие в сыворотке, эритроциты промывали стерильным физиологическим раствором и ресуспендировали в физиологическом растворе до исходного объема крови (Ebrahimi et al. , 2009 ▶). Гены, кодирующие гемолизины Staphylococcus spp. проводили путем амплификации генов hla , hlb , hld и hlg альфа-, бета-, дельта- и гамма-гемолизина с использованием метода ПЦР соответственно. Программы ПЦР и последовательности праймеров перечислены в .

Таблица 1

Таблица 1

Нуклеотидные последовательности, используемые в качестве праймеров для обнаружения генов гемолизена

MPHLG-2
Название праймера Последовательность (5-3) Целевой ген Температура отжига
(° C)
Размер изделия
(bp)
Артикул
HLA-1 CTGATTACTATCCAAGAAATTCGATTG хла 58 209 Жарро и др. ., 2002
HLA-2 CTTTTCAGCCCCTTTTTTTTATCAGT
HLB-1 GTGCacttactgacaatagtgtgctgct глб 58 309 Жарро и др., 2002
Эйч-2 GTTGATGAGTAGCTACCTTCAGT
ДВУ-1 AAGAATTTTTATCTTAATTAAGGAAGGAGTG холд 58 111 Жарро и др. ., 2002
HLD-2 TTAGTGAATTTTGTTCACTGTGTCGA
MPHLG-1 GTCAYAGAGTCCATATGCATTTAA глг 58 58 535 Jarraud et al ., 2002
CACLG-2 CACCAAATGTATAGCCTAAAGTG

Подготовка ДНК и ПЦР-анализ

Геномную ДНК бактерий экстрагировали из ночных культур изолятов с использованием процедуры, описанной ранее (Ahmadi et al. , 2010 ▶). Чистоту и концентрацию ДНК оценивали спектрофотометрически при 260 и 280 нм. После гена 16S рРНК была проведена ПЦР для идентификации Staphylococcus spp. и для обнаружения генов гемолизина, перечисленных в для каждого подтвержденного изолята. Амплификацию бактериальной ДНК проводили в общем реакционном объеме 25 мкл, содержащем 2 мкл матрицы ДНК из чистых культур. Реакционная смесь состояла из 2,5 мкл 10-кратного ПЦР-буфера (75 мМ Tris-HCl, pH 9,0, 2 мМ MgCl 2 , 50 мМ KCl, 20 мМ [NH 4 ] 2 SO 4 ), (CinnaGen, Иран), 1 мкл dNTP (50 мкМ), (CinnaGen), 1 мкл (1 ЕД ДНК-полимеразы Ampli Taq), (CinnaGen), 1 мкл (25 пмоль) прямого и обратного праймеров (CinnaGen), показано в , а объемы реакционных смесей достигали 25 мкл при использовании дистиллированной деионизированной воды.Матричную ДНК первоначально денатурировали при 94°С в течение 7 мин. В дальнейшем было проведено 35 циклов амплификации в программируемом термоциклере (MJ mini, BioRad, США). Каждый цикл состоял из денатурации в течение 1 мин при 94°С, отжига праймеров в течение 1 мин при 58°С и удлинения в течение 1 мин при 72°С. За последним циклом следовало окончательное удлинение при 72°С в течение 7 мин, после чего продукты ПЦР оставались в термоциклере при 4°С до их сбора. В каждый эксперимент был включен отрицательный контроль, содержащий воду.Продукты ПЦР разделяли электрофорезом в 1,5%-ном агарозном геле и визуализировали окрашиванием бромистым этидием и УФ-трансиллюминацией (BTS-20, Япония). В качестве маркера молекулярного размера использовали 100-пн ДНК-лестницу (CinnaGen, Иран).

Электрофорез в агарозном геле продуктов ПЦР генов гемолизина Staphylococcus spp. Дорожка M: ДНК-маркер длиной 100 п.н. (CinnaGen, Иран). Дорожка 1: отрицательный образец, дорожка 2: hla (209 п.н.), дорожка 3: hlb (309 п.н.), дорожка 4: hlg (535 п.н.) [нет положительного результата], и дорожка 5: hld (111 п.н.)

Статистический анализ

Для статистического анализа был проведен критерий хи-квадрат для анализа ассоциации генов гемолизина в образцах человека и крупного рогатого скота. Значение p ≤0,05 считалось статистически значимым.

Результаты

По результатам культуральных и биохимических свойств, а также амплификации 16S рРНК все исследованные в настоящем исследовании изоляты были идентифицированы как Staphylococcus . Всего 5 и 8 из 20 изолятов крупного рогатого скота и человека были CPS соответственно. Фенотипическая активность гемолизина обнаружена у 60 и 90% всех изолятов крупного рогатого скота и человека. Наличие негемолитических изолятов значительно отличалось среди ЦНС и ХПС, и все негемолитические изоляты принадлежали к ЦНС (P≤0.05). На чашках с агаром с овечьей кровью большинство Staphylococcus , выделенных от крупного рогатого скота, показали дельта-гемолизин, в то время как большинство изолятов человека продуцировали альфа-гемолизин. Из 20 изолятов человека 10 (50%) продуцировали двойной гемолизин (ДГ), но изоляты крупного рогатого скота показали значительно низкий коэффициент ДГ (1 из 20) (P≤0,05). Путем ПЦР-амплификации гена, кодирующего гемолизин Staphylococcus spp. со специфическими праймерами можно было наблюдать, что гены hla и hld присутствовали во всех изолятах.Также в сочетании с hla и hld ген hlb был обнаружен в 3 (15%) из 20 изолятов Staphylococcus , собранных от крупного рогатого скота, в 8 (40%) из 20 изолятов, собранных от крупного рогатого скота. люди, которые значительно отличались (P≤0,05), и 4 (44,4%) из 9 эталонных штаммов. Ни один из изолятов человека и крупного рогатого скота не обнаруживал фенотипически и генотипически гамма-гемолизин. Распределение различных генов гемолизина среди Staphylococcus spp.исследованных в настоящем исследовании показано в .

Таблица 2

Таблица 2

Характеристика гемолисанов Staphylococcus Штаммы

1 Бычий 9014 5 δ 90 145 NC
Штаммы Coagulase Test Фенотипическая характеристика
Генотипическая характеристика
Showing BA BA BA
S. saprophyticus PTCC 1440 NC NC NC α, δ
С.xylosus PTCC 1444 NC NC β α, β, δ
S. simulans PTCC 1442 δ δ β α, β, δ
S. chromogenes PTCC 1433 NC NC NC α, δ
S. intermedius PTCC 1438 + α α β α, β, δ
С.haemolyticus PTCC 1437 α α α α, δ
S. epidermidis PTCC 1436 α α β α, β, δ
S. sciuri PTCC 1441 δ δ δ α, δ
золотистого стафилококка PTCC 1764 + NC α α α, & delta;
NC NC NC α, & delta;
бычий 2 NC NC NC α, δ
бычий 3 δ δ δ α, δ
бычий 4 + NC α β α, β, δ
бычий 5 б б δ α, & delta;
бычий 6 NC NC NC α, δ
бычий 7 δ δ δ α, & delta;
бычьего 8 δ δ α, & delta;
Бычий 9 δ δ δ α, & delta;
бычьей 10 NC NC NC α, & delta;
бычьей 11 δ δ δ & alpha;, δ
бычий 12 + δ δ DH & alpha; , β, δ
Bovine 13 NC NC NC α, δ α, δ
Bovine 14 NC NC NC α, Δ
бычий 15 + NC α β α, β, δ
бычий 16 δ δ δ α, δ
Бычий 17 + NC δ δ α, & delta;
Бычий 18 + δ δ δ α, δ
Бычий 19 NC NC NC α, & delta;
бычий 20 NC NC NC α, δ
Человек 1 + NC α dh α, β, δ
человека 2 + NC α DH α, δ
человека 3 + α α DH α, β, δ
человека 4 + + NC α DH α, β, δ
человека 5 δ δ δ α, & delta;
Человека 6 NC α α α, & delta;
Человека 7 NC α DH α , δ
человека 8 α α α α α, δ
человека 9 NC NC NC α, δ
человека 10 α α α α α α человека 11 Δ δ Δ α, δ
δ δ δ α, & delta;
Человек 13 + NC α DH a, δ
Человек 14 + α DH α α, β, δ
человека 15 δ δ Δ α, β, δ
человека 16 NC α α α α α, β, Δ
человека 17 NC NC NC α, δ
Δ Δ Δ Δ δ α, δ
человека 19 NC NC α DH α, β, Δ
человека 20 + NC α DH α, β, δ

Обсуждение

Стафилококки чаще всего выделяют при маститах крупного рогатого скота и инфекциях человека. Болезни, вызванные этим родом, являются результатом синтеза нескольких факторов вирулентности, включая различные гемолизины, которые важны для вирулентности S. aureus и других стафилококков (da Silva et al., 2005 ▶). На сегодняшний день роль ЦНС как причины мастита крупного рогатого скота и инфекций человека и их гемолизиновых факторов до конца не ясна. Итак, в этом исследовании мы исследовали распределение четырех гемолизинов в изолятах ЦНС и ЦНС крупного рогатого скота и человека, фенотипически и генотипически.В этом исследовании, помимо образцов CPS (5 и 8 изолятов крупного рогатого скота и человека), использовали 15 и 12 образцов ЦНС, выделенных от инфекций крупного рогатого скота и человека. Мы обнаружили относительно большие различия в распространенности гемолизинов в изолятах Staphylococcus человека и крупного рогатого скота. Все выделенные CPS проявляли гемолитическую активность как по отдельности, так и в комбинированных формах, тогда как 25% штаммов CNS не были гемолитическими. Аналогичное исследование маститного козьего молока в бразильских молочных стадах показало высокие уровни одиночных или комбинированных типов гемолизина, продуцируемых S.aureus и ЦНС (da Silva et al., 2005 ▶). Аналогичные результаты были описаны Watts and Owens (1987) ▶ которые наблюдали выработку гемолизина S. xylosus и S. sciuri . Фенотипически большинство бычьих изолятов демонстрировали дельта-гемолиз на агаре с овечьей, лошадиной и кроличьей кровью, в то время как человеческие изоляты давали альфа-гемолиз, который, согласно многим исследованиям, показал различия между гемолизинами, продуцируемыми штаммом S. aureus , выделенным при мастите крупного рогатого скота, и от инфекции человека (Silva and Cardoso, 2000 ▶; Larsen et al., 2002 ▶). Тодар в 2005 году предположил, что большая часть S. aureus , выделенных от человека, обычно имеет бета-гемолитический характер, поскольку тромбоциты и моноциты человека более чувствительны к альфа-токсину, а большинство человеческих изолятов S. aureus не экспрессируют ß-токсин. Известно, что лизогенный бактериофаг кодирует токсин. CPS, выделенные от животных, в основном продуцируют охарактеризованный бета-токсин из-за чувствительности эритроцитов животных к этому токсину, но в этом исследовании большинство изолятов CNS крупного рогатого скота продуцировали дельта-гемолизин, что может быть связано с различиями в продукции гемотоксина у CNS и CPS. штаммы крупного рогатого скота.Кроме того, в этом исследовании двойной гемолизин, наблюдаемый у изолятов человека, был значительно выше, чем у изолятов крупного рогатого скота (P≤0,05). Возможно, это может указывать на то, что человеческие штаммы более патогенны, однако для подтверждения этой гипотезы необходимы дальнейшие исследования. Как показано на рисунке, все 49 CNS, CPS и эталонных штаммов, протестированных с помощью ПЦР, были положительными в отношении генов альфа- и дельта-гемолизина. Эти показатели встречаемости соответствуют данным других авторов (Silva and Cardoso, 2000 ▶; Larsen et al. , 2002 ▶; Эбрахими и др., 2009 ▶). Также в сочетании с альфа- и дельта бета-гемолизин наблюдался у 40% человеческих штаммов, что значительно выше, чем у бычьих изолятов (P≤0,05), что также подтверждает гипотезу о большей патогенности человеческих штаммов. В настоящем исследовании у всех изолятов отсутствовала экспрессия гамма-гемолизина. Генотипы гемолизина ЦНС и ЦПС в этом исследовании, по-видимому, не имели корреляции с экспрессией их фенотипов. На него могут влиять многие факторы на уровне генетики или фенотипа.

Существование генов hla и hld у S. aureus и CNS важно для этих изолятов, связанных со случаями стафилококковой инфекции, вызывающей заболевания животных и человека (Ariyanti et al., 2011 ▶). Это исследование показало, что гены hla и hld широко распространены среди S. aureus и ЦНС, выделенных у крупного рогатого скота и человека. Кроме того, результаты этого исследования позволяют предположить, что, в соответствии с общепринятым мнением, существуют некоторые различия в типах гемолизина среди штаммов Staphylococcus бычьего и человеческого происхождения. Кроме того, это исследование показало, что ЦНС продуцирует гемотоксины, и это может иметь важное значение в качестве нового патогена.

Благодарности

Работа выполнена при поддержке Школы ветеринарной медицины Ширазского университета, Иран. Кроме того, авторы хотели бы поблагодарить участников исследования за их вклад в исследование, а также нынешних и бывших исследователей и сотрудников. Авторы особенно хотели бы поблагодарить А. Шахед за лабораторную помощь.

Ссылки

  • Aarestrup, FM, Larsen, HD, Eriksen, NH, Elsberg, CS, Jensen, NE.Частота альфа- и бета-гемолизина у золотистого стафилококка крупного рогатого скота и человека. Сравнение между фено- и генотипом и изменением фенотипического выражения. . АПМИС. 1999;107:425–430. [PubMed] [Google Scholar]
  • Ahmadi, M, Rohani, SMR, Ayremlou, N. Обнаружение Staphylococcus aureus в молоке с помощью ПЦР. Комп. клин. Патол. 2010;19:91–94. [Google Scholar]
  • Ариянти Д., Саласия С.И.О., Тато С. Характеристика гемолизина золотистого стафилококка, выделенного из продуктов животного происхождения.Индонезийский J. biotech. 2011;16:32–37. [Google Scholar]
  • Da Silva, ER, Boechat, JUD, Martins, JCD, Ferreira, WPB, Siqueira, AP, da Silva, N. Производство гемолизина видами Staphylococcus aureus, выделенными из маститного козьего молока в бразильских молочных стадах. Маленький ром. Рез. 2005; 56: 271–275. [Google Scholar]
  • Динджес, М.М., Орвин, П.М., Шливерт, П.М. Экзотоксины золотистого стафилококка. клин. микробиол. 2000; 13:16–34. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Ebrahimi, A, Akhavan, TM.Характеристики стафилококков, выделенных от коров с клиническим и субклиническим маститом в Шахрекорде, Иран. Иранский Дж. Вет. Рез. 2009; 10: 273–277. [Google Scholar]
  • Фокс Л.К., Бессер Т.Е., Джексон С.М. Оценка коагулазонегативного варианта Staphylococcus aureus как причины внутригрудных инфекций в стаде молочного скота. Варенье. Вет. Мед. доц. 1996; 209:1143–1146. [PubMed] [Google Scholar]
  • Gouaux, JE, Braha, O, Hobaugh, MR, Song, L, Cheley, S, Shustak, C, Bayley, H.Субъединичная стехиометрия стафилококкового альфа-гемолизина в кристаллах и на мембранах: гептамерная трансмембранная пора. проц. Натл. акад. науч. США. 1994; 91:12828–12831. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Hummel, R, Devriese, LA, Lehmann, G. Характеристики бычьего Staphylococcus aureus с особым учетом активности фактора слипания. Междунар. Дж. Мед. микробиол. Вирол. Паразитол. Заразить. Дис. 1992; 276: 487–492. [PubMed] [Google Scholar]
  • Хасеби, М., Ши, К., Браун, К.К., Дигре, Дж., Менгисту, Ф., Сео, К.С., Бохач, Г.А., Шливерт, П.М., Олендорф, Д.Х., Эрхарт, Калифорния.Структура и биологическая активность бета-токсина золотистого стафилококка. Дж. Бактериол. 2007; 189:8719–8726. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Jarraud, S, Mougel, C, Thioulouse, J, Lina, G, Meugnier, H, Forey, F, Nesme, X, Etienne, J, Vandenesch, F. Взаимосвязь между генетическим фоном золотистого стафилококка, факторами вирулентности, группами agr (аллелями) и заболеванием человека. Заразить. Иммун. 2002; 70: 631–641. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Larsen, HD, Aarestrup, FM, Jensen, NE.Географическая изменчивость в присутствии генов, кодирующих суперантигенные экзотоксины и бета-гемолизин, среди золотистого стафилококка, выделенного при мастите крупного рогатого скота в Европе и США. Вет. микробиол. 2002; 85: 61–67. [PubMed] [Google Scholar]
  • Le Loir, Y, Baron, F, Gautier, M. Staphylococcus aureus и пищевое отравление. Жене. Мол. Рез. 2003; 2: 63–76. [PubMed] [Google Scholar]
  • Novick, RP. Автоиндукция и сигнальная трансдукция в регуляции вирулентности стафилококков. Мол. микробиол.2003; 48: 1429–1449. [PubMed] [Google Scholar]
  • Reinoso, E, Bettera, S, Frigerio, C, DiRenzo, M, Calzolari, A, Bogni, C. RAPD-ПЦР-анализ штаммов Staphylococcus aureus, выделенных из бычьих и человеческих хозяев. микробиол. Рез. 2004; 159: 245–255. [PubMed] [Google Scholar]
  • Salasia, SIO, Khusnan, Z, Lämmler, C, Zschöck, M. Сравнительные исследования фено- и генотипических свойств Staphylococcus aureus, выделенного из коровьего субклинического мастита в Центральной Яве в Индонезии и Гессе в Германия.Дж. Вет. науч. 2004; 5: 103–109. [PubMed] [Google Scholar]
  • Сильва, Нда, Кардосо, HFT. Производство гемолитических токсинов с помощью изолятов Staphylococcus aureus, выделяемых при мастите крупного рогатого скота. Вет. Новости. 2000; 6: 63–67. [Google Scholar]
  • Такеучи С., Маэда Т., Хашимото Н., Имаидзуми К., Кайдох Т., Хаякава Ю. Вариации локуса agr в изолятах Staphylococcusaureus от коров, больных маститом. Вет. микробиол. 2001; 79: 267–274. [PubMed] [Google Scholar]
  • Тодар, К. Тодар Онлайн-учебник по бактериологии.Стафилококк. Кафедра бактериологии, Университет Винкосин-Мэдисон; 2055. www.textbookofbacteriology.net/staph.html. [Google Scholar]
  • Watts, JL, Owens, WE. Синергетический гемолиз, связанный с коагулазонегативными стафилококками, выделенными из бычьих молочных желез. Дж. Клин. микробиол. 1987; 25:2037–2039. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Zadoks, R, van Leeuwen, W, Barkema, H, Sampimon, O, Verbrugh, H, Schukken, Y, van Belkum, A. Применение геля импульсного поля электрофорез и бинарное типирование как инструменты ветеринарной клинической микробиологии и молекулярно-эпидемиологического анализа изолятов золотистого стафилококка крупного рогатого скота и человека.Дж. Клин. микробиол. 2000; 38: 1931–1939. [Бесплатная статья PMC] [PubMed] [Google Scholar]

Пластины с кровяным агаром и гемолиз: Staphylococcus

Скачать PowerPoint

Содержание PowerPoint

Рис. 1. Крупные кремово-белые бета-гемолитические колонии, типичные для Staphylococcus aureus. (Ребекка Бакстон, Университет штата Юта, Солт-Лейк-Сити, Юта)

Рис. 2. Крупные кремово-белые бета-гемолитические колонии, типичные для Staphylococcus aureus. (Ребекка Бакстон, Университет штата Юта, Солт-Лейк-Сити, Юта)

Рис. 3. Крупные кремово-белые бета-гемолитические колонии, типичные для Staphylococcus aureus. (Ребекка Бакстон, Университет штата Юта, Солт-Лейк-Сити, Юта)

Рис. 4. Крупные кремово-белые бета-гемолитические колонии, типичные для Staphylococcus aureus. (Ребекка Бакстон, Университет штата Юта, Солт-Лейк-Сити, Юта)

Рисунок 5: Штаммы Staphylococcus aureus могут продуцировать или не продуцировать золотисто-желтый пигмент.(бета-гемолитический, беспигментный штамм. Сравните с рис. 6). (Ребекка Бакстон, Университет штата Юта, Солт-Лейк-Сити, Юта)

Рисунок 6: Штаммы Staphylococcus aureus могут продуцировать или не продуцировать золотисто-желтый пигмент. (бета-гемолитический штамм с желтым пигментом. Сравните с рис. 5). (Ребекка Бакстон, Университет штата Юта, Солт-Лейк-Сити, Юта)

Рисунок 7: Негемолитические виды стафилококков: Staphylococcus epidermidis. (Большинство видов коагулазоотрицательных стафилококков не являются гемолитическими). (Ребекка Бакстон, Университет штата Юта, Солт-Лейк-Сити, Юта)

Рисунок 8: Негемолитические виды стафилококков: Staphylococcus epidermidis. (Ребекка Бакстон, Университет штата Юта, Солт-Лейк-Сити, Юта)

Рисунок 9: Негемолитические виды стафилококков: Staphylococcus epidermidis. (Ребекка Бакстон, Университет штата Юта, Солт-Лейк-Сити, Юта)

Рисунок 10: Staphylococcus saprophyticus: негемолитические, ярко-белые, кремовые колонии (выявляются почти исключительно при инфекциях мочевыводящих путей у молодых сексуально активных женщин).(Ребекка Бакстон, Университет штата Юта, Солт-Лейк-Сити, Юта)

Рисунок 11: Micrococcus luteus: выраженный ярко-желтый пигмент (без гемолиза). (Ребекка Бакстон, Университет штата Юта, Солт-Лейк-Сити, Юта)

чашек с кровяным агаром | Резюме биохимических тестов | Дополнительная информация | Molb 2021

Модели гемолиза

Это дифференциальная среда. Это богатая комплексная среда, содержащая 5% эритроцитов барана. BAP проверяет способность организма вырабатывать гемолизины, ферменты, которые повреждают/лизируют эритроциты.Степень гемолиза этими гемолизинами помогает дифференцировать представителей родов Staphylococcus , Streptococcus и Enterococcus .

  • Бета-гемолиз — это полный гемолиз. Для него характерна четкая (прозрачная) зона, окружающая колонии. Staphylococcus aureus , Streptococcus pyogenes и Streptococcus agalactiae являются b-гемолитиками (на рисунке справа внизу показан бета-гемолиз pyogenes ).

  • Частичный гемолиз называется альфа-гемолизом. Колонии обычно окружены зеленой непрозрачной зоной. Streptococcus pneumoniae и Streptococcus mitis являются а-гемолитическими (на рисунке в центре ниже показан а-гемолиз S. mitis ).

  • Если гемолиз не происходит, это называется гамма-гемолизом. Вокруг колоний нет заметных зон. Staphylococcus epidermidis является гамма-гемолитиком.

Гамма-гемолиз Альфа-гемолиз Бета-гемолиз

Техника полосового удара

Часто при инокуляции БАТ для наблюдения за характером гемолиза исследователи также несколько раз прокалывают агар, используя инокуляционную петлю. Этот укол позволяет обнаружить стрептолизин O, специфический гемолизин, продуцируемый Streptococcus pyogenes .Этот гемолизин инактивируется O 2  и виден только под поверхностью (в анаэробной среде) вокруг следа от укола. Обратите внимание на овальные участки расчистки вокруг следов укола на картинке ниже; они вызваны стрептолизином О.

Лаборатория DM 13

Лаборатория DM 13

I. ВВЕДЕНИЕ

Нормальная флора слизистых оболочек человека включает в себя представителей a разновидность грамположительных кокков.Два важных рода, Staphylococcus и Стрептококки представлены в сегодняшнем лабораторном упражнении.

А. СТАФИЛОКОКК

Род Staphylococcus по большей части состоит из двух заслуживающих внимания видов: Staphylococcus aureus и Staphylococcus epidermidis . S. aureus является основным возбудителя и может вызывать нагноение, абсцедирование, различные гнойные инфекции и даже смертельный сепсис. S. epidermidis нормально непатогенный но может вызвать заболевание при определенных условиях. Стафилококки продуцируют фермент каталаза , что отличает их от стрептококков, которых нет. По определению, штаммы стафилококков, продуцирующие фермент коагулазу , относятся к S. aureus , что отличает их от всех других стафилококков, которые этого не делают. Большинство штаммы S.aureus образуют недиффундирующий золотисто-желтый пигмент и зону чистый бета-гемолиз на агаре с кровью. Непатогенные штаммы стафилококков обычно образуют белые или сероватые колонии и коагулазоотрицательны. Они могут быть гемолитическим, но обычно не являются.

Б. СТРЕПТОКОК

Род Streptococcus содержит множество видов, считающихся патогенными. Стрептококки, вероятно, вызывают большее разнообразие типов клинических заболеваний, чем любые другой род.Наиболее часто выделяемыми и/или наиболее вирулентными штаммами стрептококков являются:

  • Стрептококк группы А ( Streptococcus pyogenes ). Эти бета-гемолитический, и чувствительны к бацитрацину; вызывают септицемию, импетиго, фарингит, острый гломерулонефрит (АГН), ревматизм, раневые инфекции и др.
  • Стрептококк группы B ( Streptococcus agalactiae ).Это бета-гемолитические, устойчивые к бацитрацину, положительный тест на цАМФ, и они являются основной причиной послеродовой сепсис и неонатальный менингит. Этот организм обычно выделены из половых путей женщины.
  • Стрептококк группы C . Это бета-гемолитические, устойчивые к бацитрацину, цАМФ тест отрицательный и часто является осложняющим фактором раневых инфекций.
  • Стрептококк группы D .Обычно это альфа или гамма, и обычно они находятся в кишечного тракта. Есть две подгруппы, разделенные на основе сопротивления к высоким концентрациям солей.
    • Энтерококки группы D : могут расти при высоких (6,5%) концентрациях соли.
    • Группа D Неэнтерококки : не могут расти в 6,5% соли
  • Streptococcus pneumoniae представляет собой овальный диплококк, оптохин чувствительный, а- гемолитической и вызывает пневмонию, раневые инфекции, менингит, септицемию и средний отит у детей.

Способность гемолизировать эритроциты различается у разных видов рода Streptococcus , и это первый признак, наблюдаемый при классификации видов. То гемолитические реакции стрептококков на агаре с овечьей кровью (БАП):

  • АЛЬФА-ГЕМОЛИЗ — зеленоватое окрашивание кровяного агара в зона вокруг или под колониями. Слово «вириданс» означает зеленый, и эти а-гемолитические стрептококки часто называют «вириданами». стрептококки.
  • БЕТА-ГЕМОЛИЗ — полный лизис эритроцитов в зоне вокруг отдельные колонии. В этой зоне среда становится почти прозрачный.
  • ГАММА-ГЕМОЛИЗ — отсутствие реакции (отсутствие видимых изменений вокруг отдельные колонии). Гемолиз не производится.

II. ЛАБОРАТОРНАЯ РАБОТА

Поставляемые материалы: (работа индивидуально)
  • 1 пластина с кровяным агаром (BAP) с 1 неизвестным стафилококком
  • 1 БАТ с 1 стрептококком неизвестно
  • 1 чашка с агаром с желчью и эскулином ( розовая точка )
  • 1 6.5% бульон NaCl ( зеленая крышка )
  • 1 БАТ (разделен маркерной линией на 2 части)
  • 1 Пробирка с кроличьей плазмой ( фиолетовая крышка )
  • 1 чашка Петри с дисками дифференцировки А (бацитрацин) и Р (оптохин)
  • 1 пробирка Staphylococcus aureus (в бульоне для теста CAMP) ( желтый колпачок )
  • 1 флакон 3% перекиси водорода (h3O2)
Процедура:
  1. У каждого ученика свой:
    • Staphylococcus неизвестный кодовый номер,
    • Streptococcus неизвестный кодовый номер.
  2. Каждый студент:
    • должен подготовить окраску по Граму своего Staphylococcus и Стрептококк неизвестно.
    • должен провести тест на каталазу на своем Staphylococcus и Стрептококк неизвестно. Это позволит определить, что есть что.
    • должен провести тест на коагулазу на своем стафилококке неизвестно.
    • должен сделать прививку своему Streptococcus неизвестно подходящим пластины, как описано ниже.
    • должен определить гемолиз у его/ее Streptococcus unknown и при необходимости настройте тест на чувствительность к бацитрацину или оптохину. (Если этот тест проводится на неизвестный стафилококк, баллы будут вычитается.)

КАТАЛАЗНЫЙ ТЕСТ:
Каталазный тест позволяет различать группы микроорганизмов на основе производство каталазы.Этот тест стабильно положительный на стафилококки и отрицательный для стрептококков. Каталаза — фермент, расщепляющий перекись водорода на воду и кислород. Высвобожденный кислород виден в виде крошечных пузырьков.
  1. Возьмите 1 или 2 изолированные колонии стерильной петлей и нанесите на слайд. Не добавляйте солевой раствор. Не включайте агар; клетки крови имеют каталазы в них.
  2. Добавьте в мазок 1 каплю 3% перекиси водорода и найдите интенсивное выделение пузырьков.Пузырьки указывают на положительную реакцию на каталазу.
    РОД КАТАЛАЗНАЯ РЕАКЦИЯ
    Streptococcus Без пузырьков (без каталазы)
    Staphylococcus Пузырьки (присутствует каталаза)

ТЕСТ НА КОАГУЛАЗУ:
Тест на коагулазу является наиболее надежным индикатором патогенных, токсинопродуцирующих штаммы стафилококка, т.д., для золотистого стафилококка. Наиболее патогенные штаммы Стафилококки продуцируют простафилокоагулазу, которая реагирует с активатором, подобным протромбин, с образованием активного свертывающего агента, коагулазы. Коагулаза, в свою очередь, реагирует с фибриногеном, образующим фибрин, чтобы произвести свертывание плазмы.
  1. Используйте стерильную петлю для посева, чтобы удалить тяжелый инокулят из предполагаемый стафилококк неизвестен (определяется окрашиванием по Граму и Каталазный тест).
  2. Эмульгируйте этот нарост в 1 пробирке с кроличьей плазмой, напишите свое имя, и поместить в инкубатор 37С до следующего лабораторного периода.
  3. После инкубации проверьте наличие сгустков плазмы, наклонив пробирку для плазмы и наблюдайте, затвердела ли жидкость или нет ( не проливать ).
ОРГАНИЗМ ПРОИЗВОДСТВО КОАГУЛАЗЫ
Staphylococcus aureus Сгусток (продуцируемый коагулазой)
Staphylococcus epidermidis Без сгустка (без коагулазы)

ИДЕНТИФИКАЦИЯ ГРУППЫ СТРЕПТОКОКОВ
:
Чтобы определить неизвестный стрептококк, сначала необходимо классифицировать его. на основании его способности лизировать эритроциты барана (гемолиз).
  1. Внимательно изучите свой неизвестный БАТ (ищите только изолированные колонии на наличие это определение) и принять решение на основе следующих описаний, и демонстрационные пластины на переднем столе, какой из 3 типов гемолиза ваши неизвестные экспонаты.
АЛЬФА-ГЕМОЛИЗ:
Неполный лизис эритроцитов с образованием зеленого пятна вокруг колонии.
БЕТА-ГЕМОЛИЗ:
Полное разрушение эритроцитов с выбросом гемоглобина.Поляна вокруг колонии.
ГАММА-ГЕМОЛИЗ:
Никаких изменений в среде.
  1. Если ваш неизвестный стрептококк проявляет гемолиз , то он может принадлежать к группе D или быть Streptococcus pneumoniae или стрептококком Viridans. Полоса твоего неизвестной половине БАТ и поместить один диск оптохина в область плотнейшая прививка. Затем используйте стерильную петлю для инокуляции желчи-эскулина. Агаровая пластина и 6.5% бульон NaCl с неизвестным стрептококком. (Сделай это только если у неизвестного обнаружен a-гемолиз.)
  2. одну половину БАТ и поместите один диск с бацитрацином в область наиболее плотного прививка. Используйте другую половину BAP для теста CAMP (см. схему). Уничтожьте свой неизвестный стрептококк. по прямой линии через кривую сторона пластины. Простерилизуйте иглу и сделайте посев Staphylococcus aureus . ( бульон , а не тарелка ) перпендикулярно вашей неизвестной полосе, оставляя 1 см пробел между ними .
  3. Если у неизвестного стрептококка нет гемолиза (g) , пропустите шаги b и c. Вместо этого используйте стерильную петлю для инокуляции чашки с желчно-эскулиновым агаром и 6,5% бульон NaCl с неизвестным стрептококком.
  4. Инкубируйте чашки с БАТ в банке со свечой при 37°C до следующего лабораторного периода. Поместите бульон с желчью-эскулином и 6,5% NaCl в инкубатор при 37°С. Обязательно ставьте свое имя на всех ваших материалах.
  5. Обратите внимание, что если культура стрептококка чувствительна к бацитрацину или оптикину, вам увидите область без роста вокруг диска.
  6. Откажитесь от неизвестных пластин BAP. Материалы хранятся более 24 часов. довольно часто дают неубедительные или ошибочные результаты.
ПРОЦЕДУРА ТЕСТИРОВАНИЯ В ЛАГЕРЕ:
Тест

CAMP, выполненный на полноразмерной чашке с кровяным агаром. Обратите внимание усиленный гемолиз в форме стрелы.

СЛЕДУЮЩИЙ ЛАБОРАТОРНЫЙ ПЕРИОД

  1. Прочитайте и запишите результаты ваших и вашего партнера неизвестных на Лист отчета, используя таблицу ниже:
    ИДЕНТИФИКАЦИЯ СТРЕПТОКОКУСА
    Группа Гемолиз Бацитрацин
    Чувствительность
    CAMP
    Тест
    Желчь-
    Эскулин
    Агар
    6 6 5%
    NaCl
    Бульон
    Оптохин
    Чувствительность
    А Бета +


    B Бета +


    C Бета


    D
    Enterococcus
    Альфа или
    Гамма


    + +
    D
    Неэнтерококковые
    Альфа или
    Гамма


    +
    Viridans Alpha

    +
    Streptococcus
    Pneumoniae
    Alpha


    + +

  2. В конце этого лабораторного периода сдайте лист отчета, помеченный вашим имя и неизвестные #s.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *