Хлорофилл и рак: Статьи по онкологии — популярные и научные публикации для пациентов

Содержание

Статьи по онкологии - популярные и научные публикации для пациентов

Хлорофилл: полезные свойства, дозировка

Вы, конечно же, слышали о хлорофилле, и Вы, вероятно, знаете, что он важен для растений. Но чем он может быть полезен для людей?

Как мы узнали из уроков биологии, хлорофилл представляет собой растительный пигмент, отвечающий за поглощение света в процессе фотосинтеза, который придает им сил.

Но оказывается, хлорофилл также связан с естественной профилактикой онкологических заболеваний, блокировкой воздействия канцерогенов и защитой ДНК от повреждений токсинами, например грибком афлатоксином. Возможно, именно по этой причине хлорелла, водоросль с высоким содержанием хлорофилла, обладает мощными противораковыми свойствами.

Ученые также предполагают, что пигмент может способствовать снижению веса, выведению токсинов и поддержанию работы организма на оптимальном уровне.

Что такое хлорофилл?

Хлорофилл — это зеленое вещество в растениях, благодаря которому, они питаются с помощью углекислого газа и воды. Он присутствует во всех зеленых растениях, в том числе листовой зелени, привычных нам овощах, а также некоторых видах водорослей и бактерий.

Растения и водоросли используют хлорофилл для поглощения солнечного света, необходимого в фотосинтезе. На самом деле, это одно из наиболее важных соединений на планете, так как благодаря ему растения получают энергию, которую от них получаем мы.

В природе обнаружено две формы хлорофилла: хлорофилл а и хлорофилл b. Их разница заключена преимущественно в том, что они поглощают свет на немного разных длинах волн.

В растениях эти соединения присутствуют в отношении 3:1: хлорофилла а (голубовато-черное вещество) в три раза больше, чем хлорофилла b (темно-зеленое вещество). Оба соединения работают вместе, чтобы отражать темно-зеленых пигмент, который мы видим.

Хлорофилл — полностью натуральное соединение. Однако в лаборатории было выведено полусинтетическое вещество под названием «хлорофиллин», которое используется в пищевых добавках часто с пометкой «жидкий хлорофилл». Эти БАДы существуют уже более 50 лет и часто используются для лечения ран на коже, проблем с пищеварением, неприятного запаха и других неопасных недугов.

Считается, что добавка хлорофиллина способна нейтрализовать оксиданты и уменьшить последствия оксидативного повреждения, вызванного рядом факторов, например, плохим питанием, канцерогенными химикатами, воздействием УФ-лучей и облучения.

Польза для здоровья

1. Помогает справиться с раком

Исследования показали, что хлорофилл и жидкий хлорофиллин могут связываться с потенциальными канцерогенами и предотвращать их задержку в пищеварительном тракте. Таким образом, вещества блокируют перемещение канцерогенов по организму и повреждение уязвимых тканей, например суставов и сердца.

Отчет, опубликованный Институтом Лайнуса Полинга при Орегонском университете, США , говорит о том, что хлорофиллин и хлорофилл могут быть одинаково эффективны в предотвращении поглощения афлатоксина-В1 у человека и снижении биомаркеров повреждений ДНК, вызванных воздействием афлатоксина. Результаты ряда других экспериментов с участием животных и людей показали, что эта активность способствует снижению риска развития некоторых видов рака, в том числе рака толстой кишки и печени.

Снижение риска развития рака и очищение печени происходит путем влияния хлорофилла на метаболизм проканцерогена химических веществ, повреждающий ДНК. В организме человека фермент цитохром Р450 активирует проканцерогены и превращает их в активные канцерогены, которые продолжают атаковать здоровые клетки.

Это означает что замедление этого процесса остановит развитие рака, вызванного химическим воздействием.

Рацион питания с большим количеством красного мяса и недостатком зеленых овощей связан с увеличением риска развития рака толстой кишки. Иногда это связано с токсинами, образующимися во время приготовления мяса (например, хаемом), которые влияют на цитотоксичность и пролиферацию эпителиальных клеток. Недавно одно исследование выдвинуло предположение, что клетки рака толстой кишки человека «сковываются» под воздействием хлорофиллина. Это происходит благодаря ингибированию активности рибонуклеотидредуктазы, защищающему целостность ДНК и способствующему синтезу и восстановлению.

По этой причине активность рибонуклеотидредуктазы является объектом исследований, посвященных естественным методам лечения рака.

В 2005 году Исследовательский центр Вагенингена в Нидерландах изучил способность зеленых овощей блокировать негативное воздействие токсина хаем в толстой кишке. В течение 14 дней одной группе крыс был предложен рацион с высоким содержанием токсина, в то время как другой — с пищевой добавкой хлорофилла.

Результаты показали, что у крыс первой группы поражение в толстой кишке увеличилось в 8 раз по сравнению с началом исследования. Крысы второй группы, наоборот, были защищены от формирования цитотоксичных метаболитов хаема. Это позволило ученым прийти к выводу, что потребление зеленых овощей снижает риск развития рака толстой кишки, так как хлорофилл предотвращает цитотоксичность и гиперпролиферацию в результате действия таких токсинов, как хаем.

2. Способствует детоксикации печени

Хлорофилл также защищает здоровые клетки и ткани путем увеличения ферментов биотрансформации II фазы. Этот процесс поддерживает здоровье печени и естественным образом выводит из организма потенциально опасные токсины.

Некоторые более ранние исследования на животных заключили, что хлорофилл может снижать риск повреждения печени, вызванного воздействием афлатоксина, или рака печени с помощью увеличения активности этих ферментов II фазы и выведения вредных веществ.

Афлатоксин-В1 связан с увеличением риска гепатоцеллюлярной карциномы и рака печени, так как он превращается в канцероген, вызывающий клеточные мутации. В исследованиях на животных добавление хлорофиллина в рацион с большим содержанием афлатоксина-В1 значительно сократило количество повреждений ДНК.

Эти открытия особенно важны для жителей наименее развитых стран, где основными продуктами питания являются зерновые и бобовые.

В Китае было проведено рандомизированное плацебо-контролируемое исследование с участием 180 взрослых добровольцев с высоким риском гепатоцеллюлярной карциномы и хронического гепатита В. В ходе эксперимента участникам было предложено 100 мг хлорофиллина или плацебо перед приемом пищи три раза в день. Спустя 16 недель в группе, принимавшей хлорофиллин, уровень афлатоксина-В1 упал в среднем более, чем на 55%, по сравнению с плацебо-группой. Это значит, что хлорофилл вероятно, поддерживает здоровье печени без вреда для здоровья.

3. Ускоряет заживление ран

Вероятно, хлорофилл может замедлять скорость распространения бактерий, что делает его эффективным средством для предотвращения развития инфекций и ускорения заживления ран. С 1940-х годов хлорофиллин добавляют в некоторые мази, используемые для лечения стойких открытых ран у людей, например, сосудистых язв и пролежней.

Такие мази помогают снять воспаление, вызванное травмами и ушибами, ускорить восстановление и даже справиться с неприятным запахом, вызванным бактериями.

4. Улучшает пищеварение и контролирует вес

Хлорофилл способствует детоксикации путем ускорения вывода отходов из организма, нормализации уровня жидкости и профилактики запоров. Предварительное исследование показывает, что хлорофилл поддерживает обмен веществ и увеличивает вероятность успешной потери веса.

В 2014 году исследование, проведенное Отделом экспериментальной медицины в Лундском университете, Швеция, обнаружило, что включение пищевой добавки с хлорофиллом в рацион с большим содержанием углеводов уменьшает чувство голода, повышает уровень холецистокинина и предотвращает гипогликемию у женщин с избыточным весом.

Раннее, ученые обнаружили, что употребление хлорофилла в форме добавки с тилакоидами помогает нормализовать выработку гормонов, отвечающих за насыщение, в том числе холецистокинина, грелина и инсулина. Несмотря на до, что проведенные исследования, нацеленные на изучение влияния хлорофилла на вес, проходили с участием грызунов, результаты позволяют предположить, что это вещество может естественным образом уменьшить количество потребляемой пищи и предотвратить набор веса, в том числе и у людей.

Небольшое исследование Лундского университета включало 20 женщин, страдающих лишним весом. Им был предложен рацион, состоящий из трех приемов пищи. Шведский завтрак содержал большое количество углеводов, при этом одна группа добровольцев получала также хлорофилл в форме тилакоидов.

Тилакоиды способствовали подавлению чувства голода и увеличению производства гормонов насыщения после приема пищи, предотвращая переедание в течение всего дня. Со временем этот процесс будет способствовать потере веса и контролю аппетита.

5. Защищает кожу

Существуют доказательства того, что хлорофилл улучшает состояние кожи благодаря противовирусному действию. Он останавливает развитие герпеса в ротовой полости и области паха, вызванного вирусом простого герпеса. Некоторые более ранние исследования показали, что при использовании мази или крема с хлорофиллом на коже происходит замедление распространения вируса и ускорение заживления ран. Таким образом, этот препарат можно назвать средством для лечения герпеса.

Вероятно, хлорофилл также способен защитить кожу от опоясывающего лишая, справиться с болезненными язвами и даже снизить риск возникновения рака кожи. Введение хлорофилла непосредственно под кожу и использование его в форме лосьона может снизить вероятность рецидива раковых клеток у людей с базальноклеточной карциномой, очень распространенным типом рака кожи.

6. Борется с воспалением

Тропический ботанический сад и исследовательский институт Индии предполагает, что хлорофилл в свежих зеленых листьях обладает мощным противовоспалительным действием и способен бороться с опасными бактериями и токсинами из окружающей среды.

Он помогает блокировать работу провоспалительных цитокинов TNF-α, вызванных липополисахаридами, что делает вещество многообещающим средством для лечения воспалений и связанных с ними заболеваний, которые традиционная медицина контролировать не может.

Риски и побочные эффекты

Хлорофилл полностью натурален, а значит нетоксичен. На самом деле, за последние 50 лет исследований практически не было зафиксировано случаев побочного действия этого вещества, даже у людей со слабым иммунитетом (например, после противораковой терапии).

Несмотря на крайне маленький риск токсичности добавки с хлорофиллом могут вызвать такие незначительные симптомы, как окрашивание мочи и кала в зеленоватый цвет, временное изменения цвета языка или легкое расстройство кишечника, диарея. Эти симптомы могут возникнуть только при дополнительном приеме хлорофилла и быстро проходят. Хлорофилл, полученный из продуктов питания абсолютно безопасен.

Так как исследований, касающихся влияния БАДов с хлорофиллом на беременных и кормящих женщин, проведено недостаточно, мы рекомендуем отказаться от их приема в этот период.

Хлорофилл может взаимодействовать с препаратами, повышающими чувствительность к солнечному свету (фотосенсибилизирующие препараты). В этом случае Вы можете стать слишком чувствительны к солнцу, что увеличит риск ожогов.

Используйте добавки с хлорофиллом с осторожностью, если Вы принимаете фотосенсибилизирующие лекарства, или под воздействием УФ-лучей Вы быстро краснеете, покрываетесь высыпаниями или волдырями.

Продукты

Лучшими источниками хлорофилла являются зеленые овощи и водоросли. Добавьте эти продукты в свой рацион, и Вы в полной мере почувствуете всю пользу хлорофилла.

  • Зеленые листовые овощи. Кале, шпинат, мангольд получают свой характерный ярко-зеленый цвет благодаря высокой концентрации хлорофилла. Лучше всего, если Вы каждый день будете употреблять в пищу небольшое количество этой зелени, как часть рекомендованной порции овощей, или Вы можете добавлять ее в смузи.
  • Сырые или чуть обработанные овощи. Институт пищевых технологий США опубликовал очень интересные результаты. Оказывает, содержание хлорофилла в зеленых овощах снижается во время их приготовления, разморозки или порче. Так, количество хлорофилла в шпинате падает на 35% после его разморозки и еще на 50% после варки или тушения. Чтобы получить максимум хлорофилла, старайтесь употреблять больше сырых овощей или овощей, подвергшихся кратковременной обработке при низких температурах.

Ниже представлен список продуктов в сыром виде, содержащих самую высокую концентрацию хлорофилла (связанного с магнием):

  • 1 чашка шпината: 23,7 мг
  • ½ чашка петрушки: 19 мг
  • 1 чашка водяного кресса: 15,6 мг
  • 1 чашка зеленых бобов: 8,3 мг
  • 1 чашка рукколы: 8,2 мг
  • 1 чашка лука-порея: 7,7 мг
  • 1 чашка эндивия: 5,2 мг
  • 1 чашка сладкого горошка: 4, мг
  • 1 чашка пекинской капусты: 4,1 мг
  • Хлорелла: тип зелено-голубых водорослей, произрастающих в некоторых регионах Азии. Хлорелла содержит не только большое количество хлорофилла, но и множество фитонутриентов, аминокислот, витаминов и минералов. Как и сам хлорофилл, хлорелла способна нормализовать уровень гормонов, вывести токсины из организма, укрепить сердечно-сосудистую систему, уменьшить воспаление, кровяное давление и уровень холестерина. Хлореллу можно употреблять как в свежем виде, так и в форме пищевых добавок, например, в виде порошка или таблеток.

Дозировка

Помимо зеленых овощей источником хлорофилла могут быть БАДы, содержащие все полезные свойства зеленого пигмента. Тип добавки определяет ее дозировку:

  • Добавки хлорофиллина. Зеленые водоросли, например, хлорелла, часто используются для производства хлорофиллина, присутствующего в большинстве БАДов. Это связано с тем, что хлорофилл нестабилен и склонен к разложению, что делает его дорогим и неудобным для приема. Пероральная доза хлорофиллина составляет 100-300 мг в сутки. Она не вызывает побочных действий и подходить для лечения заболеваний.
  • Жидкий хлорофилл и другие источники. Добавку хлорофилла можно встретить в составе других природных средств, включая люцерну посевную (Medicago sativa) и помет шелкопряда. Что касается жидкого хлорофилла, добавьте несколько капель в стакан воды и принимайте 1-2 раза в день. Вода окрасится в ярко-зеленый цвет, но на вкус она не такая противная, как может показаться. Этот напиток подарит вам заряд энергии на весь день.

Заключение

  • Хлорофилл способен бороться с раком, очистить печень, ускорить заживление ран, улучшить пищеварение, защитить кожу и контролировать вес.
  • Хлорофилл полезен прежде всего потому, что он обладает мощными антиоксидантными и противораковыми свойствами. Это вещество поддерживает иммунную систему благодаря формированию прочных молекулярных связей с другими веществами, вызывающими оксидативный стресс и такие заболевания как рак.
  • Лучшими источниками хлорофилла являются водоросли и зеленые овощи. Наибольшей концентрацией пигмента обладают такие листовые овощи, как капуста кале, шпинат и мангольд. Приготовление овощей значительно снижает в них количество хлорофилла, поэтому мы рекомендуем употреблять их в свежем виде.
  • Хлорелла, БАДы с хлорофиллином и жидкий хлорофилл также являются хорошими источниками зеленого пигмента, богатого антиоксидантами.

Вы можете оставить заявку на плановую госпитализацию на нашем сайте и мы свяжемся с Вами.



Хлорофилл против рака простаты | Top Clinic Ichilov

Новейший метод лечения рака предстательной железы разработали израильские ученые в Институте Вайцмана. Методика уже одобрена американскими и израильскими медиками, она проходит рассмотрение в Европейской медицинской ассоциации, и в ближайшее время будет использоваться для лечения рака простаты. А пока израильские и американские ученые совместно изучают возможности применения инновационного способа лечения в борьбе со злокачественными опухолями других органов.

Новый препарат безвреден для организма, в его основе натуральное природное вещество – хлорофилл, находящийся в клетках бактерий. Исследования показали, что это вполне безобидное вещество способно разрушать клетки, если находится в небактериальной среде и подвергается воздействию света. Уникальную особенность бактериального хлорофилла и решили использовать ученые в борьбе с раком предстательной железы. Специфика строения этого органа позволяет легко достичь желаемого результата.

Хлорофилл вводится в вену и попадает в кровь, распределяясь по всему телу и не причиняя больному неудобств. После того, как пигмент проникнет во все органы, в том числе простату, врач воздействует на область опухоли лазером. Под воздействием излучения вещество разрушается, одновременно уничтожая злокачественное образование.

Этот способ лечения позволяет избежать операции и химиотерапии и добиться стойкой ремиссии. После проведения клинических испытаний первой и второй фазы результаты оказались впечатляющими. 49% больных смогли избежать операции, полностью излечиться от заболевания и вернуться к полноценной жизни. Только у 6% больных не наблюдались существенные положительные изменения, поэтому им пришлось делать операцию. Процент людей, которым помог бактериальный хлорофилл, мог бы быть больше, если бы некоторые пациенты не отказались проходить биопсию повторно, после окончания процедуры. Они чувствовали себя настолько хорошо, что были убеждены в успехе терапии.

С учетом полученных результатов ведется активная исследовательская работа, в результате которой должны появиться новые методы лечения рака молочной железы, органов пищеварения и мочевыводящих путей с помощью бактериального хлорофилла.

Ведение онкологических больных

Ольга Беклемищева: Сегодня у нас в гостях доктор Виктор Борисов. Он уже приходил к нам на программу, и, судя по отзывам, многим помог. А сегодня у нас есть еще один повод вернуться к теме - недавно Виктор Александрович был избран членом Берлинского общества онкологов по результатам его доклада о своей методике в Берлине. В докладе обсуждались два случая исцеленного рака мозга, вызвавшие восхищение коллег. Я присоединяюсь к ним в этом восхищении и объявляю тему: реабилитация онкологических больных, снижение вреда при химиотерапии рака и саплиментное лечение опухолей.

Виктор Александрович, вам слово.


Виктор Борисов: Во-первых, уточнение. Было предложено вступить в немецкое онкологическое научное общество, вернее, Берлинское научное общество, и решение будет, я думаю, где-то в течение февраля месяца. Ну, а если будет решение положительным на мое выступление, то это будет прецедент. Потому что первым человеком, которого приняли берлинцы в свое научное обществом был академик Бехтерев.


Ольга Беклемищева: Замечательно. Самый важный вопрос, как я понимаю, для всех нас, доктор Борисов, насколько, вообще, излечим рак?


Виктор Борисов: Как правило, считается, что рак – это приговор. Во всяком случае в нашем обществе такие тенденции прослеживаются. Но наблюдая за своими больными и зная о современных достижениях и химиотерапии, и лучевой терапии, и оперативного лечения… Не только продлевается жизнь больного, а уже многие болезни, я имею в виду, много видов рака стали вполне излечимы с применением комплексных методик лечения, с применением и химиотерапии, и лучевой, и хирургического лечения. И то, чем я занимаюсь, - это реабилитация этих онкологических больных.


Ольга Беклемищева: И самое главное, наверное, все-таки, чтобы сам больной боролся за свою жизнь и здоровье?


Виктор Борисов: Безусловно. Психологический фактор играет огромнейшую роль. Ведь парадокс заключается в том, что большинство больных, которые ко мне приезжают, как правило, это люди из других стран, которые знают более-менее современные методики реабилитации… А она авторская, безусловно, и абсолютно безопасна для больного, позволяет, как говорится, устранить последствия и химиотерапии, и лучевой, и хирургического лечения, но в первую очередь мы были нацелены на устранение побочных эффектов химиотерапии.


Ольга Беклемищева: Ну, об этом чуть-чуть позже. Я все время хочу, чтобы мои гости подчеркнули важность личных усилий каждого пациента. Ведь, действительно, люди приезжают из Югославии, из Дании, из Шотландии, они каким-то образом все это узнают, достают визы, достают деньги на билеты, приезжают. А наши, российские пациенты часто считают, что если им поставили диагноз, то больше уже ничего делать и не надо. Вот это самое обидное, когда люди отказываются от надежд.


Виктор Борисов: Абсолютно правильно. Я первый раз столкнулся с этим порядка пяти лет назад, когда я убедился, что лучшее средство убеждения и наиболее эффективный метод психологического воздействия на больного для того, чтобы преодолеть вот этот психологический барьер, - это общение больных между собой. И посему в нашей клинике больные, которые уже прошли первые курсы, в обязательном порядке общаются друг с другом. Не важно, что существуют языковые барьеры, они видят друг друга, и все прекрасно помнят, каким человек приезжал до этого - депрессивный, с массой осложнений, и как он меняется, и он старается рассказать окружающим. Это метод коллективной психотерапии, скажем вот так. А на самом деле я хотел сказать о другом, что наше незнание губит больного. Почему? Потому что самое страшное в борьбе с любым заболеванием – это собственная депрессия, которая подавляет нашу волю, стремление жить и так далее.


Ольга Беклемищева: Ну, и для того, чтобы поддержать волю к победе всех наших слушателей, мы немножко поговорим о раке. Рак сейчас третья причина смертности. Это достаточно распространенное заболевание, их (раков) очень много, и лечат их, как вы уже сказали, химиопрепаратами, лучевой терапией, иммунотерапией, оперативным образом. Но все эти методы, что называется, не без последствий, то есть лечение в основном все-таки тяжелое. Почему это так?


Виктор Борисов: Давайте так, в нашем организме нет ничего лишнего, и, если мы что-то удаляем, какой-то жизненно важный или часть жизненно важного органа, последствия уже можно сразу предсказать, это что касается оперативного лечения. То, что касается химиотерапии, вы знаете, что химиотерапия влияет не только на раковую опухоль, но оказывает негативное воздействие в целом на органы и системы.


Ольга Беклемищева: Потому что химиопрепаратам, в общем-то, все равно, по кому бить – по раковой клетке или по хорошей, здоровой.


Виктор Борисов: Абсолютно верно. Это метод общего воздействия. Соответственно, мы стреляем из пушки по площадям, что называется. На самом деле у некоторых больных некоторые химиопрепараты вызывают тяжелейшие осложнения. И самым главным является миелосупрессия, перевожу на русский язык, это токсическое действие препаратов на кровь и красный костный мозг. Там же молодые клетки, соответственно… Да, кстати, и на белые клетки тоже также воздействуют. У меня масса больных были с лейкопенией, с лейкоцитопенией и так далее. Устранить это осложнение и призвана наша методика реабилитации больных.


Ольга Беклемищева: А сейчас я хочу спросить нашего американского эксперта Даниила Борисовича Голубева. Даниил Борисович, скажите, как рассматривается в Соединенных Штатах проблема смягчения вредных последствий лучевой и химиотерапии при онкологических заболеваниях?


Даниил Голубев: Если кратко, то я бы сказал, что к этой проблеме в Америке диаметрально противоположное отношение у лицензированных онкологов, с одной стороны, и у представителей различных видов альтернативной медицины и натуропатов - с другой.

«Официальная», так сказать, лицензированная онкология исходит из того, что специально «смягчать» действие химиопрепаратов и лучевой терапии нужно с большой осторожностью, иначе это может снизить сам лечебный эффект. Не секрет, что оба этих вида воздействия токсичны не только для раковых клеток, но и для нормальных клеток организма. Именно поэтому у пациентов при такого рода лечении выпадают волосы, уменьшается количество форменных элементов крови, в том числе и иммунокомпетентных. Это невольная, но и необходимая плата за возможность поразить основную массу раковых клеток, обладающих большей чувствительностью к лучевым и химиотерапевтическим воздействиям, чем нормальные клетки. Таким образом, «щажение» больного во время самого лечения проводится в основном путём выбора оптимального метода или препарата, его дозировки, условий проведения лечения и тому подобного. Помощь больному для преодоления токсические проявлений терапии (тошноты, слабости, головных болей и так далее) проводится с помощью целого спектра соответствующих симптоматических средств. Истинное же стимулирование функций, пострадавших от лучевого и химиотерапевтического лечения, начинается после завершения курса.

Нередко, однако, и в процессе лучевой или химиотерапии приходится прибегать к чисто лечебным мерам по жизненным показаниям. Так, например, серьезной проблемой при химиотерапии может стать анемия, которая возникает из-за поражения химиопрепаратами или лучевыми воздействиями клеток костного мозга - предшественников эритроцитов. Анемия ухудшает работу сердца, вызывает большую слабость, апатию, угнетенное состояние и даже депрессию. Для борьбы с анемией больному, при необходимости, вводят специальные стимуляторы роста «красной крови» или проводят вливание этитроцитарной массы и тромбоцитов. Больному следует также получать полноценную пищу, богатую железом. Но это только один пример.


Ольга Беклемищева: А какие лекарства наиболее часто применяются в Соединенных Штатах для преодоления вредных последствий лучевой и химиотерапии?


Даниил Голубев: При тошноте и рвоте - частых проявлениях побочного действия этих видов терапии - чаще всего применяются сетроны - антагонисты рецепторов серотонина и относительно новое лекарство Апрепитант - из группы антагонистов нейрокинина. Реже используют антигистаминовое средство Антиверт и кортикостероид дексаметазон. Для профилактики тошноты при радиотерапиии используют комбинацию сетронов и корткостероидов.

Кроме лекарственной профилактики и лечения тошноты после радио- или химиотерапии используют и методы отвлекающего воздействия и релаксации, в частности, иглоукалывание.


Ольга Беклемищева: Вот так при применении одних лекарств приходится применять другие для смягчения последствий. А в чём состоит отличие всей этой тактики от действий натуропатов?


Даниил Голубев: С точки зрения американского общества онкологов, во время лучевого или химиотерапевтического лечения больной не должен получать никаких «добавок» («сапплементов»). Это касается многих веществ, но особенно антиоксидантов. Дело в том, что антиоксиданты (витамины С, Е, бета-каротин и другие) подавляют действие противораковых препаратов, «защищая» опухоль от их атаки. Такие действия снижают эффективность лечения. Все эти средства можно будет использовать только после окончания курса лечения, в период реабилитации. Многие же представители альтернативной медицины различные виды био- и иммуностимуляции проводят независимо от лучевой и химиотерапии. Вот в этом и состоит отличие.


Ольга Беклемищева: Спасибо, профессор Голубев.

Виктор Александрович, вы мне говорили о том, что появляются и новые лекарства, направленные на смягчение последствий химиотерапии.


Виктор Борисов: Абсолютно правильно. Вот, Даниил Борисович перечислил сетроны, которые применяются для устранение тошноты, рвоты, диспепсии, поносов и так далее, но я в Европе столкнулся с любопытным препаратом и, кстати, на конференции на последней онкологической в Москве. Я не знаю, относится ли он к сетронам или это другого типа препарат, препарат называется Эвенте . В Европе он широко применяется, а у нас уже у некоторых больных, я тоже заметил появление этого препарата, который снимает эти побочные явления.


Ольга Беклемищева: Причем снимает достаточно хорошо, насколько я понимаю?


Виктор Борисов: Достаточно хорошо. Это пероральный препарат, и снимает с одного раза.


Ольга Беклемищева: С одного применения?


Виктор Борисов: С одного применения, да.


Ольга Беклемищева: Блестяще. Но пока препарата в России нет. И кроме того, он снимает тошноту и рвоту, но не уничтожает, скажем, то же облысение и так далее. А вот вы мне демонстрировали совсем недавно больную, которая проходила уже третий курс химиотерапии по поводу рака груди, и она была с волосами, с бровями, достаточно живая на вид. Как она сказала, ее формула крови приводит в восхищение онколога, настолько у нее спокойная кровь. Что вы делаете с больными, с данной больной, например?


Виктор Борисов: У данной больной используется методика биохронотерапии. Мы организовываем их в пространстве и во времени. Эта методика была описана профессором Загускиным, которого мы ждали в студии, но, к сожалению, его сейчас нет. Он теоретик, он бы более подробно об этом рассказал. Когда считываются с больного индивидуальные ритмы и последующее воздействие, в частности, фотодинамическая терапия проводится именно в связи с этой методикой. Что этим достигается? Во-первых, достигается большая глубина проникновения и не тратится эффективная мощность прибора на разогрев крови или жидкости, находящейся внутри организма. И мы активируем препарат, который вводится либо внутривенно, либо другими путями, это фотосенсибилизатор, который начинает, во-первых, активно атаковать опухоль а во-вторых, это препарат, сделанный из спирулины. Вы прекрасно знаете о том, что это блестящий иммуномодулятор. Соответственно, мы сразу, с одной стороны, поддерживаем иммунитет, устраняя побочные явления, способствуя быстрому выведению шлаков (используем такой простой термин) или продуктов токсического распада, или токсического воздействия химиопрепаратов. Таких больных – не одна, это практически все больные, которые у меня находятся. При всем при том я обратил внимание, что когда больной в середине цикла химиотерапии попадает к нам на реабилитацию, это позволяет ему избежать вот этих проявлений, о которых говорил Даниил Борисович, то есть токсических проявлений химиотерапии. То же самое касается и лучевой терапии. Здесь самое главное – это качество жизни.


Ольга Беклемищева: Прошу прощения, я боюсь, что не все наши слушатели нас поняли. Давайте мы еще раз пройдемся по этапам. Вот больной, у которого есть подтвержденный диагноз в соответствующем учреждении (онкоцентре на Каширке в данном случае), он получает уже традиционную терапию – химиотерапию, лучевую терапию, то, что ему положено по его заболеванию. Он, не дожидаясь конца этой терапии, приходит к вам?


Виктор Борисов: Абсолютно правильно. И это более эффективно на самом деле.


Ольга Беклемищева: Когда вы идете в параллели?


Виктор Борисов: В параллели, да. Что привлекло моих немецких коллег? Ведь на самом деле методик реабилитации четко научно обоснованных достаточно мало. И Даниил Борисович правильно сказал о том, что совершенно разными курсами двигаются парамедики и онкологи. При всем при том это все связано с устранением побочных эффектов и в первую очередь опять же химиопрепаратов. А здесь методика абсолютно безвредная и безопасная, ведь мы же одновременно убиваем двух зайцев, то есть мы, с одной стороны, устраняем побочные явления химиотерапии, не позволяя больному скатиться на уровень депрессии иммунитета или снижения иммунитета, потери сил, облысения, тошноты, устраняем все это. А с другой стороны, мы стимулируем иммунитет, мы стимулируем обменные процессы, и, соответственно, улучшается выведение токсических продуктов, и даже химиотерапия протекает великолепно, то есть врачи удивляются на самом деле. Вы беседовали с этой больной. Это же одна из многих. Сейчас ко мне поступает целая группа больных из Югославии, вы можете поговорить и убедитесь, что люди, которые перенесли ни один, ни два, ни три, а, там, десяток, 12 курсов химиотерапии, они блестяще переносят. Но они успевают в промежутке, то есть в перерыве приехать ко мне на недельку, и этого достаточно.


Ольга Беклемищева: То есть ваш эффект… Как вы его объясняете? Только за счет того, что вы стимулируете иммунитет или опухоль становится более рыхлой, податливой, или разламывается на самые маленькие кусочки, которые уже никого не волнуют, то есть не вызывают аллергических реакций внутри организма? Чем вы объясняете? В чем физиологический субстрат того эффекта, который наблюдается в клинике у ваших больных?


Виктор Борисов: Мы используем метод прижизненного исследования нативной крови, то есть живой крови, и мы наблюдаем обломки этой опухоли, которая плавает в крови даже при применении нашей методики. Ну, наверное, вы точнее выразились или, во всяком случаем, понятнее для слушателей, это то, что она лучше утилизируется, то есть лучше выводится продукты ее распада. Как раз фраза «на мелкие кусочки», наверное, более точная.


Ольга Беклемищева: Я хотела бы здесь чуть-чуть уточнить для наших слушателей. Фотодинамическая терапия, как метод терапии рака, известен уже лет 20, наверное. И он состоит в том, что опухоль насыщается таким химическим веществом, в основном это какие-то производные хлорофилла, которые под действием света переходят в активную форму и как бы взрывают эту опухоль изнутри. И то, что сказал Виктор Александрович о том, что фотодинамическая терапия – тоже тяжелый метод, это как раз этим и вызывается, то есть опухоль разлетается на крупные куски, и они начинают отравлять человека, насколько я понимаю, пусть меня простят профессионалы. А в модификации Виктора Александровича этого не происходит. Вот почему?


Виктор Борисов: А я объясню. Давайте на простом примере, я вот немцам пытался это объяснить. Я – мужчина, вес у меня 100 килограммов. Если я взял гвоздь, подошел к стене и попытаюсь его затолкать туда, это бесполезное занятие, он просто не войдет. А я беру маленький молоточек и начинаю вбивать этот гвоздик в стену, он легко входит. То есть вот в чем разница? Во-первых, метод дробного воздействий, метод более продолжительный по времени, чем банальная фотодинамическая терапия и, самое главное, это метод, который устраняет препятствия на пути прохождения лазера. Лазер активирует… Ведь по сути дела мы уничтожаем опухоль каким путем? Вспоминайте древнюю монгольскую казнь, это буквально два слова, когда дорогого гостя или того гостя, которого хотели уничтожить, кормили бараньим жиром, а потом давали ледяной воды выпить. С одной стороны, его кормили, а с другой стороны, когда человек выпивал родниковой воды, жир створаживался, грубо говоря, и больной умирал в муках от заворота кишок. Ведь в принципе мы делаем то же самое…


Ольга Беклемищева: Не с человеком, а с опухолью.


Виктор Борисов: Для опухоли. Мы ее кормим, при том блестящим питательным веществом, это хлорофилл, она пожирает этот хлорофилл, при этом окружающие клетки не успевают это проглотить, потому что опухоль…


Ольга Беклемищева: Аппетит выше.


Виктор Борисов: У нее процессы повышены на порядок, это обжора за столом, она наедается хлорофилла. После этого мы активируем этот хлорофилл, который превращается в опасную форму, уже находясь внутри опухоли, и разрушает изнутри раковые клетки. Понятно?


Ольга Беклемищева: Надеюсь, что да. Здесь есть еще один тонкий момент, который отличает метод доктора Борисова от принятых методик фотодинамической терапии, он связан с тем, что все воздействие привязано к естественным ритмам человеческого организма.

А сейчас с новостями от Евгения Муслина вас познакомит Вероника Боде.


Вероника Боде: С каждым днем в Китае рождается все больше близнецов. В некоторых родильных домах их стало в четыре - четыре с половиной раза больше, чем в прошлом году. Это загадочное явление объясняется просто - женщины, особенно из зажиточных семей, стали чаще принимать лекарства от бесплодия, стимулирующие яичники и способствующие многоплодным беременностям, чтобы обойти правительственное ограничение «одна семья - один ребенок».

Однако такие лекарства, если их неправильно применять, считает директор родильного дома в городе Нанджинг доктор Гу Линг, могут нанести существенный вред и самим роженицам, и всему обществу. Близнецы и тройни, например, чаще рождаются преждевременно, а у младенцев чаще встречаются различные отклонения от нормы.

Китайские медицинские власти собираются усилить контроль за продажей лекарств от бесплодия, которые сейчас можно купить во многих аптеках даже без врачебного рецепта.

Правительственная политика «один ребенок на одну семью» действует в Китае уже на протяжении жизни целого поколения. Без этого ограничения, утверждает официальная статистика, население страны было бы сегодня на 400 миллионов человек больше.

Несмотря на значительный успех в снижении роста народонаселения, многие иностранные критики считают принимаемые меры - насильственную стерилизацию, поздние аборты, а иногда даже убийства детей - чрезмерно жесткими нарушениями прав человека. К тому же они приводят к нежелательныем долговременным последствиям - например, к значительному превышению числа рождающихся мальчиков по сравнению с девочками, поскольку многие супружеские пары, ограниченные одним ребенком, предпочитают сделать аборт, обнаружив, что зародыш женского пола.

Анестезиолог Дэвид Уорнер и его коллеги из знаменитой американской клиники Мэйо пришли к выводу, что время перед хирургической операцией - самый оптимальный период, чтобы навсегда бросить курить. Дело в том, что после операции курильщики меньше страдают от никотинного голодания, чем если бы они перестали курить в любое другое время. Это объясняется действием медикаментов и лечебных процедур, используемых обычно хирургами и подавляющих тягу к никотину. Кроме того, у оперируемого возникает еще одна веская противоникотинная мотивация: у бросивших курить послеоперационный период протекает гораздо легче, а риск инфицирования ран сокращается. Анестезия для некурящих безопаснее и ее эффекты более предсказуемы, поскольку у некурящих лучше работает сердце, кровеносные сосуды, легкие и вся нервная система.

Голландские исследователи из Роттердамского медицинского центра пришли к выводу, что более 40% мягких сердечных приступов проходят незамеченными, потому что пациенты либо не замечают, либо пренебрегают их симптомами. Чаще всего такое случается с женщинами, особенно со страдающими от ожирения или диабета, и с пожилыми людьми, что повышает их будущий кардиологический риск.

Сердечные приступы и инфаркты - одна из основных причин смертности в развитых странах. Их самый распространенный, но далеко не единственный симптом - боль в груди. Однако во многих случаях больные чувствуют боль плечах или думают, что у них затянувшийся грипп.

Массовые кардиографические обследования в Роттердаме показали, что у 43% больных сердечные приступы прошли незамеченными. Своевременное выявление таких приступов необходимо для предотвращения назревающих кардиологических проблем, особенно у женщин. Ибо врачи в подобных случаях могут порекомендовать определенные изменения в образе жизни или прописать аспирин и другие лекарства, предотвращающие следующий приступ.

По данным Всемирной организации здравоохранения, на сердечно-сосудистые болезни приходится более 29% всех случаев смертности.


Ольга Беклемищева: Ну, а мы снова возвращаемся к нашей теме. До нас дозвонились уже некоторые слушатели. Я хотела бы предоставить слово Раисе Михайловне из Москвы.


Слушатель: Виктор Александрович, вот такая ситуация у меня. Я 20 лет назад оперировалась первый раз – опухоль груди правой, потом, еще через 20 лет, снова операция – на левой груди мне удалены. Но мне ничего-ничего не делают, меня не лечат, ничего не делают абсолютно, наблюдают, правда, я сдаю кровь. Как быть? Может быть, если к вам прийти на консультацию, я подлечусь?


Виктор Борисов: Ради Бога, приходите. Телефон 365-38-49. Приходите ко мне, и мы попробуем разобраться, потому что по телефону… Мне надо увидеть вас. Хорошо? Со всеми документами.


Ольга Беклемищева: Следующий слушатель – это Сергей из Москвы.


Слушатель: Я хотел бы сказать, что вы боретесь уже с последствиями болезни, вы убиваете раковую опухоль. А из чего она состоит, из каких вредных паразитов? Чтобы человек мог как-то предупредить эту болезнь. Я, например, увлекаюсь здоровым образом жизни. Как питаться, например? Потому что химией вы убиваете, химия содержится в различных компонентах. Может ли прийти время, что химия уже не будет действовать на человека, нужные какие-то другие методы, чтобы он сам, допустим, выводил эти паразиты? Вы понимаете, о чем я говорю?


Виктор Борисов: Я понимаю, конечно, я понимаю, чем вы занимаетесь. А вы по какой методике занимаетесь?


Слушатель: Ну, я по различным методикам, Малахова есть…


Виктор Борисов: Абсолютно правильно.


Слушатель: Семенова.


Виктор Борисов: Шаталина.


Слушатель: Просто я этим увлекаюсь и хочу знать, в чем же причина, почему, что составляет раковую опухоль? Некоторые думают, что это чуть ли не какой-то клещ сидит.


Виктор Борисов: Я знаком с этими работами, но, к сожалению, они не нашли подтверждения. Но давайте так, в опухоли повышены обменные процессы, там масса питательных веществ, если уж серьезно, которые быстро перевариваются. Естественно, это питательная среда для размножения и бактерий всевозможных, как говорится, внутриклеточных и неклеточных паразитов. Это одна теория. А вторая теория, о которой вы говорите, это то, что это вызывает якобы повреждение тканей и последующее развитие опухоли. Хотя я читал эту книгу и знаком с этими работами еще при социализме, но это не нашло подтверждения. Поэтому можно предполагать, а на самом деле трудно мне сказать об этом. Тем более не я этим занимался.


Ольга Беклемищева: Я хотела бы немножечко уточнить. Опухоль – это собственные клетки организма, которые видоизменились. Это, собственно, бунт внутри нас самих, бунт некоторых клеток и ни какой это ни клещ. Причины возникновения – они, действительно, дискутабельны.


Виктор Борисов: Абсолютно правильно.


Ольга Беклемищева: Единой точки зрения нет, да и раков много, чтобы у них могла быть какая-то одна причина. А по поводу профилактики рака – здоровый образ жизни, очевидно.


Виктор Борисов: Ну, так это во всем мире. Посмотрите, что происходит и в Америке, и в Европе, ну, и даже у нас в стране сейчас призываются к профилактике, к ведению здорового образа жизни. Существует масса методик, не только те, которые вы перечислили. Ну, они очень популярны, скажем так.


Ольга Беклемищева: И следующий слушатель – это Эрих с Кубани.


Слушатель: Это доктор Эрих Гуз. Я очень рад, что мои соотечественники очень высоко оценили работу гостя. Я сам занимаюсь вопросами онкологии больше 30 лет. Мои методы зарегистрированы по открытиям и изобретениям. Так, способ лечение психосоматических больных. Вопрос следующий. Безусловно, работа очень нужная, полезная, которую вы осуществляете, она может быть и еще более эффективнее в плане лечения и профилактики, если подходить к лечению больных онкологических, как к лечению психосоматических больных. В 1973 году еще была создана европейская рабочая группа по психосоматике в онкологии и так далее. Еще старые русские врачи говорили: дальняя причина рака есть долгая печаль. Мне бы хотелось, чтобы в этом плане как можно шире вы затронули, потому что дальнейшие резервы повышения эффективности лечения онкологических больных, кстати, также как кардиология, эндокринология и так далее, это прежде всего подход как к психосоматической патологии. Пожалуйста, немножко расширьте эти моменты. Спасибо!


Ольга Беклемищева: Вот мы с этого и начинали, что главное…


Виктор Борисов: Абсолютно. Программа началась с этого, и мы как раз об этом говорили. Это один из немаловажных факторов. И у нас в составе нашей группы существует психотерапевт. Вы знаете, что даже в эксперименте на крысах, крысы, которых постоянно пугать, долго не выживают, и заканчивают очень печально свою жизнь, а те, которые находятся в стабильном состоянии, переживают крыс, находящихся в состоянии стресса. То же самое можно экстраполировать и на людей: депрессия, чувство страха, ну, и масса причин.


Ольга Беклемищева: То есть лучшая профилактика рака – это все-таки позитивное отношение к жизни и умение ей радоваться, так?


Виктор Борисов: Абсолютно правильно.


Ольга Беклемищева: И я бы хотела отметить это, мой взгляд со стороны, что в клинике у доктора Борисова, невзирая на то, что там очень много тяжелых больных, настрой действительно очень радостный, я бы так сказала, как это ни странно звучит. И это большая удача и заслуга, наверное, вашего коллектива.

Следующий слушатель – Давид из Звенигорода.


Слушатель: Доктор, раньше были работы, я тоже в прошлом медик, где сообщалось, что аборты, особенно если женщина сделает три и более, они как раз предрасположенность такую в организме затрагивают, потому что происходит серьезный настрой гормональный, собственно, полный перестрой, а потом резкий обрыв. И эти гормоны начинают, не сказать, самоедством заниматься, но перерождение клеток происходит. Сейчас в этом отношении не встречал ничего. И хотел сказать еще, новые современные контрацептивные препараты каким-то образом имеют такую предрасположенность женщин к раковым заболеваниям груди, в основном, и гинекологические.


Виктор Борисов: Попробую ответить.


Ольга Беклемищева: Не совсем по адресу.


Виктор Борисов: Не по теме, да, но попробую ответить. Об этом много писалось, и вы абсолютно правы, вы сами ответили на этот вопрос, если серьезно. По контрацептивам нет данных о том, что якобы они вызывают предрасположенность к раковым заболеваниям.


Ольга Беклемищева: А аборт, как всякая травма, естественно, создает некоторую опасность.


Виктор Борисов: И срыв гормонального фона, это очевидно.


Ольга Беклемищева: Следующий слушатель – Лидия Ивановна из Петербурга.


Слушатель: Виктор Александрович, вы не подскажете, как поступить мне в моем горе. У меня муж заболел нехоткинской лимфомой. В прошлом мы имели печальный опыт родственника, который болел лейкозом, там ребенок, правда, болел, но так как мы находились очень долгое время в больнице, мы видели, что от химиотерапии умирают и 20-летние, и 30-летние, не выдерживают химиотерапию, так как кровоизлияние происходит в почки, в мозг и так далее. И сейчас он просто отказывается от химиотерапии. Два года мы уже просто… я сама… я не знаю, просто траву ему напарю, куркуму, читаем, и бадан корни, и чистотел, в общем, все сама, что я могу, я делаю. Два года мы держимся. Я не знаю какому богу молить. Мы держимся, но, конечно, медленно ползем. Почему? Потому что повышаются лейкоциты, и эритроциты. Но все таки. Вы берете таких больных? И что нам делать, вообще, как его убедить? Он даже разговаривать не может о химиотерапии, говорит: я не выдержу. Все.


Виктор Борисов: Во-первых, мне надо познакомиться с историей болезни и все-таки, наверное, попытаться убедить его. Почему? Потому что на самом деле в реальности в настоящее время химиотерапия направленная на лечение именно этого заболевания, достаточно эффективна. Если учитывать массу работ на эту тему… Ну, давайте попробуем как-то совместно, позвоните мне, я постараюсь с ним переговорить, потому что здесь действительно огромный психологический фактор. За это время медицина сделала огромный рывок именно в лечении этого заболевания.


Ольга Беклемищева: Мы именно так и строим нашу программу, чтобы подчеркнуть, что не нужно отказываться от того, что вам предлагает классическая онкология, нужно только всеми возможными способами ее дополнять, улучшать, потому что сам процесс разрушения опухоли должен произойти, если мы не хотим, чтобы опухоль погубила человека. Методы воздействия – химические, лучевые, они разные, но они должны быть. А вот о том, как оградить остальную часть человеческого организма от негативных воздействий, от вот этих ударов по опухоли, мы и говорим, и метод доктора Борисова – мне он нравится, он замечательный, но есть и другие. В любом случае нельзя отказываться от лечения.


Виктор Борисов: Безусловно. Кстати, на заседании онкологического научного общества в Берлине мне задали вопрос: почему вы называете это реабилитацией больных? Потому что первая наша задача была избавить больного от побочных эффектов различных видов лечения, направленных против раковых заболеваний.


Ольга Беклемищева: А их очень много, это и кардиопатия, нефропатия, то, что говорила Лидия Ивановна. Да, действительно, могут пострадать и почки, и легкие, и сердце. Тем не менее, способы, как обойти эти негативные явления противораковой терапии, существуют, и об одном из них мы вам сейчас рассказываем. Все на самом деле в наших руках.

И следующий слушатель – это Сергей Львович из Москвы.


Слушатель: Я 15 лет работал рентгенологом в 7-й городской больнице в зоне интенсивной ионизации. Последние семь лет я страдаю от аденомы простаты, а проверяться я боюсь, потому что не знаю, что и как.


Ольга Беклемищева: Ну, Сергей Львович, вы же доктор, ну как вы можете не проверяться?


Слушатель: А вы знаете, сами говорили, что стресс хуже влияет, чем сама терапия. Это мы все понимаем.


Виктор Борисов: Так, минуточку, а скрытый страх, стресс – он тоже влияет, это же вы сами себя разрушаете, Сергей Львович, дорогой.


Слушатель: Ну как мне быть, коллега?


Виктор Борисов: Да проще всего – сдайте ПСА и посмотрите, самый простой метод. Кстати, Сергей Львович Загускин – разработчик метода биохронотерапии, а вы его тезка, можно сказать. Я вам скажу, что с раком простаты у нас довольно интересные результаты. В настоящее время это не приговор, поверьте мне. Кстати, и я работал в зоне ионизирующего излучения, и у меня высшая категория по рентгенологии. Так что мы с вами коллеги. Не бойтесь!


Ольга Беклемищева: Вы просто не видите моего гостя. А надо сказать, что Виктор Александрович при своих 65 годах, я уж открою секрет, выглядит, максимум, на 47. Так что надо лечиться, надо.

И следующий слушатель – это Галина Алексеевна из Москвы.


Слушатель: Виктор Александрович, мне 68 лет. Три года тому назад я у себя увидела на носу такое коричневое пятно. Ну, я думала, что это веснушка, она такая шершавенькая. И я обратилась в онкологические диспансер, метро «Войковская», они брали у меня первый год соскоб, говоря: бяка какая-то. И ничего не могли поставить. Второй раз тоже брали соскоб - и не могут определить. А когда я пошла в нашу районную поликлинику (меня клещ укусил), и хирург мне сказал: это у вас базилиома . Скажите, базилиома – это онкологическое заболевание?


Виктор Борисов: Ну, конечно.


Слушатель: У меня внутри носа как бы маленькая такая болячечка, сверху она иногда бывает шершавая, когда умываешься, до носа больно дотронуться. Сейчас я посмотрела, вот третий день, у меня уже идет такой полосочкой к кончику носа. Мне в Герцена предложили облучение лазером и косметическую операцию. Я как-то побоялась это сделать.


Виктор Борисов: Существует несколько способов лечения именно поверхностных раков, базилиомы. Вам предложено было хирургическое лечение лазером. Я так понял, правильно?


Слушатель: Я говорю: будет что-нибудь заметно? Мне говорят: мы вам сделаем еще косметическую операцию, как-то заретушируем что ли, я не знаю.


Виктор Борисов: Ну, это надо видеть, что они вам предлагают. Кстати, базилиома блестяще лечится методом фотодинамической терапии, и родоначальник метода фотодинамической терапии у нас в Москве – это Михаил Александрович, профессор Каплан. Он работает в Обнинске. У него результаты по лечению базилиомы, я считаю, ну, лучшие, наверное, в стране, надо говорить правду.


Ольга Беклемищева: Дело в том, что фотодинамическая терапия как раз очень хороша для поверхностно расположенных опухолей.


Виктор Борисов: Блестящий результат.


Ольга Беклемищева: А метод доктора Борисова, точнее, модификации – она позволяет распространить полезное действие фотодинамической терапии на более глубоко расположенные опухоли.


Слушатель: А к вам я могу записаться на прием? Может быть, вы мне поможете эту проблему решить? У меня она уже третий год.


Виктор Борисов: Пожалуйста, приходите. Но я все-таки рекомендую Михаила Александровича Каплана в Обнинске.


Слушатель: А как к нему попасть?


Виктор Борисов: Очень просто. Там при Обнинском научно-исследовательском институте у них есть поликлиника. Короче, перезвоните мне на работу, подъедете, я вам дам адрес.


Слушатель: Скажите, это может по наследству передаваться, может ли от животных или это пониженная иммунная система?


Виктор Борисов: Скорее, последнее. Я, во всяком случае, сторонник этой теории.


Ольга Беклемищева: Как раз сейчас мне бы хотелось, невзирая на то, что люди звонят, рассказать немножечко о той модификации вашего метода, что повышает его полезное действие. Мы уже несколько раз произносили это слово «хронотерапия». Наверное, нужно расшифровать.


Виктор Борисов: Давайте еще раз попробуем объяснить. Биохронотерапия: родоначальник метода, как я уже сказал – это Сергей Львович Загускин. 30 лет он посвятил изучению работы не только организма, но и каждой клетки, ответа клетки на различные типы физического воздействия. И выявил организацию не только клетки, пространственную организацию, а также и временную организацию. Оказывается, эффективность работы клетки зависит от быстрых ритмов человеческого организма, то есть от ритма пульса, ритма дыхания и ритма тремора. При всем при том вы знаете, что в ритме дыхания существует две фазы, это вдох и выдох. В ритме сердца существует тоже две фазы – диастола и систола. И то же самое в ритме тремора существует. И вот, оказывается, при наложении трех плавающих составляющих, то есть вдох, систола сердца и систола тремора, в этот момент клетка открыта и готова к восприятию любого сигнала.


Ольга Беклемищева: К сотрудничеству.


Виктор Борисов: К сотрудничеству, к работе совместной. Безусловно, применение этой методики одновременно с методом… При всем при том в литературе вы можете найти очень много ссылок, что только методика биохронотерапии появилась, как метод, после того как появились первые компьютеры, потому что мы же понимаем, что это три плавающих показателя, и нет двух одинаковых людей на планете, у каждого свой ритм дыхания, кровообращения, и тремора. И поймать эти ритмы позволило только появление персональных компьютеров. И только после этого этот метод доказал свою эффективность, при том это работа академика Комарова, академика Раппопорта, которые блестяще применяют этот метод в Клинике внутренних болезней. Но кроме этого, мы применили для лечения онкологии. И во всех работах, если вы ознакомитесь, даже в интернете, вы поймете, что это великолепно стимулирует иммунитет. При том обе фазы иммунитета - как клеточный, так и гуморальный иммунитет.


Ольга Беклемищева: То есть еще раз подчеркиваю: воздействие лазером, то, что является ключевым моментом в фотодинамической терапии, синхронизировано для каждого больного при помощи вот этой компьютерной методики с собственными ритмами данного больного, как сказал доктор Борисов, что как раз позволяет, с одной стороны, уменьшать интенсивность воздействия лазером, а с другой стороны, позволяет получить гораздо более высокий эффект.


Виктор Борисов: И глубже проникнуть в ткань.


Ольга Беклемищева: Об этом мы уже как раз рассказывали нашей слушательнице, что с вашей методикой вы можете влиять не только на поверхностные опухоли, но и на внутренние.

И следующий слушатель – Берта Григорьевна из Москвы.


Слушатель: Я сама врач. Родственница у меня живет в Кустанае. Я получила письмо оттуда, что у нее рак груди. К сожалению, четвертой степени с метастазами в легких и печени. И в химиотерапии, и в лучевой терапии ей отказали. Скажите, пожалуйста, что можно сделать в такой ситуации? Ждать конца и все?


Виктор Борисов: Не могу вам, Берта Григорьевна, ничего сказать, потому что мне нужно понять, насколько глубока проблема… Мы берем таких больных на самом деле. Моя коллега Ольга Беклемищева приезжала и видела больных, которые не могли встать, это все сопровождалось рвотой, тошнотой, слабостью, особенно детей, которых носили на руках. В результате мы их вытянули с того света. Я думаю, что в каждом отдельном случае трудно сказать, насколько мы сможем эффективно помочь… Позвоните, попробуем поговорить.


Слушатель: А что для этого надо сделать? По вашему телефону позвонить?


Виктор Борисов: Да, безусловно.


Слушатель: Или, может быть, по факсу послать выписку вам?


Виктор Борисов: Безусловно, телефон, он же и факс.


Слушатель: Можно сказать, чтобы сын послал вам выписку?


Виктор Борисов: Да, конечно.


Слушатель: Вы разрешаете?


Виктор Борисов: Да.


Слушатель: Все. Спасибо вам большое!


Ольга Беклемищева: Следующий слушатель – это Роман из Москвы.


Слушатель: Виктор Александрович, известно, что рак коварен, может развиваться долгое время без каких-либо признаков, и человек не знает, что у него есть рак и ничего не предпринимает. Можно ли этот ваш метод, который меня очень поразил, основанный на взрыве раковой опухоли с помощью хлорофилла, использовать как бы для профилактики? То есть человек как бы еще не знает ничего, но тем не менее, опасаясь будущего, ракового будущего, он просто применяет…


Виктор Борисов: Да, можно.


Ольга Беклемищева: А сейчас я должна поблагодарить нашего гостя. Я напоминаю, что в эфире программы «Ваше здоровье» был доктор Виктор Александрович Борисов. Мы говорили о реабилитации онкологических больных. Я его благодарю за участие. И благодарю всех, кто работал вместе со мной над этой передачей. Всего доброго! Постарайтесь не болеть!


Применение хлорофилла в онкологии - ФунгоДоктор

 

Здоровое питание

Лечебные грибы и снижение веса

Система снижения веса «Ямакиро»

Полезные советы или это надо знать

      - Правила питания

      - Не всякий хлеб полезен

      - Несовместимые пищевые комбинации

      - Вода

О грибной диете

Применение хлорофилла в терапии онкологии

Практические рекомендации по лечебному питанию при онкологических заболеваниях

 

Ученые-химики многократно пытались сделать хлорофилл устойчивым и доступным для применения. В начале прошлого века было получено вещество хлорофиллин - довольно стабильное, но, по существу, искусственное соединение, к тому же растворимое в воде. Этот факт - показатель того, что хлорофиллин не натурален, так как натуральный в воде не растворяется. Искусственно стабилизированные формы хлорофилла используются как пищевые красители и пищевые добавки. Они не имеют системного воздействия на организм.

Возможно, правильным будет одновременное применение хлорофилла с рядом сильных антиоксидантных препаратов. Именно они смогут предотвратить чрезмерно быстрый распад молекул хлорофилла, а значит, действие станет более длительным, мягким. Кстати, при употреблении больших количеств свежей зелени никогда не отмечается хлорофилловая интоксикация. Таким способом здоровью можно определенно помочь. (Особенно это касается  пациентов, после химиотерапии, тех, у кого возникла анемия на фоне общего истощения и интоксикации. Учитывая то, что онкобольные на тяжелых  стадиях часто умирают от последствий опухоли, а не от ее самой  (от анемии и интоксикации), существенное исправление формулы и состава крови позволяет иногда организму собраться с силами, чтобы бороться дальше или даже победить).

Но употребление свежей зелени не ведет к качественной усвояемости хлорофилла - мембрана клеток не растворима в нашем организме. Большая часть хлорофилла не усваивается в кишечнике.

И всетаки, известны положительные результаты терапии онкологии с использованием зелени и зеленых соков. Предложенный рацион оказывается самым эффективным. Ни один другой метод не позволяет достичь результата. Чтобы добиться подобного эффекта, например, используя витамин С, надо принимать настолько большие дозы, что наш организм просто не в состоянии  их усвоить.

Если акцент в рационе сделать на ростки пшеницы, а не на овощи, фрукты, то процент выздоровления будет намного выше. Следовательно, терапевтический эффект происходит при наличии особых хлорофилл-комплексных веществ.

Ученый В. Г. Беспалов  доказал экспериментально, что живые проростки имеют противоопухолевое и антиметастатическое действие. Опыты показали, что прием живых проростков снижает количество метастазов в 7-8 раз.

Описывается лечение онкобольных очищающим постом из соков. Соковая терапия становилась главной частью лечебного курса . Принимались соки свеклы, капусты, ростков пшеницы, стручков, молодых побегов (ежевики и др.), лимона, моркови, сельдерея, яблок. Кроме того, включались отвары из трав (корня одуванчика, из крапивы...), допустимыми были  овощные бульоны. Исследования определили антираковые свойства многих овощей. Но все они не так полезны, как ростки пшеницы и при термической обработке теряют свои целебные свойства.

Основным действующим веществом ростков пшеницы является именно хлорофилл-комплекс.

Лабораторные исследования подтверждают, что экстракты ростков зерен пшеницы и ячменя имеют в составе вещества, помогающие защитить клетки организма от злокачественного перерождения. Ученые точно установили, что это защитное действие – уникальное  свойство ростков. Оно не зависит от какого-либо иного питательного вещества. Также благоприятно влияет оно на иммунную систему.

Применение хлорофилла (живых зеленых соков) в онкологии

Исследователи  обобщили имеющийся опыт терапии ряда  заболеваний (в т. ч. онкологических) с помощью зеленых соков. Высказывается мнение, что свежие соки из ростков пшеницы и других зерновых (кукуруза, просо, овес...), бобовых (горох, фасоль...) и других "живых" растительных продуктов могут оказать помощь в терапии  опухолевых процессов, как добро- так и злокачественных. Не существует" лекарства" против рака. Онкологически больной организм должен сам себя исцелить.

Вещество, которое входит в состав сока из ростков пшеницы и обладает антираковыми свойствами, - витамин В17 (латрил). Впервые его  выделили из абрикосов, но его можно встретить и в других растительных продуктах, в том числе и в ростках пшеницы. Латрил  способен избирательно уничтожать онкоклетки, не затрагивая здоровые. Факт остается фактом: в странах, где жители употребляют много продуктов, в составе которых есть латрил, уровень заболеваемости онкологией  во много раз ниже. Но живые овощи и фрукты не могут заменить зеленую листву.

Соблюдать меры предосторожности необходимо: большое количество зелени не рекомендуется употреблять при наличии язв желудочно-кишечного тракта или при  кишечной непроходимости. Начинать их прием следует с малых пробных доз, постепенно увеличивая их. Проводите самоконтроль своего самочувствия и состояния.

Будьте здоровы!

 

В Киевском центре Фунготерапии, Биорегуляции и Аюрведы ведут прием квалифицированные врачи нетрадиционной медицины. Консультация бесплатная. Истории болезней и результаты лечения вы можете посмотреть по этой ссылке.

Записаться на прием вы можете по телефонам: (044) 331-74-44, (044) 257-01-01, (097) 231-74-44, (050) 331-74-44, (063) 187-78-78, +38(098) 583-85-85 (Viber),  +38(093) 688-25-88 (WhatsApp, Telegram) e-mail:Этот адрес электронной почты защищен от спам-ботов. У вас должен быть включен JavaScript для просмотра.

Также вы можете задать ваш вопрос врачам в нашей группе в Viber "Нетрадиционная и народная медицина для вашего здоровья". В этой группе вы сможете узнать о новых препаратах и методах нетрадиционной медицины, прочитать статьи по теме восстановления и поддержания здоровья, обмениваться опытом исцеления и интересными материалами с участниками группы. Ссылка для вступления в группу https://invite.viber.com/?g=mIFy1dekQkmx-vUOgSli15st9nGvG9Sc
Внимание! Те, кто только что подключился к группе, не могут видеть предыдущую переписку. Не спешите удаляться из группы, дождитесь сообщений или задайте вопрос нашим врачам.

 

 

Реабилитация при онкологии

Метод фототерапии уже более 20 лет используется для реабилитации пациентов с злокачественными опухолями.


Методика, используемая в Центре, признана эффективной для восстановления иммунитета и функций других систем организма после проведения:

  • химиотерапии;
  • лучевой терапии;
  • оперативного вмешательства по удалению опухолей.


Все эти традиционные способы лечения онкологических заболеваний являются агрессивными методами, в той или иной мере тяжело переносимыми больными людьми. В результате их применения происходит повреждение не только раковых, но и здоровых клеток организма, наблюдается глубокое подавление иммунной системы, являющейся основной для сдерживания и устранения всех атипичных и несовместимых с жизнью и здоровьем процессов.


Метод направлен на иммунокоррекцию, легко переносится пациентами. Эффективность контролируется иммунограммой и клиническим анализом крови. Наблюдается улучшение показателей исследований. Постепенно уходят негативные последствия предыдущих традиционных методов лечения рака, давно применяемых онкологами. В зависимости от исходного диагноза и распространенности процесса происходит улучшение качества жизни и активности пациента, продлевается жизнь.


Если злокачественный процесс диагностировали на ранних стадиях, то метод может стать альтернативой привычным способам лечения. После проведенных операций по поводу резекции объемных злокачественных опухолей - этот метод поможет убрать оставшиеся в организме раковые клетки для предотвращения метастазирования.


В случаях неоперабельных, из-за своих размеров, злокачественных новообразований, во многих случаях после применения метода размеры образования уменьшались и пациентам разрешали оперативное лечение.

Хлорофилл


Описываемый лечебный метод включает последовательное и сочетанное использование природного лекарственного вещества, вводимого в определенные точки тела и двух физиотерапевтических методов (фотодинамическая- и биотерапия). Вводимый подкожно хлорофилл обладает свойствами фотосенсибилизатора, т.к. получен из зеленых водорослей в которых с его участием происходит явление фотосинтеза, обеспечивающего использование энергий квантов света в биохимических реакциях.

После введения препарат подвергается активизации с помощью световой энергии, излучаемой специально разработанным физиотерапевтическим прибором. В этом приборе в резонансе используются два передовых научных метода: биотерапия и фотодинамическая терапия.


Кроме того, вышеупомянутое лекарственное вещество на основе хлорофилла - является успешной разработкой ученых соотечественников - хлорин Е-6. Этим препаратом, единственным из препаратов на основе хлорофилла, пригодным для подкожного, внутримышечного и даже внутривенного введения, кормят клетки, ставшие атипичными, чтобы они потом под действием лазерных лучей, поступающих в ткани одновременно с периодом кровонаполнения сосудов и одновременно с моментом вдоха, самоликвидировались. Благодаря именно такому способу воздействия лазерное излучение проникает на более глубокую глубину. В результате - активации подвергается даже вещество, поглощённое клетками глубоко расположенных опухолей.

Курс восстановительного лечения состоит из девяти процедур с парентеральным введением хлорина Е6. Со следующего дня после окончания процедур пациент должен самостоятельно в домашних условиях вводить по назначенной схеме ректальные свечи и принимать капсулы "Виалайф" с хлорофиллом и прийти 1-2 раза в клинику для активации лазерным аппаратом.


Для достижения терапевтического эффекта такой цикл процедур длительностью в один месяц необходимо повторить подряд 3 раза, что занимает 3 месяца. Повторное назначение зависит от динамики заболевания и назначается индивидуально через 3,6 или 12 месяцев.


Во время взаимодействия хлорина и лазерного излучения определенной длины волны в клетках злокачественной опухоли развиваются высокотоксичные фотодинамические и биохимические реакции, которые приводят к их повреждению. При этом соседние здоровые клетки сохраняются неповрежденными. Это возможно из-за особенностей обмена веществ и кровоснабжения недифференцированных раковых клеток.


При поглощении фотонов света атомы хлорофилла переходят в возбужденное состояние что сопровождается излучением света - флуоресценцией. Этот эффект можно отследить на мониторе, подключенному к прибору. Наблюдается свечение тканей пациента различной степени выраженности и распространенности.

Хлорофилл помогает удалять раковые клетки

В результате происходящих изменений в зоне новообразований, опухоль, до этого подавляющая иммунитет, чтобы оставаться невидимой для него, становится обнаруженной и опознанной как чужеродное образование.


Клетки иммунной системы начинают эффективно выполнять свои функции. Одни иммунокомпетентные клетки разрушают атипичные клетки, другие захватывают распадающиеся клетки, третьи презентуют их участки-антигены другим клонам лимфоцитов, как фотографию преступника. 3апускаются механизмы восстановления внутренней среды организма


Параллельно с уничтожением раковых клеток иммунная система реализует противовоспалительное и очищающее действие.


Хлорин Е6 проявляет свои природные лечебные эффекты:
  • насыщение тканей кислородом;
  • антиоксидантное действие;
  • повышение активности всех систем организма;
  • способствует синтезу эритроцитов крови;
  • регенерации тканей.

Почему не заботимся о состоянии иммунной системы?


Давно известна главенствующая роль иммунитета в борьбе с любой болезнью.


Почему же мы - такие умные, современные, кажется, что образованные, в 21 веке так легкомысленно и покорно ждем “своего часа”? Не заботимся о состоянии иммунной системы организма? Не говоря уже о том, как курением, алкоголем, ненатуральными и ГМО продуктами самостоятельно убиваем свой организм - храм нашей души.


Метод способен защитить любого из нас заблаговременно, еще до наступления каких-либо неполадок и проблем в организме.


Может быть лучше просто не допустить снижения уровня активности иммунитета , а если надо - то укрепить его? И тогда, вредные клетки в борьбе с полезными будут всегда обречены на поражение.


Курс лечения, направленный на увеличение собственных сил организма, на профилактику заболеваний состоит и 6-7 процедур в условиях клиники и рекомендуемо проводится 1-2 раза в год.


Для получения консультации запишитесь на прием или позвоните нам по телефону: +7 (905) 279-99-97

что можно и чего нельзя при раке

Что МОЖНО и чего НЕЛЬЗЯ при раке из продуктов НСП… И почему вопрос «натуральное, как помощь при онкологии» имеет право быть задан?

Довольно много ученых задавалось таким вопросом! И исходя из развития рака, раковой опухоли, исходя из изучения базовых механизмов развития рака, исходя из понимания современного лечения и постановки диагноза рака, биомаркеры, составление моделей как развивается этот процесс, биологические компоненты и механизмы раковой интоксикации, имеют право на существование альтернативные методы поддержки онкобольных (те, которые не мешают основной терапии, не конкурируют с ней, не вытесняют ее и реально оказывают помощь при онкологии).

Почему про онкологию нужно помнить? Почему онкопротекция касается всех? Потому что, чем старше человек становится, тем выше риск возникновения рака…

Следующий график показывает рост новообразований и заболеваний системы кровообращения.

Выглядит довольно страшно… И не случайно… Когда были открыты ворота для еды низкого качества и когда произошел такой слом в устройстве государства — все это сказалось на здоровье населения. Добавьте сюда же Чернобыль, алкоголь, табак… многие факты повлияли!

Вклад Чернобыля в рост рака груди, йододефицитные области Украины.

Украина: до 1986 года рак щитовидной железы случался 1 раз в год, после 1986 года в национальном раковом реестре – более 3 ТЫСЯЧ детей с раком щитовидной железы. Как видно на слайде – в Республике Беларусь ситуация (в пересчете на 100 тыс. населения) еще хуже.

Что здесь хочется сказать: цель дожить до определенной возрастной группы уже несет за собой риски возникновения рака! Если речь идет о человеке с подтвержденном диагнозом «РАК», то нужно задать вопросы, которые помогут Вам решить, чем можно здесь помочь?

1. Что ему точно НЕЛЬЗЯ применять.
2. Как его лечат (сроки проведения, операции, препараты, облучение).
3. Точный диагноз и вероятность семейных форм рака.
3а. Чем помочь родственникам.
3б. Узнать все о прошлых поколениях в этой семье (были ли раки у родных).
4. Как Вы собираетесь оказать помощь? Воздействовать на опухоль? Помощь по другим направлениям (малокровие, запоры – поносы, простуды, аллергозы и т.д. ).

Есть люди, которым нельзя оказать помощь – но НЕТ людей, которым нельзя навредить.

Письмо. Пишет мать больной женщины. У больной – рак яичников, метастазы, прошла операции и химиотерапию.

Из письма: «перед химией и во время я давала дочери… (название витаминных коктейля и таблеток одной из фирм млм) и алоэ. Можно ли Железо из вашей компании НСП ей добавить? Показатели крови были отличные, она прекрасно перенесла химию, врачи были в шоке»…

В шоке были не только лечащие врачи…
Поливитаминные коктейли и таблетки (в которых много витаминов группы В, присутствуют БИОстимуляторы) и алоэ – это стимуляторы клеточного деления.

ЗАЧЕМ соглашаться на химию, если сводить ее результаты в МИНУС? МИНУС – оттого, что и с химией, и без нее АЛОЭ И ВИТАМИНЫ для онкобольного могут означать все что угодно, кроме продления его Жизни и помощи.

Те «доходяги», которых мать онкобольной не уговорила купить чудесный набор из ее млм-компании – многие живы и до сих пор.
Пережить химию МОЖНО, если не ускорять рост опухоли и ее метастазирование.
Шансы ЖИТЬ после химии – точно есть.
А после «чудо-коктейля» и алоэ — ?

Ещё пример. 5 лет после удаления опухоли, метастазов нет, всё спокойно.

Совпал первый (после начала болезни) прием витаминов (отечественный поливитаминный комплекс из аптеки) со сдачей анализа на онкомаркеры. 10 дней приема витаминов – и сдача крови на онкомаркеры.
Онкомаркеры ВЫРОСЛИ в сотни раз.
Онколог сказал, что нужно искать метастазы и проверять все, что можно проверить. Предложил сразу госпитализацию. «На всякий случай – готовьтесь к химиотерапии».
После отмены «витаминов из аптеки» и ударного их выведения Е-чаем – онкомаркеры вернулись к норме.

А если бы не?
— не проверили онкомаркеры,
— не послушали бы врача,
— не прекратили бы приём поливитаминов?…

ЙОД: «вообще» – крайне хорошее вещество.

Жизненно важное.
Но при раке щитовидной железы ЙОД убирают из рациона – потому, что лечат рак (убивают «убежавшие» от операции раковые клетки, профилактируя метастазирование) РАДИО-ЙОДОМ.
Накормленные «хорошим» йодом, раковые клетки НЕ ВОЗЬМУТ радиойод. И не погибнут..
«ЙОД вообще полезен для ЩЖ» – и «ЙОД можно при конкретной болезни»: это НЕ ОДНО И ТО ЖЕ.

Один из самых дорогих (оплаченных по высочайше цене) принципов ведения онкобольных:
НЕ НАВРЕДИ. И еще – ЗАБУДЬ ВСЕ, ЧТО ТЫ ЗНАЛ ДО СИХ ПОР. Многое не работает. Многое – вредит.
Например, «домашняя аптека на подоконнике»… алоэ-каланхоэ-столетник-чистотел… вкупе с рецептом «керосин от рака» – это хиты среди антинародных заблуждений.
Йод «от щитовидки» и «травки вместо химии» – из той же серии.

Категорически НЕЛЬЗЯ при онкологии:
Активаторы клеточного деления – под ПОЖИЗНЕННЫМ запретом (поливитаминные коктейли и таблетки, в которых много витаминов группы В, присутствуют БИОстимуляторы…).
НЕ категорически, но лучше НЕ применять: все то, что усиливает микроциркуляцию (первые годы после постановки диагноза – точно НЕ применять, потом – на усмотрение онколога, но почти всегда онкологи против).Продукты НСП, способные помогать онкобольным (не просто «не запрещено» – а действительно есть положительное влияние на больного), это:
Пау Пау
Шарк Рей
«По Д’Арко НСП» (УКРАИНСКАЯ)
Е-чай
Грепайн
Флора, Лецитин, Коралловый Кальций
Келп (если речь НЕ идет о раке щитовидной железы)

 

Есть такое слово — АНГИОГЕНЕЗ. Ангиогенез — появляются НОВЫЕ сосуды (рост детей, беременность, рубцевание ран…).

В принципе, в ангиогенезе ничего плохого нет, если это не ангиогенез в раковой опухоли! Целый ряд раков развивается именно за счет развития новых сосудов.

И ученым пришло в голову заблокировать эти самые сосуды. Стратегия угнетения роста опухоли — через антиангиогенные лекарства.

Идея правильная, идея остроумная и идея жизненная. Она используется в онкологии очень широко. Обратите внимание на этот слайд.

Здесь интересно не столько то, что экстракт хряща используется в качестве ангиогенного ингибитора, как угнетатель развития новых сосудов, а сколько список литературы, где эта информация упоминалась (международная конференция сообщества интегративной онкологии). Очень интересные факты были доложены. Например, уже в 1983 г в журнале Science было опубликовано, что акулий хрящ содержит ингибиторы ангиогенеза.

Хрящевая ткань не имеет кровеносных сосудов, поэтому питание клеток осуществляется посредством циркуляции жидкости, доставляющей питательные вещества с поверхностных слоев хряща (надхрящницы у реберного хряща, снабженной разветвленной капиллярной системой, или блестящей пластинки у суставного) через микропористую систему. Размер пор в здоровом хряще составляет 10 – 30 нм. В тех случаях, когда этого недостаточно, возможно прорастание в хрящевую ткань инвагинаций соединительной ткани с капиллярами , что может влиять на упругие свойства хряща. (http://www.chem.msu.ru/rus/theses/2015/2015-06-08-soshnikova/fulltext.pdf)

Как сдерживается нео-ангиогенез проверили на куриных яйцах. В куриные эмбрионы вводили вытяжки из разных хрящей.

И именно вытяжки из хрящей АКУЛЫ показали лучшие результаты (хотя и было доказано также, что у самих акул БЫВАЕТ рак).

Рекомендации по дозировкам акульего хряща некоторых млм- (и не-млм) компаний:
— «1 капсула 2 раза в день для ПОДДЕРЖКИ больного или для профилактики», — это вообще НИЧЕГО для блокирования роста новых сосудов;
— «от 50 капсул в день», — это честно. Но дозы в капсулах – мизерные.

Компания НСП вообще никаких обещаний и заявлений по онкологическим БОЛЕЗНЯМ – не делает (производителям Биологически активных добавок нельзя делать таких заявлений), хотя такие результаты есть, и их много.

Если соотнести концентрацию вещества, и содержание в каждой капсуле, то по Продукту НСП Шарк Рей получается доза от 10 (12) капсул в сутки и до 15-20 капсул (при рисках быстрого метастазирования, при рисках прорастания опухолей в магистральные сосуды – например, рак гортани).

О профилактическом приеме Шарк Рей тоже многое сказано и написано. Продукт прекрасен!
— Хрящ акулы прекрасен для питания опорно-двигательного аппарата.
— Гриб Рейши в составе данного продукта прекрасен для поддержки иммунной системы.
— В мирное время, без тяжелой патологии, этот продукт идеален для современного НЕбеременного человека.

Шарк Рей при болезнях, которые не сопровождаются неоангиогенезом можно не использовать, тк как нет точки приложения.

Лейкозы, саркомы, меланомы… При лейкозе нет той «мишени», к которой можно приложить Шарк Рей (сдерживание неоангиогенеза здесь не решит основную проблему).
Главная цель в применении Продукта НСП – поддержать человека, которому жизненно важны химиотерапии и (возможно) предстоит пересадка костного мозга. И не навредить при этом.
Здесь уместно принимать Е-чай, Коралловый Кальций, Флору…

Что касается Е-чая — очень долгая история в поддержании раковых пациентов в живом, работоспособном, бодром состоянии. Многие знают историю про этот чай. Уже скоро пройдет 120 лет, как этот чай был апробирован.
Что принимать при онкологии, помощь при онкологии, помощь при раке
У «По Д’Арко НСП» тоже очень древняя история применения. По Д’Арко угнетает рост клеток при раке груди, докладов на эту тему сделано много. Книг написано тоже много!

Очень хорошо принимать при онкологии пикногенолы (антиоксиданты НЕ витаминной природы):

В НСП это такой продукт, как Грепайн. Много говорится о том, что экстракты виноградных косточек и другие продуты из винограда являются онкопрофилактикой, а также способом борьбы с раком. (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2728696/)

Кто об этом пишет? Журнал, который привык отвечать за свои публикации. (Welcome to NCBI. The National Center for Biotechnology Information advances science and health by providing access to biomedical and genomic information.)

И на самом деле получается, что исследования есть!

MedicalXpress (по данным университета Колорадо Denver) пишет о том, что экстракт косточки винограда убивает раковые клетки головы и шеи, оставляя здоровые клетки неповрежденными.

BBC NEWS также опубликовал о том, что экстракт винограда убивает раковые клетки.

В итоге изучения всего опыта применения растений и акул, как помощь при онкологии (и созданных из них БАД) получилась Базовая Программа НСП с применением таких натуральных средств как: Шарк рей, По Д’Арко, Е-чай, Грэпайн.

Базовая Программа НСП при онкологии
Помощь при раке

Можно и даже нужно:
Шарк Рей
«По Д’Арко НСП» (УКРАИНСКАЯ)
Е-чай
Грепайн
Вышеперечисленные продукты имеют судьбоносное влияние на состояние онкобольных. Оказывают прямое влияние на само заболевание! Но НЕ ИСПОЛЬЗУЮТСЯ вместо химиотерапии, не вместо лучевой терапии или вместо операции, а только в дополнение и не мешая предложенной медициной терапии!

Для поддержки онкобольного также рекомендуется использовать Флору, Лецитин, Коралловый Кальций, Локло

Между «химиями» и БЕЗ совмещения с антиоксидантами – Пау Пау (2-3 раза в году – перерывы в приеме на 1 месяц).

 

Иногда спрашивают, что лучше: Грепайн или Индол?
Ответ: Грепайн.
Это именно ТОТ Продукт, который возможно пить всю жизнь без перерывов.
Индол – не тот.
Наличие фарм препарата, который близок по составу с Индолом (и там рекомендации – почти «пить как воду, ведрами и без перерывов») – мне не кажутся оправданными. Главное обоснование не пить долго в профилактике рака – субстратная перегрузка печени. Кому интересно – поищите.
ГРЕПАЙН безопасен и эффективен при длительном приеме (онкобольными и здоровыми).
Что принимать при онкологии, помощь при онкологии, помощь при раке

Как конкретно пить онкопротекторы?

Отделить от курсов химио-, лучевой терапии на 3 дня (отменить за 3 дня до и начать через 3 дня после). Почему 3 дня?

Я считала периоды полувыведения фарм препаратов для химиотерапии… нужно было знать названия препаратов, схему их применения, дозирование… я высчитывала их взаимодействие с компонентами БАД НСП… высчитывала, когда выведутся Продукты НСП (перед химией) и как они «наложатся» на химию, если их свалить в одну кучу (все вместе – и БАДы, и химия…).
Если коротко, то: 3 дня – безопасный интервал. Он может быть меньше, ЕСЛИ ВЫ УЧЛИ И ПОСЧИТАЛИ все, что можно учесть и посчитать.

Нет возможности учитывать и рассчитывать? — Пользуйтесь готовым безопасным решением: 3 дня.

Как быть, если химиотерапия назначается не отдельными курсами, а частыми дробными введениями?
Как быть с препаратами «от рака» (влияющими на гормональный фон), которые надо применять каждый день?
Тамоксифен, например.
Ответ тоже базируется на расчетах (любое ЖИЗНЕННО ВАЖНОЕ лекарство нужно пить, ОТДЕЛЯЯ от Продуктов с детоксицирующими свойствами).

ЖИЗНЕННО ВАЖНОЕ лекарство – например, лекарство, которое при ЭПИЛЕПСИИ избавляет человека от приступов. Вы не можете «выбросить» ТАКОЕ лекарство из организма!

Пример из жизни: человек начал пить Хлорофилл. Лекарство от эпилепсии (которое всегда помогало, приступов не было) – сразу после Хлорофилла. Приступы ПОЯВИЛИСЬ ВНОВЬ. Врач (эпилептолог) посчитал, что лекарство нужно менять («старое» не работает)… Перенесли Хлорофилл на 2 часа от приема лекарства – и о чудо! Все работает, с желудком и печенью – идеально, приступов нет… И польза от Продукта НСП есть, и эффект от ЖИЗНЕННО ВАЖНОГО лекарства – есть.

Если проще, то:
а) дайте препарату усвоиться (не запивайте его Хлорофиллом, Фет Гребберзом или Локло).
б) не ускоряйте его выведение из организма (Каскарой, например. Каскару пить можно, конечно – но не в один прием с лекарством. Интервал — хотя бы в 2 часа).

Как конкретно пить онкопротекторы?

1. Отделить от курсов химио-, лучевой терапии на 3 дня (отменить за 3 дня до и начать через 3 дня после).

2. поставить четкую цель – ЗАЧЕМ Вы применяете Продукт НСП? «От запора», «от головы», «от тошноты», «от ожогов на коже» – это нормальные цели. «Сдержать опухолевую прогрессию» – тоже вполне реалистичная цель. «Повысить качество Жизни», «продлить Жизнь»…

Поделим цели на тактические (текущие задачи: интоксикация, запоры, ожоги) и стратегические (сдержать опухолевую прогрессию, жить дольше, с большим ресурсом энергии и сил).

Для решения тактических целей, текущих задач (интоксикация, запоры, ожоги…): используйте все что не запрещено в таком режиме, который не мешает проявляться эффектам лекарств (если их прием продолжается – БАДы отодвинуть на 2 часа от приема лекарств), химиотерапии (БАДы отодвинуть на 3 дня «до» и «после»).

Стратегические цели (сдержать опухолевую прогрессию, жить дольше, с большим ресурсом энергии и сил): схема «Акулий хрящ, «По Д’Арко НСП», Грепайн и Е-чай» апробирована более 30 лет назад. На нашу территорию БАДы как таковые пришли лет 20 назад – но они УЖЕ БЫЛИ где-то, и именно «где-то» они использовались широко и массово.

Историю открытия чая «Эссиак» (Ечай), По дАрко и Акульего хряща мы все знаем.

Про экстракты виноградных зерен и коры морской сосны (пикногенолы!) – тоже хорошо известно, этим открытиям сотни лет. Современная наука позволяет доказывать эффективность тех средств, которые были проверены многими поколениями. Более того: сохранить СТАБИЛЬНОСТЬ смесей под силу немногим производителям (чай «Эссиак», например, заваривался прямо перед употреблением из-за нестабильности смеси компонентов).

Заваривать Эссиак предлагают до сих пор… потому, что компоненты в стабильном состоянии удержать невозможно (не имея СУПЕРсовременного производства).

Е-чай от НСП: это экстракты растений, которые стабильны, эффективны и ультра-концентрированы!

Рене Каиссе (медсестра, которая использовала древний индейский рецепт для помощи своей онкобольной тети) – утверждала, что детоксикационные и восстанавливающие силы свойства Ечая будут востребованы и будущими поколениями. Она была права.

Детям: при запорах, простудах, — это средство абсолютно безопасно и натурально!

Е-чай: стабильный (не теряющий эффективности при смешивании и длительном хранении компонентов), стандартизированный, надежный и БЕЗОПАСНЫЙ! Это чудо современной науки и техники, объединяющее опыт веков и самые передовые технологии!

Вопрос, который часто задается: почему усиливать циркуляцию ЛИМФЫ при раке недопустимо? Потому что после операции по поводу рака груди часто встречается ЛИМФОстаз. Лимфотические каналы для распространения опухоли — это тоже работает против больного человека.

Поэтому не рекомендуется усиливать циркуляцию лимфы. Здесь я рекомендую к Базовой програме, описанной выше, добавить Протеазу плюс.

Шарк Рей: в дозе более 10-12 капсул в сутки блокирует НЕО-ангиогенез (развитие новых капилляров).

А если прекратить прием Шарк Рей — ?
В моей практике были только очень сложные случаи. И прием Шарк Рей (полной Базовой Программы) никогда не прерывался.
«Отказники» (больные, выписанные домой без лечения, только с обезболиванием) – применяли полную Базовую Программу.
Опыта с прекращением Базовой Программы – просто нет.

Много информации об использовании Шарк Рей, Грепайна, «По Д’Арко НСП», Е-чая накоплено за пределами «онкологической» темы. Эти Продукты – как минимум, безопасны (Грепайн у людей с мочекаменной болезнью требует доп. водной нагрузки).

В онкологической практике – есть сдерживающие факторы. Почему медицина не хочет вникать в добавки?

Медицина не вникает по существу в идею «БАД для онкобольного».

Наука идет вперед, есть прорывные открытия (врачу нужно успеть понять, изучить, освоить, внедрить), есть и проблемы (о которых знает каждый, кто обращался хоть раз за мед помощью).

Что не устраивает врачей в плане идеи «добавки для онкобольного»? – МНЕНИЕ ДОКТОРОВ: «Шаманский подход, когда «травки безопасны, а ваша «химия» травит народ» — не надо бросаться такими фразами во врачей, так как да, от химии плохо, но она и делается, чтобы потом стало хорошо!). «Партизанское» использование ЗАПРЕЩЕННЫХ веществ (витамины «для крови», иммуно- и биостимуляторы «от химии», непрозрачные «авторские» смеси от АНТИнародных целителей – состав неясен, польза неочевидна, вред налицо)».

Лично МОЯ практика: я бралась только за тех, кто ПРОСИЛ о помощи сам и был готов к приему БАД. Меня всегда пугает, если в переписке указано «согласны на все». Рефлекс уже выработался…

Люди, «согласные на все» – это «отказники». ОТ НИХ отказалась медицина, — было прямо сказано, что выписывают домой. И это ненадолго.

Более 30 ТАКИХ больных, которых я, как врач вела лично. Более 100 человек – заочная переписка. И это все было апробировано в те времена, когда… Когда в НСП (на нашем рынке) еще не было Пау Пау.

Ацетогенины Пау Пау (120 капсул в упаковке, по 1 капсуле 4 раза в день): селективно регулируют производство АТФ (основная система накопления энергии в клетке) в специфических клетках, связывая ферменты синтеза АТФ. Регуляция этого процесса влияет на скорость роста злокачественной опухоли, которая требует повышенного содержания кислорода и очень чувствительна к гипоксии.

Пау Пау — это уникальная запатентованная разработка компании, которая содержит стандартизированый эстракт ацетогенинов (Acetogenin), обладает селективным воздействием на поражённые клетки, сокращает синтез АТФ в митохондриях повреждённых клеток, регулирует рост кровеносных сосудов в пораженных тканях.

Как работает «базовая» программа?

1. Сдерживание роста опухоли. Сдерживание метастазов – речь идет о тех опухолях, которые растут за счет капилляров (рак кишечника, рак легких, рак желудка, гинекологические проблемы, включая НЕ раковые, и т.д.). НЕ лейкозы. НЕ саркомы. Не опухоли мозга (за гематоэнцефалический барьер проникает мало полезных веществ).

2. Помощь в восстановлении иммунной защиты (насколько возможно ее восстановить). Речь НЕ ИДЕТ об иммуностимуляции. Иммуностимуляторы НЕ ПОЗВОЛЕНЫ (кроме назначений специалистов). Двойное использование термина «иммуностимуляция», – его применяют и к растениям, КОТОРЫЕ В ДАННОЙ СИТУАЦИИ ПОД ЗАПРЕТОМ, и к узкому сегменту лекарств – которые применимы по усмотрению специалистов.

Кстати. В нашем веке стало возможным проведение индивидуализированной терапии – из тела человека изымаются иммунные клетки и они ОБУЧАЮТСЯ уничтожению раковых клеток! (в них вживляются нужные гены). Это а) ново, б) дорого, в) есть обнадеживающие результаты. Когда наука идет вперед… старые проверенные средства тоже применимы!

3. Помощь в восстановлении нормальной работы систем и органов (которые всегда страдают – и от основного заболевания, и от лечебного воздействия). Вот эта ПОМОЩЬ может быть оказана только четко очерченным кругом Продуктов НСП, которые не запрещены. БАЗОВАЯ ПРОГРАММА может быть дополнена Лецитином, Коралловым Кальцием, Флорой, Серебром, Железом.

4. БАЗОВАЯ ПРОГРАММА может быть дополнена и усилена Лецитином, Коралловым Кальцием, Флорой, Серебром, Железом. Лучше, если эти Продукты предлагаются сразу же с БАЗОВОЙ ПРОГРАММОЙ. Омега3— ввиду ее влияния на свертывание крови, нужно прояснить, какая ситуация у конкретного человека. Какие операции, лекарства применяются (и будут применяться), есть ли проблемы с повышенной кровоточивостью.

Вместе с Лецитином, Коралловым Кальцием, Флорой, Серебром, Железом (5 таб в месяц) – реальное ощущение прилива сил.

ПРИМЕР. Больной, 71 год, прооперирован по поводу жкк (желудочно-кишечного кровотечения). Кровоточащие дефекты («дырки») были ушиты, несколько участков кишечника было удалено (кишечник ушит, коммент хирурга – «швы могут развалиться, вся брюшина поражена метастазами»). На УЗИ – метастазы в печень. С соответствующим диагнозом БЕЗ рекомендаций по лечению выписан домой. «максимум неделя».

Выбора не было. Я просто начала консультировать «ничейного больного».
Шарк Рей – вроде и страшно (тормозит развитие капилляров – значит, будет замедленное срастание швов?), на первую неделю выбрали дозу в 4 кап в сутки (по 1 кап 4 раза, разводили в воде, сами капсулы больной не получал, только раствор).
Е-чай – 12 капсул в 0,5 л воды размешали, пил целый день понемногу.
«По Д’Арко НСП» и Бифидофилус – так же, как Е-чай.
Грепайн – под язык, рассасывать, 6 таб в день.

Через неделю:
добавили Шарк Рей до 12 кап в сутки, в 0,5 л воды смешали, пил целый день,
Е-чай –12 капсул в 0,5 л воды размешали, пил целый день понемногу.
«По Д’Арко НСП» –12 капсул в 0,5 л воды,
Бифидофилус — 12 капсул в 0,5 л воды,
Грепайн – 6 таб в день,
Коралловый Кальций – 2-3 мерн ложки в 0,5 л воды.

Еще через неделю — Лецитин по 2 кап 2-3 раза, Серебро натощак по 1 стол ложке (неделю пить – 2 недели перерыв)…

Через 1,5 года этот онкобольной пошел «на проверку» к своему хирургу.

Пошел САМ. Пешком (до больницы — 2 остановки). Вернулся крайне огорченный. У хирурга случился инфаркт, работать не может, «набрали молодых, я никого из них не знаю, а карточку мою не нашли».

Онкобольной получал всё из Базовой Программы + Лецитин, Серебро, Железо, Омегу-3, Кальций с Вит Д, Хондроитин… Прожил на Базовой Программе еще 4,5 года. Умер от тромбоза. Обслуживал себя сам. В магазин, по дому – все сам.

Этот результат я не обнародовала. Но он пригодился. Таких «отказников» было много. Очень похожие ситуации (рак кишечника, метастазы, человек выписан домой, противоболевые препараты назначены с замечанием «это ненадолго») — повторялись неоднократно. 30 человек вела лично, более сотни – в переписке, сколько рекомендаций было дано родственниками больных другим людям – я не в курсе.

Были ли неудачи? – Да.
«Купили, но не успели дать»…
«Пошли к местной бабке, она сняла порчу, сказала что все будет хорошо… через день — …»…
«После химиотерапии отказала печень»…
«При облучении пережгли мочеточник, делали операцию, присоединился сепсис»…
«Купили все назначенное в аптеке в (название соседней европейской страны, где все дешевле). Результата вообще никакого не было… как врач сказал – максимум месяц, так и вышло» …
«Купили все по списку на интернет-ресурсе, где добавки многих фирм продаются, выбрали где дозы повыше и подешевле… без пользы»…
Опоздали.
Пошли по «бабкам и дедкам».
Осложнения основной терапии (они встречаются в практике, но они НЕ ДАЮТ ПОВОДА ОТКАЗЫВАТЬСЯ от основного лечения. По крайней мере – ТАКОЕ решение принимает НЕ ТОТ, кто предлагает Продукт НСП).
Искали «фирму подешевле». Нашли…

Кстати – о витаминах, биостимуляторах и адаптогенах.
Часто встречаю вопрос – «вот люди из других фирм запрещенный продукт берут и пьют, и им не плохо. Почему в НСП так нельзя?»
Ответ. Потому, что НСП указывает реальное содержание вещества в каждом Продукте. При проверке одного «витаминного препарата из аптеки» оказалось, что реально в нем нет и 20% от заявленного состава. «Травные препараты» тоже этим грешат. Заявлено дорогое растение – присутствует… мягко говоря – сено.

Напрашивается анекдот про лошадь, которой надели зеленые очки, чтобы сено выглядело как молодая трава.

Вы считаете, что производители БАД все честны и бескорыстны?

Давайте будем так считать. Однако, сама возможность ПРОВЕРКИ сырья на безопасность и эффективность недоступна ОЧЕНЬ МНОГИМ производителям, которые сбывают свой товар «к нам».

Эксперты: 80% БАД для улучшения потенции содержат запрещенные вещества
Большинство продающихся в аптеках биологически активных добавок для улучшения потенции содержат фармакологические субстанции, бесконтрольное употребление которых может нанести вред здоровью, сообщили на пресс-конференции в МИА «Россия сегодня» эксперты по итогам исследования, проведенного в апреле 2015 года. (https://ria.ru/society/20150610/1069263326.html)

Доверчивые пациенты понятия не имеют, что они на самом деле принимают под видом безобидных травок. Мало того, что такие фальсификаты представляют серьезную опасность для жизни и здоровья, они еще могут спровоцировать бесплодие у мужчин в возрасте 25-45 лет. К тому же эти лекарственные вещества обладают нейро-, нефро и гепатотоксичностью — назначать их должен только врач, который учтет все особенности пациента. Кроме того, их нельзя принимать даже с некоторыми продуктами, например, грейпфрутами — это может привести к смертельному исходу. Такие случаи, увы, зафиксированы. (http://www.mk.ru/social/2016/05/27/ostorozhno-falsifikat.html)

С проблемой тадалафиловых фальсификатов сегодня хорошо знакомы во всем мире. Российская ситуация не стала исключением в мировой практике. Эксперты говорят, что сегодня доходы этого теневого бизнеса сравнимы с доходами от торговли контрафактным алкоголем или оружием. При этом бизнес этот высокотехнологичный, и фармпираты прибегают к различным инновациям, ухищрениям, постоянно внедряя новые технологии фальсификации. В США даже создали информационную базу фальсифицированных БАД. Одних только «лже-средств» для потенции с тадалафилом там более 60 наименований.(http://www.mk.ru/social/2016/05/27/ostorozhno-falsifikat.html)

Например, прошлогодняя проверка показала, что в добавках «Сеалекс Форте» и «Аликапс» субстанции тадалафила содержались в желатиновой оболочке капсулы! …с подобными пиратскими технологиями ранее сталкивались в Сингапуре, где в оболочке капсул БАД хххх(в России он продавался как хххх) нашли тадалафил. Кстати, названную добавку отозвали с рынка в июле 2015 года, Роспотребнадзор аннулировал свидетельства о ее государственной регистрации.

А на днях стало известно, что с рынка Белоруссии, Армении и Казахстана были отозваны и добавки «Сеалекс Форте» и «Аликапс». «В них не просто есть фармакоактивные субстанции, которые при бесконтрольном приеме могут представлять реальную угрозу здоровью и жизни, — говорит директор Департамента конкурентной политики в области государственных закупок Евразийской экономической комиссии Сергей Максимов. — Сейчас главное следственное управление СК РФ ведет расследование по уголовному делу, возбужденному по этому поводу. В том числе, по факту оборота фальсифицированной продукции». (http://www.mk.ru/social/2016/05/27/ostorozhno-falsifikat.html)

Как обманывают потребителя?
Систематически.
Уровень Гос. Контроля пока не соответствует необходимым стандартам.
Потребителя в «новых» европейских странах обманывают крупные производители продуктов питания.
Потребителей БАД во всем мире обманывают, вводя в состав запрещенные фарм. Субстанции (эффективные, но крайне опасные), или подменяя заявленное дорогое сырье на «сено».
«Урезание» доз витаминов, минералов, отсутствие заявленных в составе веществ – это НЕ НОВО.

Надежность, безопасность, качество НСП – это не слова.
Это реальная Миссия Компании.
С 1972 года – ни одной жалобы на качество!
При жесточайшем контроле со стороны FDA (при внезапных проверках, на которых и FDA имеет право, и которые всегда могут быть инициированы по обращению потребителя или конкурирующих компаний…)

Осознанный выбор ЛУЧШЕГО Продукта.
НИИ, созданный Компанией НСП для углубленных научных исследований.
Лучшая Команда Ученых,
Суперсовременное техническое оснащение,
Изучение векового опыта траволечения и внедрение всех знаний в Лучший Продукт…
Это и есть НСП.

Онкопрофилактика — именно ТО направление, которое требует абсолютно чистого, гарантированно качественного и эффективного Продукта. «Продукты не для лечения, а просто для здоровья» – это тоже повод выбрать ЛУЧШЕЕ!

 

Подумайте о том, что РАК имеет отношение не только к семьям уже больных раком. Онкопрофилактика нужна всем:
Грепайн (антиоксидант, онкопротектор, детоксикант).
Кальций с Вит Д (или Коралловый Кальций) – 1 000 мг кальция в сутки, поделить на 4 приема (защита от стронция, связывание и инактивация канцерогенов).
Флора (профилактика рака кишечника).
Локло (профилактика рака кишечника, груди и др локализаций).
Серебро, Хлорофилл, Флора – профилактика рака желудка (канцерогенный Хеликобактер нужно убирать)
Е-чай (детоксикант, онкопротектор).
Омега-3, Лецитин – защита иммунитета, печени, онкопротекция (снижение поражающих эффектов избыточной Омеги-6 при достаточном поступлении Омеги-3).
Келп – онкопротекция (связывание радионуклидов и др канцерогенов, активация противоракового звена иммунитета).
Аминокислоты (особенно СЕРОсодержащие) + поливитамины и комплекс минералов с микроэлементами – радиопротекторы.

Если есть ОНКОриски (а они есть у всех. В большей мере – при семейных формах рака):
1. учет и контроль у специалистов.
2. исключение всего того, что запрещено при состоявшемся раке. Это не только витамины группы В, биостимуляторы и иммуностимуляторы.
Онкологи больным запрещают:
красное мясо – в нем гормоны,
копчености – в них канцерогены,
алкоголь – иммунодепрессант, сильный гепатотропный яд и канцероген,
Табак — -»-
Майонезы, маргарины, избыток Омеги 6 (подсолнечное и кукурузное масло надо БАЛАНСИРОВАТЬ с Омегой3).
Почему об этих запретах не знают пока еще здоровые?

Какие онкопротекторы должны стать частью ежедневной пищи современного(пока еще здорового) человека?
Клетчатка + Флора — синтез онкопротекторов, удаление канцерогенов и токсинов, активация иммунной защиты (Локло + Бифидофилус)
Аминокислоты (Пептовит, НутриБерн)
Антиоксиданты невитаминной природы (Грепайн, СуперАнтиоксидант)
Правильные Жиры (Лецитин, Омега3, Кофермент)
Прицельная детоксикация с целенаправленной онкопротекцией (Ечай)
Кальций (Кальций Коралловый, Кальций с Вит Д)
Йод с альгинатами — радиопротекция, онкопротекция, усиление противоопухолевого звена иммунитета (Келп)
Сера (Чеснок, МСМ)
Удаление канцерогенной и не канцерогенной микрофлоры (Ечай)
Полноценные комплексы витаминов, минералов и микроэлементов (МегаХел, СуперКомплекс, Смарт Мил)

…а также:
Коллоидные Минералы
Остео+
ТНТ
Солстики, Хром, Гарциния, Фет Гребберз и Карбо Гребберз (профилактика ожирения = профилактика рака)
Все перец- содержащие БАД НСП
Репейник
Лив Гард
Вайлд Ям…

Почему онкопротекторы НСП должны стать частью ежедневной пищи современного (пока еще здорового) человека?
Потому, что онкологические риски касаются абсолютно всех. Экологическое отягощение, «мирный атом», автотранспорт, стрессы, несбалансированное питание, инфекции, попытка защититься от них (самолечение и АБ, гормоны в пище), пестициды и ГМО, транс-жиры…

Почему гарантированные качество и безопасность каждого Продукта НСП крайне важны именно в наше время?
Именно ПОТОМУ, ЧТО защищаться от факторов внешней и внутренней среды (а мы сами синтезируем массу канцерогенов!) нужно именно ТЕМ, ЧТО МОЖЕТ ЗАЩИТИТЬ.

Продукт, принятый с целью питания и защиты — ОБЯЗАН БЫТЬ идеально чистым и гарантированно действенным.
Компания НСП – всемирно признанный Лидер по качеству, чистоте и безопасности продукции.

Наши РЕЗУЛЬТАТЫ — прямое тому подтверждение. Компания НСП сама производит и сама продает свою продукцию, — исключая возможность подделки.

Жизнь слишком хороша, чтобы игнорировать ОНКОПРОТЕКЦИЮ!

Я поделилась с Вами лекцией врача-нутрициолога компании НСП Шершун Ольги.

Полную запись выше изложенного семинара на тему «Помощь при онкологии: что можно и чего нельзя при раке» можно прослушать ниже:

Хлорофилл против рака

Что такое раковая клетка

Это клетка, которая потребляет очень много питательных веществ, очень быстро делится, активно размножается во всех тканях, вытесняет нормальные клетки, истощает организм и приводит его к гибели.

Как с нею бороться

 

Хитростью! Ее надо отравить таким образом, чтобы здоровые клетки не пострадали. Представим себе, что за столом собралась компания гостей. Вредные хозяева знали привычки приглашенных, решили от некоторых из них избавиться и поставили на стол тортик, приправленный, к при-меру, цикутой. И пока большинство гостей чинно разговаривали и по крошке от торта отведали, несколько торопливых обжор быстренько весь тортик съели и скончались на месте. А все остальные остались живы и здоровы.

 

Примерно таким же образом профессор Борисов лечит рак. Он вводит в организм вместо «тортика» препарат из зеленого хлорофилла, который похож на гемоглобин и легко усваивается прожорливыми раковыми клетками. Затем клетку с помощью лазера облучают светом с определенной длиной волны. Под влиянием лазерного луча из хлорофиллового препарата освобождается активный кислород.

 

В раковых клетках поры отсутствуют, а кислорода в них накапливается так много, что они буквально взрываются изнутри. Здоровые клетки хлорофилла захватывают очень мало и поэтому остаются целыми и невредимыми. Но тут возникает серьезная проблема - свет, который испускается лазером, достигает только кожи и не проникает в глубину тканей. Он может исцелить от поверхностного рака, но не от опухолей внутренних органов. Как быть?

Профессор Борисов нашел оригинальный способ, позволяющий свету проникать очень глубоко. Все в нашем организме подчинено ритму под названием биорезонанс: дыхание, сердцебиение и сокращение самых мелких сосудиков - капилляров, проталкивающих кровь в глубину тканей. У каждого пациента - свой ритм дыхания, сокращения сердца и капилляров.

Биоритм определяют с помощью компьютера, непрерывно следящего за состоянием больного, и синхронно с ним короткими импульсами подают свет. На выдохе, когда кровь притекает к сердцу и все сосуды опустошены, лазерный луч добирается до пораженных опухолью тканей самым коротким путем и уничтожает больные клетки. На вдохе свет в ткани не поступает. Если больной во время процедуры вспомнил про плохое и разволновался, приборы моментально отреагируют на изменение биоритма и частота световых импульсов увеличится. А как только он успокоится - снова замедлится.Каждый слышит, как он дышит.


В чем плюсы данного метода

 

Он, в отличие от химиотерапии и об-лучения, не повреждает здоровые ткани и не вызывает никаких побочных эффектов - от него не тошнит, не болит голова и не повышается температура. Его можно применять у самых тяжелых больных при самых серьезных опухолях. В 2004 году профессор Борисов помог исцелиться от тяжелейшего наследственного заболевания 19-летней англичанке Луизе Лонгмен. Она страдала множественными опухолями кровеносных сосудов, ей грозила ампутация руки. Английские врачи ничем не могли ей помочь. Родители Луизы услышали про метод Борисова и обратились за помощью к нему - терять было нечего. Борисов проконсультировал девочку в Англии и пригласил ее на лечение в Москву. За курс лечения опухоли уменьшились на четверть. Врачи смогли удалить образования и сохранить девушке руку. Прошло три года. Луиза прекрасно себя чувствует, учится на третьем курсе медицинского факультета и планирует стать хирургом.

 

В 2005 году Борисов вылечил страдающего опухолью головного мозга 12-летнего мальчика из Югославии. Ребенок с трудом передвигался и не мог разговаривать. Австрийские врачи нашли у него, кроме огромной опухоли в мозгу, множественные метастазы в легких и отправили его домой умирать. После первого курса лечения состояние ребенка резко улучшилось. Он ходит в школу и за два года два раза приезжал к профессору, чтобы привести в порядок иммунитет. Теперь в клинику Борисова валом повалили онкологические пациенты из Югославии. Эффективна его методика при лечении новообразований желудка, молочных желез и гинекологической сферы.

 

И вместо, и вместе

 

Может ли метод Борисова использоваться вместо операции и других способов лечения онкологических болезней? Теоретически на ранних стадиях заболевания - может. Практически, даже в запущенных случаях, избирательная хронофототерапия неоднократно приводила к полному исцелению пациентов - например, ликвидировала опухоли груди или метастазы. Но чтобы превратить ее в полноценный способ лечения, надо продолжать исследования и тратить на них много денег, которых у клиники Борисова попросту нет. Поэтому сейчас хронофототерапия применяется или после операции, или вместе с химиотерпией, или вместе с лучевой терапией и приводит к блестящим результатам. (ред. - лучше не применять химио- и лучевые терапии)

 

Почему он помогает

 

По двум причинам. Первая - препарат из водоросли спирулины содержит весь набор нужных нам витаминов и минералов, причем в очень близкой человеку форме, и, попадая в организм, активизирует все его защитные силы. Давно не секрет, что натуральные витамины лучше синтетических.

Некоторые синтетические витамины, некогда рекомендованные врачами для защиты от онкозаболеваний, на самом деле стимулируют образование предраковых клеток. Синтетический витамин Е в больших дозах вызывает рак печени.

 

Прием искусственных каротинов (провитамин А) чреват онкологическими заболеваниями легких. Сверхдозы витамина С (более 500 мг в день) увеличивают производствосвободных радикалов, нарушающих строение клеточных ДНК.

 

Натуральные витамины, такие как в спирулине, ничего, кроме пользы, нам не приносят. Находящиеся в ней биологически активные вещества помогают клеткам освобождаться от токсинов и способствуют очищению организма. Нам не надо бояться того, что здоровая клетка «отравится» хлорофилловым препаратом. У нее нормальный аппетит, и она наберет ровно столько полезных веществ, сколько способна усвоить.

 

Вторая причина - биорезонансный аппарат световыми импульсами заставляет клетки работать в здоровом, естественном ритме. Они чувствуют себя как усталые люди, которым наконец-то позволили вволю отоспаться и наладили режим дня. В тканях нормализуется обмен веществ, иммунитет сам справляется с врагами, и болезнь уходит. 

Галина Зайцева

 

Профессия реабилитолог

 

Процессы в мире элементарных частиц, т.е. в микромире, изучает квантовая механика. Квантовый уровень - это мир информации, мир-"невидимка". В такой уникальной естественной самоорганизующейся системе, какой является человек, квантовыми излучениями являются его мысли и чувства. Они прямо или косвенно сказываются на развитии организма, так как клетки тела постоянно "прислушиваются" к нашим мыслям и изменяются ими. Негативная мысль, в том числе и собственная, может стать для организма снарядом, способным пробить любую оболочку.

 

Так, депрессия подавляет иммунную систему, несчастье и отчаяние повышают опасность инфаркта и рака. Добрая же мысль творит чудеса. Она способна нейтрализовать пос­ледствия негативных эмоций, действует подобно лекарству, исцеляет и дает новые силы, восстанавливает структуру клетки. Мысль оптимиста, верящего в свои силы, в успех лечения - исцеляет. Мысль пессимиста, ни во что не верящего - добивает. А это означает, что нельзя отделять биологию от психологии.Путь к здоровью - это познавательный процесс, со своими особенностями, свойствами и законами. Он лежит через понимание и осознание, через умение управлять своими эмоциями.

Путь к здоровью - это познавательный процесс, со своими особенностями, свойствами и законами. Он лежит через понимание и осознание, через умение управлять своими эмоциями.

 

Кто вы, доктор?

 

- Я - практический врач, давайте начнем с этого, - говорит о себе Борисов - Имею по­рядка 15 медицинских специальностей, притом базовых. Когда меня спрашивают: "Кто вы?", отвечаю: "Я настоящий советский врач, никакой я не колдун, чтобы не было таких мыслей". Не получается у меня с колдовством, к сожалению (смеется), потому что это было бы проще. Мне приходится многое знать, для того, чтобы понимать. Я реабилитолог - это врач, который должен распознать любую болезнь, понять, с чего начиналось её развитие, и подумать о том, как помочь. На са­мом деле, я считаю, это одна из самых сложных дисциплин современной медицины. Его имя Виктор Александрович Борисов. Профессор Борисов. Доктор Борисов. Мы хотим заранее уведомить читателей, что он никого не оперирует и даже не применяет никаких медикаментов. Но при этом даже самые тяжелые онкологические больные, порой в безнадежных, терминальных состояниях, когда единственным облегчением считается морфий, попав в клинику Борисова, в считанные дни начинают чувствовать улучшение, а после нескольких стандартных курсов восстановительной терапии в добром здравии возвращаются к нормальной, полноценной жизни. Хотя, заметьте, речь не идет о каких-либо чудесах.

Автор множества поистине чудодейственных методик, практикующий их уже более полутора десятков лет, Борисов стал известен широкой общественности только летом 2004 года на волне газетной шумихи, поднятой английской The Sun и поддержаной многими российскими СМИ.

Это произошло после того, как Виктор Александрович помог справиться с редким генетическим заболеванием, вызывающим рак, синдромом фон Хиппель-Линдау, английской студентке Луизе Лонгман. Почему-то тогда никого не заинтересовал медицинский аспект события: все газеты с пеной у рта спорили только о том, оплатил В.В. Путин лечение англичанки или нет.

Тем не менее, благодаря той истории имя Борисова стало известно и другим неизлечимым больным. В частности, о статье в The Sun вовремя вспомнили родственники страдающего саркомой югославского мальчика Немани Станковича. После операции, сделанной ему в Белграде и химиотерапии, проведенной в Германии, с метастазами в легких, мальчик был отпущен домой умирать. В Австрии доктор Борисов осмотрел мальчика и пригласил приехать на курс реабилитации. Дальше произошло чудо.

Сегодня, по стопам Немани, в клинике Борисова выздоравливает большая группа детей из бывшей Югославии, многие из них с злокачественными опухолями мозга.

- Виктор Александрович, почему столько детей именно из Югославии?

- Видите ли, это страшная история. Во время недавней войны, американцы сбросили на территорию Югославии свой стратегический запас управляемых бомб замедленного действия, начиненных обедненным ураном, и снарядов с урановыми боеголовками. Это вызвало настолько стремительный рост онкологических заболеваний, что своими силами югославская медицина не в состоянии с этим справиться. Дети рождаются уже с раковыми заболеваниями. Вот мы и помогаем по мере сил.

- Действительно, очень страшная история. А можете ли вы познакомить нас с кем-нибудь из этих малышей?

 

- С удовольствием. Вот, Никола Берлич, 5 лет. Диагноз - опухоль малого таза 7,5 на 8 см, проросшая в мочевой пузырь. Была предложена операция по удалению опухоли вместе с мочевым пузырем. Родители категорически отказались от операции и привезли его ко мне в Москву. Это было три месяца назад. В результате химиотерапии, произведенной в Белграде - неукротимые рвоты и аллергия, передвигался с трудом, хромал из-за болей в ноге. Первый недельный (а, фактически, пятидневный) курс реабилитации он перенес хорошо. Родители отметили, что уже во время курса ребенок повеселел, стал активнее. Когда спустя месяц его привезли вторично, он чувствовал себя заметно лучше, хромать перестал. Мы обследовали мальчика. Компьютерная томография показала, что опухоль уменьшилась до размеров 3,5 на 1,5 см, а рентген выявил, что она не прорастает в мочевой пузырь. Я предложил родителям мальчика прооперировать опухоль. Они согласились, и операция в Белграде была назначена на 20-й день после окончания второго недельного сеанса реабилитации. Мальчика взяли на операцию, обследовали, оказалось - оперировать нечего. 28 сентября они приехали в мою клинику на третий, последний курс реабилитации. Такая вот история.

- Звучит сказочно. Трудно поверить, что вы не волшебник. Что же это за чудесная наука - реабилитология?

 

- Я нисколько не умаляю блестящий опыт хирургов и химиотерапевтов, но считаю, что самое страшное в жизни онкологического больного начинается тогда, когда его выписывают на амбулаторное лечение. Реабилитационные курорты в лучшем случае слегка подкрепляют его силы. Но вот на какой-то период времени больной оказывается в домашних условиях и, не понимая ничего, ждет, что же с ним будет дальше. Ему сказали: "Придете через полгода - мы проверим". Или через три месяца, не важно когда. И в этот ответственнейший период времени, необходимый для реабилитации, больной предоставлен сам себе, а это для него - огромная психологическая травма. Причем, так происходит во всех странах.

Я занимаюсь системной реабилитологией. Я не ставлю задачу прямого лечения онкологических заболеваний, для этого существуют специалисты. В моем случае речь идет не о лечении, а о восстановлении. Наша задача - восстановить иммунитет, оздоровить человека, вернуть его к жизни. Целью моей и моих коллег является восстановление фактического здоровья пациента. Заметьте, не средне­ статистического, а фактического. Между ними огромная разница. Надо дать понять пациенту, как правильно себя вести, как настроить себя, как помочь восстановиться после тяжелейшей операции, после химиотерапии, после лучевой терапии - вот главная задача, на самом деле. А то, что получаются такие положительные результаты, это зависит от совместной деятельности и врача, и больного.

- Но вы же не будете возражать, что эти положительные результаты связаны с применением ваших уникальных методик?

- Понимаете, любая авторская методика - это просто искусство врача. Когда имеешь 40-летний стаж работы, знаешь результаты применения одного или другого вида препарата и эффективность его воздействия на организм и, соответственно, балансируешь между состоянием здоровья пациента, используя системы обратной связи, то есть, используя систему биохронотерапии. Здесь ничего особенного нет, это просто-напросто комбинация различных наших медицинских возможностей.

- Вот, Виктор Александрович, наконец-то вы произнесли те самые слова, которых мы ждали: "системы обратной связи". Расскажите подробнее о биохронотерапии.

Диалог с клеткой и не только

 

- Речь идет о подходе к организму, как к целостной системе, с учетом того, что на планете не существует двух одинаковых людей. У наших клеток и у всего организма в целом существуют определенные биологические ритмы. Каждый человек примерно полсуток бодрствует, а ночью спит. Свой двухфазный ритм имеет и каждая клетка нашего тела. Представьте, каждая клетка - как птенец в гнезде. Вот группы клеток в спящем состоянии, и прилетает мама-птичка с червячком - птенцы проснулись, открыли клювики, поели и опять заснули. Синхронно и гармонично.

Сбой в работе клетки, когда она начинает развиваться дико и самостоятельно, не подчиняясь ритмике целостного организма - это и есть рак или, как его называют ученые, "кара люксоринз" - "дикое мясо". Далее, разрушение гармонии биоритмов приводит к депрессии иммунитета. Со всеми вытекающими последствиями. (Кстати, то же самое происходит в результате лучевой и химиотерапии.) Один из самых эффективных на сегодня методов восстановления ритмов здоровых клеток, а с ним нормального катаболизма и метаболизма на клеточном уровне - метод биохронотерапии. Гармонизация биоритмов приводит к тому, что пациент начинает чувствовать себя субъективно более здоровым. А за счет клеточного эффекта памяти обеспечивается стойкость лечебного эффекта, то есть, даже окончив курс лечения, человек продолжает ощущать на себе все его положительные последствия.

- Как все сложно, и в то же время просто... Значит, здоровый организм - тот, чьи клетки подчиняются определенным ритмам?

- Да, и этими определенными ритмами являются быстрые ритмы человеческого организма - ритмы дыхания, пульса и тремора.

С помощью аппаратуры, которая учитывает индивидуальные ритмы больного и работает в системе обратной связи, биохронотерапия оказывает помощь клетке именно тогда, когда та в ней нуждается. Как если бы вы поднимались по ступенькам и кто-то поддержал вас за локоть - ведь вас не надо поднимать двумя руками, достаточно чуть-чуть поддержать. Аппаратура считывает сигналы и модулирует обратный сигнал только тогда, когда идет совпадение ряда факторов.

- Каких именно?

- Ритм дыхания, пульса и тремора, когда клетка открыта. То есть, системой физиотерапевтического воздействия управляет не врач, а организм больного. Методика биохронотерапии достаточно молода, поэтому многие приборы мы разрабатываем самостоятельно - на стыке наук - биофизики, радиоэлектроники и системного программирования. Так работает современная медицина. Такова методика биохронотерапии, эффективная и безопасная. Но настоящие чудеса начинаются, если соединить ее с другой не менее эффективной и безопасной методикой - фотодинамической терапией.

- Ну, если уже врач заговорил о чудесах... В чем же суть фотодинамической терапии?

- В том, что опухолевые клетки обладают свойством накапливать препарат, который мы тем или иным способом вводим в организм. На это впервые обратил внимание американский ученый Шнайдер еще в 1942 году. Ну, грубо говоря, сидит за столом компания людей, кто-то из них обжора, и пока остальные обсуждают новости, он успевает съесть все на столе. Это и есть опухоль. Скорость обменных процессов в ней колоссальная, поэтому опухоль "поедает" в первую очередь питательные вещества, то есть, в данном случае, наш препарат. Далеее, под воздействием света он акти­вируется и сжигается.

- Что же это за препарат?

- Это хлорофилл. Тот самый, который мы ежедневно потребляем в колоссальных количествах. Мы можем съесть тазик салата, благополучно сходить в туалет и даже не вспомним о том, что мы его съели. В 1992 году российские ученые синтезировали активное начало хлорофилла, хлорин Е-6. Он выпускается в России в двух формах и одна в Белоруссии. Эти препараты давным-давно сертифицированы и широко применяются. Только главным отличием методики, которую я применяю, является то, что я использую эти препараты под воздействием приборов биохронотерапии.

- То есть, вам удалось объединить два совершенно уникальных метода лечения. А скажите, больных с какой онкологией вы берете на оздоровление?

- Я отвечу иначе. Скажу, каких я не беру. Я не беру на оздоровление тех, кто легко поддается другим видам лечения, например, в Институте онкологии и так далее. Ко мне попадают люди с довольно сомнительными случаями, то есть либо нет биопсии, либо нехарактерное течение заболевания, либо, наоборот, бурное прогрессирование, несмотря на вроде бы благоприятный диагноз. И, естественно, приходится в этом разбираться при помощи моих же коллег из специализированных институтов, в том числе и онкологических.

- А помимо онкологии? Какие еще болезни поддаются вашим методикам?

- Это отдельный большой разговор. Коротко: мы работаем с широким спектром заболеваний: например, с детским церебральным параличом, с постинсультными состояниями, с аденомой простаты, с различными гинекологическими паталогиями. Сегодня в центре нашего внимания вирусология, и есть очень интересные результаты.

В Москве Виктор Александрович Борисов руководит созданным им медицинским Центром Биохронотерапии, в котором оздоравливает людей со всего света. У него также есть пациенты в Австрии, Германии, Югославии. В Австрии лечит немцев, в Германии англичан. Иначе нельзя, медицинское законодательство не позволяет. Выучи языки, сдай экзамены как положено - тогда и лечи. И никакими заслугами перед человечеством и наукой не раскачать косную бюрократическую машину. Нельзя, и все тут.

Мы по наивности попросили знакомого "русского" доктора, работающего в Германии в клинике женской онкологии, рассказать о Борисове своему шефу, вдруг он заинтересуется, подскажет, поможет. Ничуть. Шеф дал понять, что глупости его не интересуют, а вот если Борисов захочет, то он может ему организовать творческую командировку в его, шефа, клинику и поучить уму-разуму, показать, как он, шеф, работает. А как он работает? Как на конвейере. Ампутации одна за другой, потом химио- и прочая терапии, а дальше - как Бог даст. Так что, тем, кто нуждается в помощи Борисова, путь пока один: в Москву.

Краткая информация для тех, кто выбрал этот путь: Виктор Александрович просит предварительно прислать ему (факс, электронная почта) историю болезни пациента на русском языке. Важнейшим условием приема на лечение является физическая возможность больного добраться до Москвы. опубликовано econet.ru

 

Беседовала с доктором Борисовым Евгения Жмурко.

Хлорофилл может помочь предотвратить рак, но исследование поднимает другие вопросы.

Корваллис, штат Орегон. Недавнее исследование, проведенное в Университете штата Орегон, показало, что хлорофилл в зеленых овощах обеспечивает защиту от рака при тестировании на умеренных уровнях воздействия канцерогенов, которые, скорее всего, будут обнаружены. в окружающей среде.

Однако хлорофилл на самом деле увеличивает количество опухолей при очень высоких уровнях воздействия канцерогенов.

Помимо подтверждения ценности хлорофилла, исследование поднимает серьезные вопросы о том, дают ли традиционные лабораторные исследования на мышах и высоких уровнях токсического воздействия точные ответы на то, что является реальным риском для здоровья, а что нет, и какие диетические или фармацевтические подходы полезны.

Результаты, опубликованные в журнале Food and Chemical Toxicology, были сделаны с использованием 12 360 радужной форели в качестве лабораторных моделей вместо более обычных лабораторных мышей. Исследования на грызунах намного дороже, что требует использования меньшего количества образцов и более высокого воздействия канцерогенов.

«В эпидемиологических и других клинических исследованиях на людях есть убедительные доказательства того, что хлорофилл и его производное, хлорофиллин, могут защищать от рака», - сказала Тэмми Маккуистан, научный сотрудник, работающий с Джорджем Бейли, почетным профессором Института Линуса Полинга при ОГУ.

«Это исследование, как и другие до него, показало, что хлорофилл может до определенной степени уменьшить количество опухолей», - сказал Маккуистан. «Но при очень высоких дозах того же канцерогена хлорофилл на самом деле усугубил проблему. Это ставит под сомнение ценность подхода, часто используемого при изучении соединений, вызывающих рак».

Эксперты OSU в последние годы стали первопроходцами в использовании радужной форели в качестве модели для биомедицинских исследований, отчасти потому, что рыбы реагируют аналогично реакциям грызунов, но также потому, что ученые могут использовать тысячи из них - вместо десятков или сотни мышей - и проводят эксперименты, которые иначе были бы невозможны.

В этом контексте данное исследование поднимает вопросы относительно фундаментальной предпосылки многих медицинских исследований - подвергнуть лабораторное животное воздействию соединения на высоких уровнях, наблюдать результат и предсказать, что пропорциональное количество того же результата будет присутствовать при низких уровнях контакт.

В одной части исследования форель подвергалась довольно умеренному воздействию известного канцерогена, но также подвергалась воздействию хлорофилла. Это уменьшило количество опухолей печени на 29-64 процента и опухолей желудка на 24-45 процентов.Но в другой части исследования с использованием гораздо более высоких и нереалистичных доз того же канцерогена, использование хлорофилла привело к значительному увеличению количества опухолей.

Другими словами, традиционные исследования с небольшим количеством животных, получавших очень высокие дозы канцерогена, могут сделать вывод о том, что хлорофилл может увеличить риск рака у человека. Это исследование, а также другие доказательства и испытания пришли к прямо противоположному выводу.

Также было обнаружено, что защитный механизм хлорофилла довольно прост - он просто связывается с канцерогенами и изолирует их в желудочно-кишечном тракте до тех пор, пока они не будут выведены из организма.При более низких дозах канцерогенов и частоте рака, характерных для людей, хлорофилл обладал сильной защитой.

«Основное предположение таких экспериментов состоит в том, что эффекты вмешательства при высоких дозах канцерогенов будут одинаково применяться и при более низких дозах канцерогенов», - написали исследователи в своем отчете. «Вопреки обычному предположению, результаты в главном органе-мишени сильно зависели от дозы канцерогена».

Эксперты

OSU утверждали, что в некоторых исследованиях радужная форель может давать лучшие, более точные, реальные результаты по сравнению с традиционными моделями грызунов на животных и актуальными для человека, потому что можно использовать гораздо больше образцов и изучать более низкие дозы токсинов.Они говорят, что эксперименты с рыбой могут быть примерно в 20 раз дешевле и, в конце концов, более научно обоснованы.

«Результаты, полученные при высоких дозах канцерогенов и высоких ответах опухолей, могут не иметь отношения к вмешательству человека», - заявили ученые в своем заключении.

Эта работа была поддержана Национальными институтами здравоохранения.

Каковы преимущества употребления хлорофилла?

Все мы знаем, что есть зелень полезно для вас, но что, если бы вы могли извлечь зелень и принимать ее в качестве добавки?

Недавняя тенденция привела к тому, что все больше людей делают именно это.Хлорофилл - это вещество, придающее растениям зеленый цвет, и добавки с хлорофиллом в жидкой или таблетированной форме становятся популярными.

Хлорофилл - антиоксидант, улучшающий ваше здоровье. Но имеет ли он те же преимущества, когда его принимают в качестве добавки? Мы попросили взвесить нашего диетолога Линдси Вулфорд.

Вот шесть фактов, которые она хочет, чтобы вы знали о хлорофилле.

Хлорофилл - это не то название, которое вы видите на этикетке. Хлорофилл - это название зеленого пигмента, который растения используют для приготовления пищи в процессе фотосинтеза.Но если вы попытаетесь купить его в качестве добавки, вы, скорее всего, увидите его под названием хлорофиллин, который представляет собой водорастворимую форму хлорофилла, содержащую медь и натрий. Эти дополнительные минералы облегчают усвоение организмом.

Действие хлорофилла неясно. Производители пищевых добавок утверждают, что хлорофилл может делать много вещей, например, стимулировать эритроциты, помогать с потерей веса, лечить поврежденную кожу, нейтрализовать токсины, снимать воспаления и предотвращать рак. Это впечатляющий список, но немногие утверждения подкреплены научными данными.

«Есть некоторые исследования, которые показывают, что средства для ухода за кожей с хлорофиллом потенциально могут бороться с прыщами, и есть очень, очень ограниченные данные о потере веса», - говорит Вулфорд. «Кроме того, мы знаем, что он получен из растений и содержит антиоксиданты. Это примерно то, что мы можем с уверенностью подтвердить ».

Жидкость может быть лучше, чем таблетка. Если вы хотите попробовать хлорофилл, возможно, лучше подойдут жидкие добавки, поскольку они легче усваиваются вашим организмом.Но вам следует поговорить со своим врачом, прежде чем начинать принимать хлорофилл.

«Нет никакого реального риска принимать его, хотя некоторые люди сообщают о побочных эффектах, таких как диарея или тошнота», - говорит Вулфорд. «Вы всегда должны проконсультироваться с врачом, если начинаете принимать какие-либо новые добавки».

Хлорофилл присутствует во всех зеленых растениях. Вам не нужно принимать пищевые добавки, чтобы добавить хлорофилл в свой рацион. Вы можете просто есть зеленые фрукты и овощи. Даже замороженные овощи содержат хлорофилл.

«Вы получаете хлорофилл, когда едите брокколи, , шпинат или любые другие зеленые фрукты или овощи», - говорит Вулфорд.

Из добавок вы можете усвоить немного больше хлорофилла, но фрукты и овощи дадут вам другие витамины и минералы. Они также дадут вам клетчатку, которая необходима для хорошего пищеварения и поддержания нормального уровня сахара в крови и .

Зеленый - не единственный важный цвет. В добавлении хлорофилла в ваш рацион нет ничего нового.Как мы могли забыть об этой тенденции роста пырея? Это все о хлорофилле. Ростки пшеницы очень богаты зеленым веществом. Но важно помнить, что все цвета фруктов и овощей ценны.

«Вы хотите есть продукты разных цветов, чтобы максимально увеличить количество различных питательных веществ для своего тела», - говорит Вулфорд.

Например, оранжевые продукты, такие как морковь, с высоким содержанием бета-каротина, фиолетовые продукты, такие как баклажаны, содержат антоциан, а красные продукты, такие как помидоры, содержат ликопин.Каждый цвет содержит разные фитохимические вещества, и все они приносят пользу вашему организму.

Ничто не заменит здорового питания. Никакое количество хлорофилла не сможет обратить вспять вред, который может нанести нездоровая пища. Рафинированные углеводы и другие сладкие продукты могут вызывать хроническое воспаление и болезнь. Обработанное мясо увеличивает риск рака. Жареная пища и полуфабрикаты также могут вызвать повреждение и недостаток питательных веществ, необходимых вашему организму.

Лучший способ обеспечить хорошее самочувствие и снизить риск заболевания - это придерживаться растительной диеты из цельного зерна, овощей, фруктов, орехов, бобов и семян с добавлением постных или растительных белков.

Также важно, чтобы оставались активными в течение дня и занимались не менее 150 минут умеренными упражнениями или 75 минут энергичными упражнениями каждую неделю.

«Если вы принимаете хлорофилл, это действительно должна быть добавка», - говорит Вулфорд. «Это может принести немного дополнительной пользы, но вам все равно нужно есть зелень и другие овощи, чтобы получить клетчатку и другие питательные вещества, которые хлорофилл не будет содержать, и вам все равно нужно заниматься спортом.

Запросите запись в MD Anderson онлайн или по телефону 1-877-632-6789.

Матричный биомаркер на 12 000 животных и исследование опухолей

Резюме

Недавние пилотные исследования показали, что природный хлорофилл (Хл) ингибирует поглощение канцерогенов и туморогенез на моделях грызунов и рыб, а также изменяет поглощение и биораспределение следов 14 C-афлатоксин B1 у людей-добровольцев. Настоящее исследование расширяет эти многообещающие результаты, используя дизайн матрицы доз-доза для изучения Chl-опосредованных эффектов на индуцированное дибензо ( def, p) хризен (DBC) образование аддуктов ДНК, частоту опухолей, множественность опухолей и изменения в генах. регулирование в форели.В матрице «доза-доза» использовались исходные 12360 радужной форели, которую лечили 0–4000 ч. / Млн диетического Хл вместе с 0–225 ч. / Млн ДБК в течение до 4 недель. Было обнаружено, что диетический DBC вызывает дозозависимые изменения в экспрессии генов, которые устраняются совместной обработкой Chl, тогда как Chl сам по себе не влияет на те же гены. Совместная обработка Chl обеспечила дозозависимое снижение общих аддуктов DBC-ДНК без изменения относительной интенсивности аддуктов по хроматографическому профилю. У животных, получавших только DBC, частота опухолей печени (как logit) и множественность опухолей были линейными в зависимости от дозы DBC (как log) вплоть до их максимальной эффективной дозы и после этого снижались.Совместное лечение Хл существенно снижало частоту и множественность при дозах DBC до их максимальной эффективной дозы. Эти результаты показывают, что концентрации Chl, встречающиеся в богатых Chl зеленых овощах, могут обеспечивать существенную химиопротекцию рака, и предполагают, что они делают это за счет снижения биодоступности канцерогенов. Однако при дозах DBC, превышающих оптимальные, совместное лечение Chl не смогло снизить заболеваемость опухолью и значительно увеличить множественность. Это открытие ставит под сомнение уместность исследований химиопрофилактики, проводимых на людях с высокими дозами канцерогенов, которые, как не доказано, лежат в линейном или, по крайней мере, монотонном диапазоне конечной точки доза-реакция.

Ключевые слова: хлорофилл, хлорофиллин, дибензо ( def, p ) хризен, заболеваемость опухолями, биодоступность, рак печени, рак желудка, химиопрофилактика

1 Введение

Полициклический ароматический углеводород дибензо, p def хризен (DBC), ранее известный как дибензо ( a, l ) пирен или DBP, может быть легко обнаружен в твердых частицах при сжигании древесного угля, угля и мазута (Deraat et al. , 1987; Mumford et al. al., 1987; Мамфорд и др. , 1995) в образцах почвы и донных отложений (Kozin et al. , 1995), в конденсате выхлопных газов автомобилей (Seidel et al. , 2004) и в конденсате табачного дыма (Snook et al. , 1977; Hoffmann и Hoffmann, 1998). DBC демонстрирует сильную мутагенность in vitro в анализах бактериальных и животных клеток (Busby et al. , 1995; Durant et al. , 1999), образует множественные аддукты ДНК in vitro и in vivo (Mahadevan и другие., 2005), и может действовать на in vivo через промоторные механизмы, а также механизмы инициации опухоли (Baird et al. , 2005). Сравнительные исследования на моделях грызунов показали, что DBC является наиболее канцерогенным полициклическим ароматическим углеводородом, испытанным на сегодняшний день, значительно превосходящим эффективность хорошо известных канцерогенов бензо [ a ] пирен и 7,12-диметилбенз [ a ] антрацен ( Кавальери и др. , 1989; Кавальери и др. , 1991; Хиггинботам и др., 1993; LaVoie et al. , 1993). Кожное нанесение DBC мышам привело к опухолям кожи и легких и злокачественной лимфоме, поражающей несколько органов (Higginbotham et al. , 1993). Внутрибрюшинное введение DBC мышам вызывало опухоли легких (Prahalad et al. , 1997), а внутримолочная инъекция крысам приводила к опухолям молочной железы (Cavalieri et al. , 1991). У радужной форели воздействие DBC с пищей приводило к опухолям желудка, печени и плавательного пузыря (Reddy et al., 1999; Pratt et al. , 2007; Simonich et al. , 2008).

Исключительно высокая канцерогенная активность DBC (Bailey et al. , 2009), наряду с неизбежным и потенциально значительным воздействием на человека в городских районах, делает меры по смягчению его неблагоприятных эффектов особенно привлекательными. Эксперименты на животных моделях выявили множество природных и синтетических химиопрофилактических агентов, которые могут резко ингибировать вызванное канцерогеном повреждение и, как следствие, заболеваемость раком (см. Обзор (Barrett, 2002; Guyton and Kensler, 2002; Hirose et al., 2002; Кенслер, 2004; Аггарвал и Шисодиа, 2006 г .; Kelloff et al. , 2006; Райт и др. , 2006)). Один из таких агентов, хлорофиллин (CHL), натрий-медное производное хлорофилла (Chl), кажется многообещающим в качестве нетоксичного агента, который может защитить от нескольких классов пищевых канцерогенов, включая DBC, на животных моделях. В исследовании vivo механистические исследования на млекопитающих и рыбах показывают, что диетический ХЛ блокирует инициирование опухоли (Reddy et al. , 1999; Pratt et al., 2007; Simonich et al. , 2008) и in vitro Исследования предполагают, что это может происходить частично за счет образования прочных комплексов с такими канцерогенами, как афлатоксины, DBC и некоторые гетероциклические амины (Breinholt et al. , 1995; Dashwood et al. др. , 1996; Hayashi и др. , 1999), которые разделяют частично плоские ароматические структурные элементы. Независимо от того, за счет образования комплекса или какого-либо другого неопределенного транспортного механизма, совместное лечение CHL эффективно ингибирует абсорбцию этих канцерогенов, тем самым снижая биодоступность для ткани-мишени, аддукцию ДНК и окончательный ответ опухоли (Dashwood et al., 1998). Трансляционные эксперименты продемонстрировали, что CHL может значительно снизить биомаркеры эффективного воздействия канцерогенов у людей в Китае с хроническим, неизбежно высоким воздействием афлатоксина B 1 (AFB 1 ) и высокой заболеваемостью раком печени (Qian et al. , 1994; Якобсон и др. , 1997; Эгнер и др. , 2001; Эгнер и др. , 2003). Недавнее исследование микродозирования показало, что совместное воздействие CHL достигает этого за счет значительного изменения фармакокинетических параметров AFB 1 и снижения его биодоступности для людей (Jubert et al., 2009), как и в моделях на животных. Дополнительное подтверждение полезности CHL для вмешательства человека обеспечивается недавним исследованием Shaughnessy (Shaughnessy et al. ), который обнаружил, что таблетки CHL в сочетании с овощами семейства крестоцветных и йогуртом снижают повреждение колоректальной ДНК и системную генотоксичность у людей, потребляющих мясо. приготовленные при высокой температуре.

Хотя эти результаты предполагают значительный потенциал добавок CHL в снижении риска рака у человека, имеется относительно мало информации о химиопротективном потенциале природных хлорофиллов, поскольку они могут присутствовать в рационе человека.Недавно мы сообщили, что в модели канцерогенеза радужной форели совместное воздействие с пищей в течение одного месяца до 1000–6000 частей на миллион высокоочищенного хлора резко снижает частоту возникновения опухолей печени и желудка, инициированных DBC (Simonich et al. , 2008). . Мы также сообщили об аналогичной степени защиты от ранних и поздних предраковых биомаркеров у крыс, когда 2000 ppm очищенного Chl вводили совместно с 250 ppb AFB 1 (Simonich et al. , 2007). Наконец, наше недавнее исследование микродозирования показало, что совместное лечение очищенным Chl было так же эффективно, как и CHL, в изменении фармакокинетических параметров AFB 1 и снижении его поглощения у людей-добровольцев (Jubert et al., 2009 г.). Хотя эти результаты предполагают, что природные хлорофиллы могут иметь защитную эффективность, сравнимую с производной CHL, проблемы со стабильностью и стоимостью в настоящее время ограничивают использование высокоочищенных хлорофиллов в качестве долгосрочной стратегии вмешательства человека. Одна из целей настоящего исследования состояла в том, чтобы сравнить химиопрофилактическую эффективность более доступного экстракта шпината, обогащенного Хл, с таковым очищенного Хл и коммерческого ХЛ. Дополнительная и важная цель исследования состояла в том, чтобы определить, были ли наши предыдущие наблюдения зависимости от дозы канцерогена в химиопрофилактике рака (Pratt et al., 2007) можно было подтвердить. Уместен вопрос, могут ли химиопрофилактические эффекты или отсутствие эффектов, наблюдаемые на данной животной модели при высокой дозе канцерогена, экстраполировать на более низкие воздействия канцерогенов и опухолевые реакции, характерные для людей. Чтобы решить эту проблему, мы использовали матрицу «доза-доза» для 12 000 животных, которая обеспечивает количественное исследование химиопрофилактической эффективности как функции канцерогена, а также дозы Хл. Конечными точками и оцененными биомаркерами были начальная аддукция DBC-ДНК, изменения в профилях экспрессии генов и окончательные ответы опухоли в печени и желудке.

3 Результаты

3.1 Образование опухоли, инициированное DBC

Диетическое введение DBC молоди радужной форели в течение 4 недель привело к дозозависимому образованию опухолей печени и желудка при отборе проб через 9 месяцев после прекращения лечения DBC с помощью диеты (). Опухолевые ответы в печени и желудке для этого исследования полностью совпадают с таковыми в нашем исследовании мега-доза-реакция на 40 800 животных ED 01 с DBC (Reddy et al ., 1999; Bailey et al ., 2009) (Reddy и др. ., 1999) и демонстрируют явные различия в дозозависимости DBC в двух основных органах-мишенях. Как видно на фиг.2, частота поражения печени увеличивалась прямо пропорционально дозе DBC по логит-шкале в диапазоне 14–112 ppm, тогда как ответ на следующую более высокую дозу 224 ppm был ниже, чем ответ на 112 ppm (p <0,0001, квазивероятность f-тест с масштабным параметром, оцениваемым по всему набору данных). Таким образом, доза-реакция на DBC в этой модели и органе-мишени немонотонна и демонстрирует дозу с максимальным эффектом.Это резко контрастирует с AFB 1 , который дает ответ с частотой, прямо пропорциональной дозе, в широком диапазоне воздействия в модели форели (Dashwood et al ., 1998). В желудке реакция на DBC не была значительно выше фона при двух самых низких дозах, как ожидалось в нашем предыдущем исследовании (Bailey et al ., 2009). Это исключает возможность изучения химиопрофилактических эффектов на этот орган при использовании этих двух доз. Мы не рассматриваем это очевидное отставание в обнаруживаемой реакции как свидетельство порогового значения в этом органе, скорее это пример недостаточного количества животных, чтобы отличить вызванный канцерогеном ответ от фонового при этих сверхмалых дозах (Bailey et al ., 2009). Мы также отмечаем, что токсичность DBC для молоди форели (Bailey et al ., 2009) исключает тестирование при дозах, намного превышающих 224 ppm, если также не вводится эффективное химиопротекторное средство, такое как Chl (например, как в группе лечения 24). Заболеваемость опухолью желудка, по-видимому, увеличивалась прямо пропорционально дозе по логит-шкале при дозах в диапазоне 56–224 ppm, что дает полезный диапазон для изучения химиопрофилактических эффектов хлорофиллов в этом органе.

3.2 Ингибирование ответа опухоли диетическими хлорофиллами

Потенциал совместного лечения с диетой с экстрактом Chl ингибировать ответ опухоли на DBC в печени показан на и.Степень ингибирования, по-видимому, увеличивалась с дозой Chl и наблюдалась при всех дозах DBC, вплоть до максимальной эффективной дозы при 112 ppm DBC. Однако при концентрации DBC 224 ppm, что превышает максимальную эффективную дозу, не было доказательств ингибирования опухоли при любой дозе Chl (). В желудке () имелись четкие доказательства ингибирования заболеваемости опухолями при каждой из четырех испытанных доз Chl для доз DBC, превышающих фоновый уровень 56, 112 и 224 ppm. Визуальный осмотр данных печени и желудка, нанесенных на график. Шкала логарифмической заболеваемости в сравнении с логарифмической шкалой [DBC] (соответственно) дает общее представление о кривых доза-ответ опухоли DBC, сдвигающихся дальше вправо с увеличением доз Chl.То есть каждая доза Chl сдвигала кривую зависимости зависимости от дозы только канцерогена в обоих органах, так что для достижения любого конкретного опухолевого ответа потребовались бы более высокие дозы DBC. Как уже отмечалось, заболеваемость опухолью желудка при самых низких дозах DBC, 14 и 28 ppm, существенно не отличалась от фона (p = 0,06 и p = 0,3, соответственно). При более высоких дозах DBC Хл сдвигала кривую доза-реакция только для DBC вправо. Отметим, однако, что максимальная степень сдвига при 4000 ppm Chl была лишь примерно вдвое меньше, чем в печени.Как следствие, степень сдвига между промежуточными дозами Хл 500–2000 ppm Хл в желудке различить менее легко, чем в печени. В целом, однако, визуальный осмотр кривых доза-ответ DBC при 0, промежуточном и 4000 ppm Chl подтверждает прогрессивный сдвиг вправо (ингибирование ответа опухоли) с увеличением совместной обработки Chl (вставка). В отличие от печени, кривая доза-реакция только для DBC в желудке не проходит через оптимум в пределах диапазона доз DBC, протестированного здесь, следовательно, нет никаких доказательств отсутствия защиты Chl при максимальной дозе DBC.

Также нет доказательств влияния дозы DBC или Chl на фенотип опухоли. Опухоли печени, инициированные DBC, были в первую очередь гепатоцеллюлярными карциномами (HCC) и аденомами (HCA), с относительно небольшим количеством смешанных гепатоцеллюлярных / холангиоцеллюлярных карцином (MC) или аденом (MA) () в соответствии с предыдущими данными (Reddy et al ., 1999. ; Pratt et al ., 2007). Не было дозозависимого изменения DBC в относительных процентах HCC, HCA или MC, трех наиболее распространенных фенотипов печени форели (P≥0.1, все три фенотипа). Добавление Chl в любой дозе не изменило фенотипический ответ (P ≥ 0,1 для HCC, HCA и MC) по сравнению с ответом от одного DBC. Все опухоли желудка были одного фенотипа - папиллярная аденома, независимо от дозы DBC или Chl.

3.3 Моделирование ответов опухоли

Исследование было разработано частично для того, чтобы определить, остается ли степень защиты Chl постоянной в диапазоне доз DBC. Эта информация жизненно важна, если мы хотим рассмотреть возможность экстраполяции степени защиты Chl при высоких дозах и заболеваемости канцерогенов, что было бы типично для исследований химиопрофилактики на грызунах, до более низких доз и заболеваемости, более репрезентативных для риска рака человека.Использование дизайна матрицы доза-доза позволяет оценить степень защиты от химиопрофилактики рака для любой из нескольких доз антиканцерогенов путем моделирования влияния каждой дозы на форму и положение всей кривой доза-ответ (Pratt et al. ., 2007). Как мы показали ранее, степень защиты при любой дозе химиопрофилактического агента не будет зависеть от дозы канцерогена в тех условиях, если таковые имеются, где кривые зависимости logit [частота] от log [канцерогена] доза-ответ с агентом и без него такая же форма, но со смещением по горизонтали (Dashwood et al ., 1989). Эти наборы данных также можно использовать для получения количественных оценок эффективности Chl для ингибирования образования опухоли при любой или всех дозах DBC. Для этого доза канцерогена, необходимая для получения ρ% заболеваемости опухолью, определяется как значение TDρ. Например, при ρ = 25% кривая ответа для каждой дозы Chl даст оценку TD 25 , которую можно использовать для расчета величины ингибирования опухоли для этой дозы Chl, используя следующее:% ингибирования = 100 ( 1- (TD 25Chlo / TD Chlx )), где Chlo относится к лечению без Chl, а Chlx относится к лечению в любой дозе X (Dashwood et al ., 1989). Когда кривые логит-ответ-логарифмическая доза являются линейными и параллельными, процент ингибирования, рассчитанный на основе любой заболеваемости опухолью в линейном диапазоне, будет эквивалентным, то есть степень ингибирования не зависит от дозы канцерогена. Это было бы тем обстоятельством, при котором существует больше оснований для экстраполяции данных ингибирования от высоких доз канцерогенов и ответов опухоли на воздействия и уровни рака, более актуальные для людей.

Ответ опухоли печени на различные дозы DBC был достаточным () для получения полного набора из пяти немоделированных кривых доза-ответ ().Используя данные до максимальной эффективной дозы включительно, кривые были успешно смоделированы с помощью логистической регрессии в виде серии линейных и параллельных кривых доза-реакция (общее несоответствие (11df) p> 0,45) с каждым увеличением. в Chl обеспечивает последовательные смещения в сторону более высоких значений TD (, вставка). Эти данные подтверждают вывод о том, что величина ингибирования опухоли печени увеличивается с дозой Chl и не зависит от дозы DBC для каждой из четырех исследованных доз Chl и для всех доз DBC до оптимальной.Напротив, включение точек данных за пределами оптимума (более 112 ppm DBC для [Chl] 2000 ppm и ниже; и выше 224 ppm DBC при 4000 ppm) приводит к отказу от модели параллельного смещения (). Это условие препятствует экстраполяции данных при наивысшей дозе DBC, чтобы предсказать что-либо о возможных химиопрофилактических эффектах Chl при более низком воздействии канцерогенов и заболеваемости раком, потенциально значимой для человека.

Поскольку DBC является мультиорганным канцерогеном для форели, мы смогли сравнить химиопрофилактическую эффективность Chl в желудке и печени.Однако есть некоторые ограничения из-за снижения чувствительности желудка к DBC и Chl (Bailey et al ., 2009). Как видно на фиг.3, реакция опухоли желудка на различные дозы DBC также давала пять кривых зависимости ответа от дозы. Если исследовать весь набор данных опухоли желудка среди всех доз DBC, он не соответствует регрессионной модели с линейными и параллельными линиями (p <0,013). Однако уже было известно, что диапазон доз DBC неотличим от фона во втором органе для двух самых низких доз DBC (Bailey et al ., 2009), так что эти точки данных DBC не будут использоваться при моделировании откликов параллельного смещения. Дополнительная проблема возникает из-за того, что эффективность ингибирования Хл в желудке меньше, чем в печени. Это означает, что конструкция, оптимизированная для печени, имеет меньшую чувствительность для демонстрации возрастающего ингибирования с увеличением дозы Хл в этом органе. В частности, наблюдается значительное совпадение наблюдаемой заболеваемости опухолями между кривыми 500–2000 ppm Chl (). Это происходит как естественное следствие уменьшенного ингибирования Хл в желудке по сравнению с печенью, а также статистических ограничений обнаружения тонких различий в модуляторах, несмотря на использование более 9000 животных для оценки ответа опухоли.Эти ограничения были устранены путем моделирования упрощенной матрицы набора данных для доз DBC выше фона (56, 112, 224 ppm), сопоставленных с 0, 2000 и 4000 ppm Chl. Для этого подмножества данных кривые доза-реакция успешно соответствуют регрессионной модели с линейными и параллельными линиями достаточно хорошо, отсутствие соответствия, p = 0,66 (, вставка).

После того, как данные были успешно сопоставлены с моделями с параллельным смещением, можно было определить% ингибирования, как указано выше. Для печени это вычисление дает мощности доза-ответ для% ингибирования Chl (± S.E.) 29 (± 7), 36 (± 7), 46 (± 8) и 63 (± 7)% при дозах Хл 500, 1000, 2000 и 4000 ppm соответственно (см.). Для желудка ингибирование% Chl составляет 24 (± 9)% для 2000 ppm Chl и 45 (± 7)% для 4000 ppm Chl (). Следовательно, DBC проявляет меньшую активность в отношении инициации опухоли в желудке, чем в печени, а диетический Chl менее эффективен в качестве блокирующего агента против DBC в этом органе. Взятые вместе, эти результаты подтверждают идею о том, что концентрации Chl, обычно встречающиеся в богатых Chl зеленых овощах, таких как шпинат, могут обеспечить существенную химиопротекцию рака против таких многоорганных генотоксинов, как DBC.Они также ясно показывают, что дизайн матрицы дозы, оптимизированный для одного органа (печени), может не дать оптимальных результатов для другого органа.

Процент ингибирования конечной заболеваемости опухолью в печени (панель A) и желудке (панель B) при различных концентрациях пищевого Chl. Процент ингибирования рассчитывали для каждой дозы Хл на основе изменения значения DBC TD 25 (см. Текст). Значения ингибирования опухоли печени определяли, как описано в разделе результатов. Рацион содержал 14, 28, 56, 112, 224 или 448 ppm DBC и 500, 1000, 2000 или 4000 ppm Chl.Планки погрешностей представляют собой 95% доверительные интервалы.

3,4 Влияние Хл на кажущуюся множественность опухоли печени

Из-за масштабов исследования мы не смогли провести исчерпывающую патологию на каждом поражении в печени, несущем несколько грубо наблюдаемых поражений. Однако было возможно изучить данные о макроскопических поражениях на предмет возможных эффектов доз DBC и Chl на «кажущуюся множественность опухолей». Подобно данным о заболеваемости опухолями, кажущаяся множественность опухолей печени показала максимальный ответ, который имел место около 56 ppm DBC для этой конечной точки ().Увеличение доз совместного лечения с Хл сдвигало кривую доза-ответ вправо в сторону более высоких доз DBC. Однако доза-ответ для множественности опухоли не является простой линейной или монотонной функцией дозы DBC, и, как следствие, эффекты вмешательства Chl в значительной степени зависят от дозы DBC. При трех наименьших испытанных дозах DBC (14, 28, 56 ppm) концентрации Chl 500–4000 ppm снижали наблюдаемую видимую множественность опухоли по сравнению с одним DBC, что значительно выше при 56 ppm DBC (p <0.02). Однако эффекты добавок Chl при дозах DBC, превышающих оптимальную, равную 56 ppm, дали совершенно разные результаты. Например, добавление 500, 1000 или 2000 ppm Chl не привело к снижению кажущейся множественности, но вместо этого значительно увеличило ее по сравнению с 112 ppm DBC (p = 0,059, 0,014, 0,008, соответственно; попарный точный тест Вилкоксина). Это открытие резюмирует и подкрепляет наши предыдущие наблюдения с совместным лечением CHL, которые продемонстрировали ту же картину, что и Chl, по уменьшению видимой множественности опухоли печени при низких дозах DBC, но усиливая ее при более высоких дозах DBC (Pratt et al ., 2007).

Воздействие Chl на видимую множественность опухолей в печени. Форель исследовали на предмет образования опухолей через 9 месяцев после прекращения воздействия DBC. Видимая множественность опухоли используется для обозначения включения некоторых грубых, а также гистологически подтвержденных поражений среди людей с более чем одним поражением. Планки погрешностей представляют собой стандартное отклонение.

3.5 Относительная химиопрофилактическая эффективность препаратов CHL и Chl

Все виды хлорофилла при тестировании в концентрации 2000 ppm значительно снижали заболеваемость опухолями печени ().Хорошо зарекомендовавший себя положительный контроль для химиопрофилактики, 2000 ppm CHL, показал существенное и значительное снижение с 57% заболеваемости только DBC до 12% (p <0,0001). Chl, очищенный с помощью CCC, давал аналогичный ответ, от 57% до 14% (p <0,05). Экстракт Chl, использованный в части исследования, посвященной матрице дозы и дозы, снизил заболеваемость опухолями печени с 57% до 31% (p <0,005). Экстракт Chl, очищенный CCC Chl и CHL также показали значительное снижение частоты возникновения опухоли желудка, инициированной DBC (p = 0.002; p <0,0001, p <0,0001 соответственно). Основываясь на этих результатах, экстракт Chl, содержащий 2000 ppm Chl, оказался менее эффективным, чем 2000 ppm очищенного Chl (p <0,0001) или 2000 ppm CHL (p <0,0001) в снижении частоты опухолей. Основа пониженной эффективности Хл в экстракте в настоящее время неизвестна, но может отражать некоторую степень секвестрации Хл другими компонентами экстракта. В любом случае дополнительной защиты легко добиться, просто увеличив дозу экстракта Chl в рационе (,;).

Уменьшение DBC-индуцированных опухолей печени препаратами Chl. Рацион содержал 112 частей на миллион DBC и 2000 частей на миллион Chl или CHL. Форель исследовали на предмет образования опухолей через 9 месяцев после прекращения воздействия DBC. Заболеваемость опухолью была представлена ​​как наблюдаемое среднее значение (± стандартная ошибка).

3,6 Ингибирование аддуктов DBC-ДНК с помощью Chl

Профили аддуктов DBC-ДНК, выделенных из печени форели, были практически идентичны тем, о которых сообщалось в наших более ранних исследованиях с использованием того же протокола пост-метки 33 P (Harttig and Bailey, 1998; Пратт и др. ., 2007). Профиль аддуктов DBC-ДНК печени () имеет полярные пики аддукта, элюируемые через 10–20 мин, и менее полярные пики, элюируемые через 35–65 минут. Добавление 2000 ppm Chl не изменило профиль аддукта DBC, но действительно изменило величину отклика, означающую снижение общего количества аддукта (). С помощью ВЭЖХ общая концентрация основных аддуктов DBC-ДНК при 112 м.д. DBC была определена как 26 ± 2 пмоль аддуктов / мг ДНК; добавление 2000 ppm Chl в том же самом [DBC] снижало уровни аддуктов DBC-ДНК до 12 ± 1 ppm аддуктов / мг ДНК.Это более чем 50% -ное снижение аддуктов DBC-ДНК за счет воздействия природного Chl в концентрации 2000 ppm, и сравнимо с приблизительным сокращением вдвое конечной заболеваемости опухолью при таком лечении.

Хроматограммы in vivo аддуктов DBC-ДНК радужной форели после пост-мечения 33 P и анализа ВЭЖХ. Профили аддуктов в печени были получены путем 2-недельного воздействия либо 112 ppm DBC (A), либо 112 ppm DBC и 2000 ppm Chl (B). Обратите внимание на тот же профиль с Chl и без него. Уменьшение показано разницей в масштабах по оси ординат.

3.7 Регулирование генов хлорофиллами

Предыдущие исследования (Fahey et al ., 2005) показали, что хлорофиллы могут модулировать паттерны экспрессии генов в культивируемых клетках в направлении, благоприятствующем путям детоксикации канцерогенов. Поскольку это может представлять собой важный механизм химиопротекции, мы провели предварительное исследование влияния пищевых хлорофиллов и DBC на экспрессию генов печени у всего животного. Воздействие 224 ppm диетического DBC приводило к двукратному или большему усилению регуляции 25 аннотированных генов в 11 функциональных категориях в печени форели по сравнению с контролями, не получавшими лечения ().Меньшее количество генов активировалось (13) в печени животных, получавших 80 ppm DBC (данные не показаны), что указывает на то, что изменения экспрессии, вызванные DBC, являются дозозависимыми. Совместное введение 2000 м.д. Chl по существу устраняет индуцированную DBC повышающую экспрессию гена. Не менее важно, что сам по себе Chl практически не оказывает индуктивного действия на транскрипцию, поскольку только один ген из 4000 элементов в этой библиотеке Oncorhynchus продемонстрировал свидетельства повышения регуляции. Общее влияние DBC на понижающее регулирование было менее значительным, но следовало той же тенденции.Как показано на фиг.3, обработка 224 ppm DBC вызывает двукратное или большее подавление активности четырех аннотированных генов форели в четырех функциональных категориях. Опять же, эти эффекты были отменены совместной обработкой 2000 ppm Chl, тогда как Chl сам по себе не оказывал подавляющего действия на транскрипцию. Мы интерпретируем эти результаты как указание на то, что механизм химиопрофилактики Chl согласуется с Chl-опосредованным снижением биодоступности канцерогенов и доступа к органам-мишеням, и не отражает глобальные изменения экспрессии генов печени с помощью Chl.

Таблица III

Гены, активируемые воздействием DBC с пищей по сравнению с химиотерапией

1", "term_text": "BE859102"}} BE859102
Среднее кратное изменение экспрессии генаa a
Ген Аннотация (присоединение к DFCI / присоединение к GenBank) DBC б DBC + Chl c Chl д
Внеклеточная реакция окружающей среды
ARNT TC142567 / {"тип": "энтрез-нуклеотид", "attrs": {"текст": "U73841.1 "," term_id ":" 1695922 "," term_text ":" U73841.1 "}} U73841.1 1,76 - -
Фактор роста
EGFR {"type": "entrez-nucleotide", "attrs": {"text": "FM865854", "term_id": "211970682", "term_text": "FM865854"}} FM865854 1,43 - -
Иммунный ответ
IFITM3 TC146120 / {"type": "entrez-нуклеотид", "attrs": {"text": "AJ320157", "term_id": "20160303", "term_text": "AJ320157"}} AJ320157 1.29 - -
PSME1 {"type": "entrez-nucleotide", "attrs": {"text": "BT074326", "term_id": "225705807", "term_text": "BT074326"}} BT074326 1.00 - -
PSME2 {"type": "entrez-нуклеотид", "attrs": {"text": "BT074299", "term_id": "225705753", "term_text": "BT074299"}} BT074299 1.00 - -
cf H TC162759 / {"type": "entrez-nucleotide", "attrs": {" text ":" AJ627206 "," term_id ":" 869 "," term_text ":" AJ627206 "}} AJ627206 1.12 - -
CD63 TC137037 / {"type": "entrez-нуклеотид", "attrs": {"text": "AY593998", "term_id": "51038280", "term_text ":" AY593998 "}} AY593998 1.00 - -
MHC I TC132378 / {" type ":" entrez-nucleotide "," attrs ": {" text ":" AB012064 " , "term_id": "5688869", "term_text": "AB012064"}} AB012064 1,24 - -
HAMP TC164847 / {"type": "entrez-nucleotide", "attrs ": {" текст ":" AF281354 "," term_id ":" 11095800 "," term_text ":" AF281354 "}} AF281354 1.02
Клеточная пролиферация / апоптоз
P53 TC132531 / {"type": "entrez-нуклеотид", "attrs": {"text": "NM_001124692", "term_id": "185135597", "term_text": "NM_001124692"}} NM_001124692 2,28 - -
PCNA {"type": "entrez-нуклеотид", "attrs": {"text": "NM_131404", "term_id": "563580272", " term_text ":" NM_131404 "}} NM_131404 1.43 - -
MAPK8 {" type ":" entrez-nucleotide "," attrs ": {" text ":" CX028516 "," term_id ":" 56972869 "," term_text ":" CX028516 "}} CX028516 1.34 - -
Метаболизм
CYP1A1 TC158463 / {"type": "entrez-нуклеотид", "attrs": {"text": "U62796", "term_id": "1778054", "term_text": "U62796"}} U62796 2,79 - -
SULT1A2 TC135750 / {"type": "entrez-нуклеотид", "attrs": {"text": "BX867991", "term_id": "598" , "term_text": "BX867991"}} BX867991 1.02 - -
GAPD TC137453 / {"type": "entrez-nucleotide", "attrs": {"text": " NM_001124246 "," term_id ":" 185132745 "," term_text ":" NM_001124246 "}} NM_001124246 1.00 - -
DLAT TC132429 / {"type": "entrez-нуклеотид", "attrs": {"text": "J04051", "term_id": "213775", "term_text ":" J04051 "}} J04051 {" type ":" entrez-нуклеотид "," attrs ": {" text ":" M29099 "," term_id ":" 213775 "}} M29099 1.16 - -
SOD1 NP543739 / {"type": "entrez-нуклеотид", "attrs": {"text": "AF469663", "term_id": "18766890", "term_text": "AF469663"} } AF469663 1,39 - -
Транспортные белки
FXYD TC165305 / {"type": "entrez-нуклеотид", "attrs": {"text": "BT074290", "term_id": "225705735", "term_text": "BT074290"}} BT074290 1.81 - -
Коэффициенты удлинения
EF-1 alpha TC166688 / {"type": "entrez-nucleotide", "attrs": {"text": "AF498320", "term_id": "20269865", "term_text": "AF498320 "}} AF498320 1,31 - -
Внеклеточный матрикс
Лектин C-типа {"type": "entrez-нуклеотид", "attrs": {"text": "NM_001160495", "term_id": "238231566", "term_text": "NM_001160495"} } NM_001160495 1.00
MMP9 TC132759 / {"type": "entrez-нуклеотид", "attrs": {"text": "AJ320533", "term_id": "20160305", "term_text": "AJ320533"} } AJ320533 1,12 - -
Поддержание костей и хрящей
Катепсин K TC8255 / {"type": "entrez-нуклеотид", "attrs": {"text": "U61499", "term_id": "1698588", "term_text": "U61499"} } U61499 1,45 - -
Функция у форели неизвестна
Катепсин S TC8256 / {"type": "entrez-нуклеотид", "attrs": {"text": "AY622858", "term_id": "54300681", "term_text": "AY622858"} } AY622858 1.17 - -
Общая сигнализация клеток
RhoG TC169097 / {"type": "entrez-нуклеотид", "attrs": {"text": "BE859102", "term_id": "13 1.03 - -

Таблица IV

Гены, подавляемые диетическим воздействием DBC по сравнению с химиотерапией

a
9011 9011 9011 Среднее 9011 9011 изменение экспрессии гена
Ген Аннотация (присоединение к DFCI / присоединение к GenBank) DBC б DBC + Chl c Chl д
Фактор роста
FGF6 NP544420 / {"type": "entrez-нуклеотид", "attrs": {"text": "Y16850", "term_id": "3980189", "term_text": "Y16850"}} Y16850 -1.00 - -
Иммунный ответ
IGF1 NP544251 / {"type": "entrez-нуклеотид", "attrs": {"text": "M95183", "term_id": "213435", "term_text": "M95183"}} M95183 −1,25 - -
LECT2 TC154068 / {"type": "entrez-nucleotide", "attrs": {"text": "AF363272", "term_id": "20385164 "," term_text ":" AF363272 "}} AF363272 -1,15 -
Метаболизм
Vtg1 TC132491 / {"type": "entrez-нуклеотид", "attrs": {"text": "X", "term_id": "1296952", "term_text": "X"}} Х -1.20 - -
Внеклеточный матрикс
MMP TC147381 / {"type": "entrez-нуклеотид", "attrs": {"text": "AB043536", "term_id": "11761265", "term_text": "AB043536"}} AB043536 −1,26 - -

4 Обсуждение

4.1 Химиопрофилактика рака с помощью пищевых хлорофиллов

В настоящем исследовании химиопрофилактики использовалась матрица доза-доза на 12000 животных для оценки дозозависимых эффектов совместное лечение Хл с пищей в широком диапазоне воздействий DBC ().Совместное воздействие с Chl-обогащенным экстрактом шпината, как было показано, обеспечивает дозозависимое снижение конечной заболеваемости опухолями желудка при всех дозах DBC и печени при всех дозах DBC, кроме самой высокой (). Химиопрофилактическая эффективность Хл по сравнению с более низким воздействием DBC оценивалась путем успешного моделирования наборов данных в виде серии параллельных кривых доза-ответ, смещенных в сторону более высокого TD 25 с увеличением [Chl] (, вставка панелей). Согласно этому анализу, потребление 500–4000 частей на миллион Хл снижает заболеваемость опухолями печени до DBC с 29–64% и ответ опухоли желудка с 24–45% ().Эти результаты аналогичны нашему предыдущему исследованию доза-матрица с производным CHL, которое подавляло заболеваемость опухолью печени на 62–82% и заболеваемость опухолью желудка на 30–68% с использованием большего диапазона доз CHL, 1500–6000 ppm (Pratt и др., , 2007). Хотя прямые сравнения затруднены, эти два исследования показывают, что синтетический ХЛ и частично очищенный природный Хл обладают по крайней мере сопоставимой молярной химиопрофилактической эффективностью в этой модели. Более прямое сравнение химиопрофилактической эффективности различных препаратов хлорофилла представлено в.По этому результату, CHL и очищенный CCC Chl были сравнимы по снижению опухолевого ответа в желудке и печени, тогда как экстракт Chl, использованный для большей части исследования матрицы дозировки, демонстрировал пониженную эффективность, требуя дополнительной концентрации в рационе для достижения сопоставимой химиопрофилактики.

4.2 Механизмы химиопрофилактики хлорофиллами

Предыдущие фармакокинетические эксперименты на крысах, фореле и людях-добровольцах предоставили достаточно доказательств того, что пероральное совместное лечение с CHL или очищенным Chl препятствует пероральной абсорбции таких канцерогенов, как DBC, AFB 1 , и некоторые гетероциклические амины, что снижает их системную биодоступность и возможность генетического повреждения.Как было показано в этом и предыдущих исследованиях, снижение биодоступности канцерогена сопровождается значительным сокращением повреждения ДНК органа-мишени канцерогеном и инициации опухоли. Альтернативные или дополнительные механизмы блокирования могут включать изменения в экспрессии и / или каталитической активности ферментов, метаболизирующих ксенобиотики, так что реакции детоксикации благоприятствуют. Действительно, в культуре клеток было показано, что различные хлорофиллы изменяют экспрессию генов, важных для метаболизма канцерогенов.Однако попытки продемонстрировать CHL- или Chl-опосредованные изменения в экспрессии таких генов у всего животного в соответствующих органах-мишенях в условиях химиопрофилактического воздействия до сих пор оказались отрицательными (Simonich et al. , 2007). Настоящий небольшой эксперимент с микрочипами обеспечивает дополнительную поддержку гипотезе о том, что химиопрофилактика Chl происходит просто за счет секвестрации канцерогена в желудочно-кишечном тракте для быстрого выведения из организма. Общий эффект с точки зрения транскрипции заключается в том, что и без того низкая биодоступность DBC дополнительно снижается при совместной обработке хлорофиллом, в то время как хлорофиллы сами по себе не могут изменить экспрессию ни одного из генов форели и семейств генов, доступных для анализа.Привлекательность механически простого механизма секвестрации канцерогенов для вмешательства человека очевидна. Дополнительные эффекты после инициации для Chl могут быть не менее важны для защиты человека. Недавно мы определили, что диета, содержащая 10% шпината, существенно подавляла развитие опухоли в нескольких органах-мишенях (тонкая кишка, толстая кишка, кожа, селезенка, печень, легкие) у крыс, когда эта диета применялась в течение 34 недель после лечения канцерогенами (Dashwood et al., неопубликованные результаты).Механизмы, связанные с этим подавлением опухоли, явно не имеют ничего общего с взаимодействиями Chl-канцероген, но в настоящее время отсутствуют данные, указывающие на то, что подавление может быть приписано самому Chl.

4.3 Ограничения для химиопрофилактики при высокой дозе канцерогена

Ранее пилотные исследования продемонстрировали способность очищенного природного Хл защищать от инициированного DBC онкогенеза печени и желудка у форели (Simonich et al. , 2008) и AFB 1 канцерогенность у крыс (Simonich et al., 2007). Однако в наших первоначальных исследованиях Хл, как и почти во всех других исследованиях химиопрофилактики, использовалась однократная высокая концентрация канцерогена, направленная на обеспечение высокой заболеваемости опухолями в положительном контроле. Это делается регулярно, чтобы максимизировать статистическую мощность для обнаружения значительного снижения конечных точек (биомаркеров, предраковых поражений и опухолей) на доступном количестве животных. Однако центральное предположение таких экспериментов заключается в том, что эффекты вмешательства при высокой дозе канцерогена и высокие конечные реакции будут одинаково применяться при более низких дозах канцерогенов и заболеваемости, более актуальной для воздействия на человека и уровней риска.Это предположение было проверено дважды с использованием моделей доза-доза для 10 000 и 12 000 животных с недорогой моделью радужной форели. В этих исследованиях использовались дифференцированные диетические дозы DBC, сопоставленные с дифференцированными диетическими дозами либо CHL (Pratt et al. , 2007), либо натурального обогащенного Chl экстракта шпината (настоящее исследование). Как и ожидалось, результаты показали, что эффективность Хл, а также ХЛ в обоих органах-мишенях зависела от дозы ингибитора. Однако, вопреки обычному предположению, результаты в основном органе-мишени сильно зависели от дозы канцерогена.При более низких дозах DBC совместная обработка градуированных CHL или Chl обеспечивала сильную защиту от начального образования аддуктов DBC-ДНК в печени, заболеваемости опухолями и множественности опухолей. Однако при высоких дозах DBC совместное лечение любым агентом не защищало от возникновения опухолей и фактически значительно увеличивало множественность опухолей. Мы подчеркиваем, что CHL не смог защитить от опухолевого ответа при высокой дозе DBC, несмотря на защиту от исходных биомаркеров аддукта DBC-ДНК во всем диапазоне доз DBC (Pratt et al., 2007). Это явление произошло из-за того, что частота и множественность дозозависимых ответов для DBC в этом органе-мишени не являются ни линейными, ни даже монотонными, а достигают оптимума при умеренной дозе и снижаются при более высокой дозе. Поскольку чистым эффектом лечения Chl было снижение эффективных воздействий DBC и, таким образом, сдвиг кривых доза-ответ на все более и более высокие уровни обработки DBC, совместные обработки Chl, которые были ингибирующими при более низких обработках DBC, становились неэффективными или усиливались при высоком воздействии DBC.Если бы этот конкретный эксперимент проводился с традиционной однократной высокой дозой DBC, можно было бы сделать вывод, что CHL является либо неэффективным (заболеваемость), либо ко-канцерогенным (множественность) и, следовательно, бесполезен для снижения риска рака человека при воздействии экологически значимого канцерогена. выдержки. Это было бы неудачным выводом и упущенной возможностью, поскольку недавние исследования на людях показывают очевидные перспективы защиты как от Chl, так и от CHL (Dashwood et al. , 1989; Hayashi et al., 1999; Jubert et al. , 2009), при воздействии афлатоксина в окружающей среде.

4.4. Выводы

Результаты настоящего исследования демонстрируют, что увеличение диетических доз Chl-обогащенного экстракта шпината обеспечивает усиление и мощную защиту от начального ответа опухоли, инициированного DBC, в двух органах-мишенях, что защита экстрактом была умеренно снижена по сравнению с эквивалентные дозы CHL или очищенного Chl, и эта защита происходила в отсутствие очевидных изменений в паттернах экспрессии генов.Мы также определили, что защитная эффективность совместного воздействия Хл с пищей сильно зависит от концентрации DBC в рационе, с хорошей защитой в обоих органах-мишенях при низкой дозе канцерогена и ответом опухоли, но очевидным усилением ответа опухоли печени при высоких дозах канцерогена. и опухолевые реакции, не встречающиеся в человеческих популяциях. Эти результаты подчеркивают необходимость в разработке исследований химиопрофилактики рака для выбора доз канцерогена в пределах известного линейного или монотонного диапазона доза-реакция.В отсутствие этой информации результаты, полученные при высоких дозах канцерогенов и высоких ответах опухоли, могут не иметь отношения к вмешательству человека.

Матричный биомаркер на 12000 животных и исследование опухолей

Резюме

Недавние пилотные исследования показали, что природный хлорофилл (Хл) ингибирует поглощение канцерогенов и онкогенез на моделях грызунов и рыб, а также изменяет поглощение и биораспределение следов 14 C-афлатоксин B1 у людей-добровольцев. Настоящее исследование расширяет эти многообещающие результаты, используя дизайн матрицы доз-доза для изучения Chl-опосредованных эффектов на индуцированное дибензо ( def, p) хризен (DBC) образование аддуктов ДНК, частоту опухолей, множественность опухолей и изменения в генах. регулирование в форели.В матрице «доза-доза» использовались исходные 12360 радужной форели, которую лечили 0–4000 ч. / Млн диетического Хл вместе с 0–225 ч. / Млн ДБК в течение до 4 недель. Было обнаружено, что диетический DBC вызывает дозозависимые изменения в экспрессии генов, которые устраняются совместной обработкой Chl, тогда как Chl сам по себе не влияет на те же гены. Совместная обработка Chl обеспечила дозозависимое снижение общих аддуктов DBC-ДНК без изменения относительной интенсивности аддуктов по хроматографическому профилю. У животных, получавших только DBC, частота опухолей печени (как logit) и множественность опухолей были линейными в зависимости от дозы DBC (как log) вплоть до их максимальной эффективной дозы и после этого снижались.Совместное лечение Хл существенно снижало частоту и множественность при дозах DBC до их максимальной эффективной дозы. Эти результаты показывают, что концентрации Chl, встречающиеся в богатых Chl зеленых овощах, могут обеспечивать существенную химиопротекцию рака, и предполагают, что они делают это за счет снижения биодоступности канцерогенов. Однако при дозах DBC, превышающих оптимальные, совместное лечение Chl не смогло снизить заболеваемость опухолью и значительно увеличить множественность. Это открытие ставит под сомнение уместность исследований химиопрофилактики, проводимых на людях с высокими дозами канцерогенов, которые, как не доказано, лежат в линейном или, по крайней мере, монотонном диапазоне конечной точки доза-реакция.

Ключевые слова: хлорофилл, хлорофиллин, дибензо ( def, p ) хризен, заболеваемость опухолями, биодоступность, рак печени, рак желудка, химиопрофилактика

1 Введение

Полициклический ароматический углеводород дибензо, p def хризен (DBC), ранее известный как дибензо ( a, l ) пирен или DBP, может быть легко обнаружен в твердых частицах при сжигании древесного угля, угля и мазута (Deraat et al. , 1987; Mumford et al. al., 1987; Мамфорд и др. , 1995) в образцах почвы и донных отложений (Kozin et al. , 1995), в конденсате выхлопных газов автомобилей (Seidel et al. , 2004) и в конденсате табачного дыма (Snook et al. , 1977; Hoffmann и Hoffmann, 1998). DBC демонстрирует сильную мутагенность in vitro в анализах бактериальных и животных клеток (Busby et al. , 1995; Durant et al. , 1999), образует множественные аддукты ДНК in vitro и in vivo (Mahadevan и другие., 2005), и может действовать на in vivo через промоторные механизмы, а также механизмы инициации опухоли (Baird et al. , 2005). Сравнительные исследования на моделях грызунов показали, что DBC является наиболее канцерогенным полициклическим ароматическим углеводородом, испытанным на сегодняшний день, значительно превосходящим эффективность хорошо известных канцерогенов бензо [ a ] пирен и 7,12-диметилбенз [ a ] антрацен ( Кавальери и др. , 1989; Кавальери и др. , 1991; Хиггинботам и др., 1993; LaVoie et al. , 1993). Кожное нанесение DBC мышам привело к опухолям кожи и легких и злокачественной лимфоме, поражающей несколько органов (Higginbotham et al. , 1993). Внутрибрюшинное введение DBC мышам вызывало опухоли легких (Prahalad et al. , 1997), а внутримолочная инъекция крысам приводила к опухолям молочной железы (Cavalieri et al. , 1991). У радужной форели воздействие DBC с пищей приводило к опухолям желудка, печени и плавательного пузыря (Reddy et al., 1999; Pratt et al. , 2007; Simonich et al. , 2008).

Исключительно высокая канцерогенная активность DBC (Bailey et al. , 2009), наряду с неизбежным и потенциально значительным воздействием на человека в городских районах, делает меры по смягчению его неблагоприятных эффектов особенно привлекательными. Эксперименты на животных моделях выявили множество природных и синтетических химиопрофилактических агентов, которые могут резко ингибировать вызванное канцерогеном повреждение и, как следствие, заболеваемость раком (см. Обзор (Barrett, 2002; Guyton and Kensler, 2002; Hirose et al., 2002; Кенслер, 2004; Аггарвал и Шисодиа, 2006 г .; Kelloff et al. , 2006; Райт и др. , 2006)). Один из таких агентов, хлорофиллин (CHL), натрий-медное производное хлорофилла (Chl), кажется многообещающим в качестве нетоксичного агента, который может защитить от нескольких классов пищевых канцерогенов, включая DBC, на животных моделях. В исследовании vivo механистические исследования на млекопитающих и рыбах показывают, что диетический ХЛ блокирует инициирование опухоли (Reddy et al. , 1999; Pratt et al., 2007; Simonich et al. , 2008) и in vitro Исследования предполагают, что это может происходить частично за счет образования прочных комплексов с такими канцерогенами, как афлатоксины, DBC и некоторые гетероциклические амины (Breinholt et al. , 1995; Dashwood et al. др. , 1996; Hayashi и др. , 1999), которые разделяют частично плоские ароматические структурные элементы. Независимо от того, за счет образования комплекса или какого-либо другого неопределенного транспортного механизма, совместное лечение CHL эффективно ингибирует абсорбцию этих канцерогенов, тем самым снижая биодоступность для ткани-мишени, аддукцию ДНК и окончательный ответ опухоли (Dashwood et al., 1998). Трансляционные эксперименты продемонстрировали, что CHL может значительно снизить биомаркеры эффективного воздействия канцерогенов у людей в Китае с хроническим, неизбежно высоким воздействием афлатоксина B 1 (AFB 1 ) и высокой заболеваемостью раком печени (Qian et al. , 1994; Якобсон и др. , 1997; Эгнер и др. , 2001; Эгнер и др. , 2003). Недавнее исследование микродозирования показало, что совместное воздействие CHL достигает этого за счет значительного изменения фармакокинетических параметров AFB 1 и снижения его биодоступности для людей (Jubert et al., 2009), как и в моделях на животных. Дополнительное подтверждение полезности CHL для вмешательства человека обеспечивается недавним исследованием Shaughnessy (Shaughnessy et al. ), который обнаружил, что таблетки CHL в сочетании с овощами семейства крестоцветных и йогуртом снижают повреждение колоректальной ДНК и системную генотоксичность у людей, потребляющих мясо. приготовленные при высокой температуре.

Хотя эти результаты предполагают значительный потенциал добавок CHL в снижении риска рака у человека, имеется относительно мало информации о химиопротективном потенциале природных хлорофиллов, поскольку они могут присутствовать в рационе человека.Недавно мы сообщили, что в модели канцерогенеза радужной форели совместное воздействие с пищей в течение одного месяца до 1000–6000 частей на миллион высокоочищенного хлора резко снижает частоту возникновения опухолей печени и желудка, инициированных DBC (Simonich et al. , 2008). . Мы также сообщили об аналогичной степени защиты от ранних и поздних предраковых биомаркеров у крыс, когда 2000 ppm очищенного Chl вводили совместно с 250 ppb AFB 1 (Simonich et al. , 2007). Наконец, наше недавнее исследование микродозирования показало, что совместное лечение очищенным Chl было так же эффективно, как и CHL, в изменении фармакокинетических параметров AFB 1 и снижении его поглощения у людей-добровольцев (Jubert et al., 2009 г.). Хотя эти результаты предполагают, что природные хлорофиллы могут иметь защитную эффективность, сравнимую с производной CHL, проблемы со стабильностью и стоимостью в настоящее время ограничивают использование высокоочищенных хлорофиллов в качестве долгосрочной стратегии вмешательства человека. Одна из целей настоящего исследования состояла в том, чтобы сравнить химиопрофилактическую эффективность более доступного экстракта шпината, обогащенного Хл, с таковым очищенного Хл и коммерческого ХЛ. Дополнительная и важная цель исследования состояла в том, чтобы определить, были ли наши предыдущие наблюдения зависимости от дозы канцерогена в химиопрофилактике рака (Pratt et al., 2007) можно было подтвердить. Уместен вопрос, могут ли химиопрофилактические эффекты или отсутствие эффектов, наблюдаемые на данной животной модели при высокой дозе канцерогена, экстраполировать на более низкие воздействия канцерогенов и опухолевые реакции, характерные для людей. Чтобы решить эту проблему, мы использовали матрицу «доза-доза» для 12 000 животных, которая обеспечивает количественное исследование химиопрофилактической эффективности как функции канцерогена, а также дозы Хл. Конечными точками и оцененными биомаркерами были начальная аддукция DBC-ДНК, изменения в профилях экспрессии генов и окончательные ответы опухоли в печени и желудке.

3 Результаты

3.1 Образование опухоли, инициированное DBC

Диетическое введение DBC молоди радужной форели в течение 4 недель привело к дозозависимому образованию опухолей печени и желудка при отборе проб через 9 месяцев после прекращения лечения DBC с помощью диеты (). Опухолевые ответы в печени и желудке для этого исследования полностью совпадают с таковыми в нашем исследовании мега-доза-реакция на 40 800 животных ED 01 с DBC (Reddy et al ., 1999; Bailey et al ., 2009) (Reddy и др. ., 1999) и демонстрируют явные различия в дозозависимости DBC в двух основных органах-мишенях. Как видно на фиг.2, частота поражения печени увеличивалась прямо пропорционально дозе DBC по логит-шкале в диапазоне 14–112 ppm, тогда как ответ на следующую более высокую дозу 224 ppm был ниже, чем ответ на 112 ppm (p <0,0001, квазивероятность f-тест с масштабным параметром, оцениваемым по всему набору данных). Таким образом, доза-реакция на DBC в этой модели и органе-мишени немонотонна и демонстрирует дозу с максимальным эффектом.Это резко контрастирует с AFB 1 , который дает ответ с частотой, прямо пропорциональной дозе, в широком диапазоне воздействия в модели форели (Dashwood et al ., 1998). В желудке реакция на DBC не была значительно выше фона при двух самых низких дозах, как ожидалось в нашем предыдущем исследовании (Bailey et al ., 2009). Это исключает возможность изучения химиопрофилактических эффектов на этот орган при использовании этих двух доз. Мы не рассматриваем это очевидное отставание в обнаруживаемой реакции как свидетельство порогового значения в этом органе, скорее это пример недостаточного количества животных, чтобы отличить вызванный канцерогеном ответ от фонового при этих сверхмалых дозах (Bailey et al ., 2009). Мы также отмечаем, что токсичность DBC для молоди форели (Bailey et al ., 2009) исключает тестирование при дозах, намного превышающих 224 ppm, если также не вводится эффективное химиопротекторное средство, такое как Chl (например, как в группе лечения 24). Заболеваемость опухолью желудка, по-видимому, увеличивалась прямо пропорционально дозе по логит-шкале при дозах в диапазоне 56–224 ppm, что дает полезный диапазон для изучения химиопрофилактических эффектов хлорофиллов в этом органе.

3.2 Ингибирование ответа опухоли диетическими хлорофиллами

Потенциал совместного лечения с диетой с экстрактом Chl ингибировать ответ опухоли на DBC в печени показан на и.Степень ингибирования, по-видимому, увеличивалась с дозой Chl и наблюдалась при всех дозах DBC, вплоть до максимальной эффективной дозы при 112 ppm DBC. Однако при концентрации DBC 224 ppm, что превышает максимальную эффективную дозу, не было доказательств ингибирования опухоли при любой дозе Chl (). В желудке () имелись четкие доказательства ингибирования заболеваемости опухолями при каждой из четырех испытанных доз Chl для доз DBC, превышающих фоновый уровень 56, 112 и 224 ppm. Визуальный осмотр данных печени и желудка, нанесенных на график. Шкала логарифмической заболеваемости в сравнении с логарифмической шкалой [DBC] (соответственно) дает общее представление о кривых доза-ответ опухоли DBC, сдвигающихся дальше вправо с увеличением доз Chl.То есть каждая доза Chl сдвигала кривую зависимости зависимости от дозы только канцерогена в обоих органах, так что для достижения любого конкретного опухолевого ответа потребовались бы более высокие дозы DBC. Как уже отмечалось, заболеваемость опухолью желудка при самых низких дозах DBC, 14 и 28 ppm, существенно не отличалась от фона (p = 0,06 и p = 0,3, соответственно). При более высоких дозах DBC Хл сдвигала кривую доза-реакция только для DBC вправо. Отметим, однако, что максимальная степень сдвига при 4000 ppm Chl была лишь примерно вдвое меньше, чем в печени.Как следствие, степень сдвига между промежуточными дозами Хл 500–2000 ppm Хл в желудке различить менее легко, чем в печени. В целом, однако, визуальный осмотр кривых доза-ответ DBC при 0, промежуточном и 4000 ppm Chl подтверждает прогрессивный сдвиг вправо (ингибирование ответа опухоли) с увеличением совместной обработки Chl (вставка). В отличие от печени, кривая доза-реакция только для DBC в желудке не проходит через оптимум в пределах диапазона доз DBC, протестированного здесь, следовательно, нет никаких доказательств отсутствия защиты Chl при максимальной дозе DBC.

Также нет доказательств влияния дозы DBC или Chl на фенотип опухоли. Опухоли печени, инициированные DBC, были в первую очередь гепатоцеллюлярными карциномами (HCC) и аденомами (HCA), с относительно небольшим количеством смешанных гепатоцеллюлярных / холангиоцеллюлярных карцином (MC) или аденом (MA) () в соответствии с предыдущими данными (Reddy et al ., 1999. ; Pratt et al ., 2007). Не было дозозависимого изменения DBC в относительных процентах HCC, HCA или MC, трех наиболее распространенных фенотипов печени форели (P≥0.1, все три фенотипа). Добавление Chl в любой дозе не изменило фенотипический ответ (P ≥ 0,1 для HCC, HCA и MC) по сравнению с ответом от одного DBC. Все опухоли желудка были одного фенотипа - папиллярная аденома, независимо от дозы DBC или Chl.

3.3 Моделирование ответов опухоли

Исследование было разработано частично для того, чтобы определить, остается ли степень защиты Chl постоянной в диапазоне доз DBC. Эта информация жизненно важна, если мы хотим рассмотреть возможность экстраполяции степени защиты Chl при высоких дозах и заболеваемости канцерогенов, что было бы типично для исследований химиопрофилактики на грызунах, до более низких доз и заболеваемости, более репрезентативных для риска рака человека.Использование дизайна матрицы доза-доза позволяет оценить степень защиты от химиопрофилактики рака для любой из нескольких доз антиканцерогенов путем моделирования влияния каждой дозы на форму и положение всей кривой доза-ответ (Pratt et al. ., 2007). Как мы показали ранее, степень защиты при любой дозе химиопрофилактического агента не будет зависеть от дозы канцерогена в тех условиях, если таковые имеются, где кривые зависимости logit [частота] от log [канцерогена] доза-ответ с агентом и без него такая же форма, но со смещением по горизонтали (Dashwood et al ., 1989). Эти наборы данных также можно использовать для получения количественных оценок эффективности Chl для ингибирования образования опухоли при любой или всех дозах DBC. Для этого доза канцерогена, необходимая для получения ρ% заболеваемости опухолью, определяется как значение TDρ. Например, при ρ = 25% кривая ответа для каждой дозы Chl даст оценку TD 25 , которую можно использовать для расчета величины ингибирования опухоли для этой дозы Chl, используя следующее:% ингибирования = 100 ( 1- (TD 25Chlo / TD Chlx )), где Chlo относится к лечению без Chl, а Chlx относится к лечению в любой дозе X (Dashwood et al ., 1989). Когда кривые логит-ответ-логарифмическая доза являются линейными и параллельными, процент ингибирования, рассчитанный на основе любой заболеваемости опухолью в линейном диапазоне, будет эквивалентным, то есть степень ингибирования не зависит от дозы канцерогена. Это было бы тем обстоятельством, при котором существует больше оснований для экстраполяции данных ингибирования от высоких доз канцерогенов и ответов опухоли на воздействия и уровни рака, более актуальные для людей.

Ответ опухоли печени на различные дозы DBC был достаточным () для получения полного набора из пяти немоделированных кривых доза-ответ ().Используя данные до максимальной эффективной дозы включительно, кривые были успешно смоделированы с помощью логистической регрессии в виде серии линейных и параллельных кривых доза-реакция (общее несоответствие (11df) p> 0,45) с каждым увеличением. в Chl обеспечивает последовательные смещения в сторону более высоких значений TD (, вставка). Эти данные подтверждают вывод о том, что величина ингибирования опухоли печени увеличивается с дозой Chl и не зависит от дозы DBC для каждой из четырех исследованных доз Chl и для всех доз DBC до оптимальной.Напротив, включение точек данных за пределами оптимума (более 112 ppm DBC для [Chl] 2000 ppm и ниже; и выше 224 ppm DBC при 4000 ppm) приводит к отказу от модели параллельного смещения (). Это условие препятствует экстраполяции данных при наивысшей дозе DBC, чтобы предсказать что-либо о возможных химиопрофилактических эффектах Chl при более низком воздействии канцерогенов и заболеваемости раком, потенциально значимой для человека.

Поскольку DBC является мультиорганным канцерогеном для форели, мы смогли сравнить химиопрофилактическую эффективность Chl в желудке и печени.Однако есть некоторые ограничения из-за снижения чувствительности желудка к DBC и Chl (Bailey et al ., 2009). Как видно на фиг.3, реакция опухоли желудка на различные дозы DBC также давала пять кривых зависимости ответа от дозы. Если исследовать весь набор данных опухоли желудка среди всех доз DBC, он не соответствует регрессионной модели с линейными и параллельными линиями (p <0,013). Однако уже было известно, что диапазон доз DBC неотличим от фона во втором органе для двух самых низких доз DBC (Bailey et al ., 2009), так что эти точки данных DBC не будут использоваться при моделировании откликов параллельного смещения. Дополнительная проблема возникает из-за того, что эффективность ингибирования Хл в желудке меньше, чем в печени. Это означает, что конструкция, оптимизированная для печени, имеет меньшую чувствительность для демонстрации возрастающего ингибирования с увеличением дозы Хл в этом органе. В частности, наблюдается значительное совпадение наблюдаемой заболеваемости опухолями между кривыми 500–2000 ppm Chl (). Это происходит как естественное следствие уменьшенного ингибирования Хл в желудке по сравнению с печенью, а также статистических ограничений обнаружения тонких различий в модуляторах, несмотря на использование более 9000 животных для оценки ответа опухоли.Эти ограничения были устранены путем моделирования упрощенной матрицы набора данных для доз DBC выше фона (56, 112, 224 ppm), сопоставленных с 0, 2000 и 4000 ppm Chl. Для этого подмножества данных кривые доза-реакция успешно соответствуют регрессионной модели с линейными и параллельными линиями достаточно хорошо, отсутствие соответствия, p = 0,66 (, вставка).

После того, как данные были успешно сопоставлены с моделями с параллельным смещением, можно было определить% ингибирования, как указано выше. Для печени это вычисление дает мощности доза-ответ для% ингибирования Chl (± S.E.) 29 (± 7), 36 (± 7), 46 (± 8) и 63 (± 7)% при дозах Хл 500, 1000, 2000 и 4000 ppm соответственно (см.). Для желудка ингибирование% Chl составляет 24 (± 9)% для 2000 ppm Chl и 45 (± 7)% для 4000 ppm Chl (). Следовательно, DBC проявляет меньшую активность в отношении инициации опухоли в желудке, чем в печени, а диетический Chl менее эффективен в качестве блокирующего агента против DBC в этом органе. Взятые вместе, эти результаты подтверждают идею о том, что концентрации Chl, обычно встречающиеся в богатых Chl зеленых овощах, таких как шпинат, могут обеспечить существенную химиопротекцию рака против таких многоорганных генотоксинов, как DBC.Они также ясно показывают, что дизайн матрицы дозы, оптимизированный для одного органа (печени), может не дать оптимальных результатов для другого органа.

Процент ингибирования конечной заболеваемости опухолью в печени (панель A) и желудке (панель B) при различных концентрациях пищевого Chl. Процент ингибирования рассчитывали для каждой дозы Хл на основе изменения значения DBC TD 25 (см. Текст). Значения ингибирования опухоли печени определяли, как описано в разделе результатов. Рацион содержал 14, 28, 56, 112, 224 или 448 ppm DBC и 500, 1000, 2000 или 4000 ppm Chl.Планки погрешностей представляют собой 95% доверительные интервалы.

3,4 Влияние Хл на кажущуюся множественность опухоли печени

Из-за масштабов исследования мы не смогли провести исчерпывающую патологию на каждом поражении в печени, несущем несколько грубо наблюдаемых поражений. Однако было возможно изучить данные о макроскопических поражениях на предмет возможных эффектов доз DBC и Chl на «кажущуюся множественность опухолей». Подобно данным о заболеваемости опухолями, кажущаяся множественность опухолей печени показала максимальный ответ, который имел место около 56 ppm DBC для этой конечной точки ().Увеличение доз совместного лечения с Хл сдвигало кривую доза-ответ вправо в сторону более высоких доз DBC. Однако доза-ответ для множественности опухоли не является простой линейной или монотонной функцией дозы DBC, и, как следствие, эффекты вмешательства Chl в значительной степени зависят от дозы DBC. При трех наименьших испытанных дозах DBC (14, 28, 56 ppm) концентрации Chl 500–4000 ppm снижали наблюдаемую видимую множественность опухоли по сравнению с одним DBC, что значительно выше при 56 ppm DBC (p <0.02). Однако эффекты добавок Chl при дозах DBC, превышающих оптимальную, равную 56 ppm, дали совершенно разные результаты. Например, добавление 500, 1000 или 2000 ppm Chl не привело к снижению кажущейся множественности, но вместо этого значительно увеличило ее по сравнению с 112 ppm DBC (p = 0,059, 0,014, 0,008, соответственно; попарный точный тест Вилкоксина). Это открытие резюмирует и подкрепляет наши предыдущие наблюдения с совместным лечением CHL, которые продемонстрировали ту же картину, что и Chl, по уменьшению видимой множественности опухоли печени при низких дозах DBC, но усиливая ее при более высоких дозах DBC (Pratt et al ., 2007).

Воздействие Chl на видимую множественность опухолей в печени. Форель исследовали на предмет образования опухолей через 9 месяцев после прекращения воздействия DBC. Видимая множественность опухоли используется для обозначения включения некоторых грубых, а также гистологически подтвержденных поражений среди людей с более чем одним поражением. Планки погрешностей представляют собой стандартное отклонение.

3.5 Относительная химиопрофилактическая эффективность препаратов CHL и Chl

Все виды хлорофилла при тестировании в концентрации 2000 ppm значительно снижали заболеваемость опухолями печени ().Хорошо зарекомендовавший себя положительный контроль для химиопрофилактики, 2000 ppm CHL, показал существенное и значительное снижение с 57% заболеваемости только DBC до 12% (p <0,0001). Chl, очищенный с помощью CCC, давал аналогичный ответ, от 57% до 14% (p <0,05). Экстракт Chl, использованный в части исследования, посвященной матрице дозы и дозы, снизил заболеваемость опухолями печени с 57% до 31% (p <0,005). Экстракт Chl, очищенный CCC Chl и CHL также показали значительное снижение частоты возникновения опухоли желудка, инициированной DBC (p = 0.002; p <0,0001, p <0,0001 соответственно). Основываясь на этих результатах, экстракт Chl, содержащий 2000 ppm Chl, оказался менее эффективным, чем 2000 ppm очищенного Chl (p <0,0001) или 2000 ppm CHL (p <0,0001) в снижении частоты опухолей. Основа пониженной эффективности Хл в экстракте в настоящее время неизвестна, но может отражать некоторую степень секвестрации Хл другими компонентами экстракта. В любом случае дополнительной защиты легко добиться, просто увеличив дозу экстракта Chl в рационе (,;).

Уменьшение DBC-индуцированных опухолей печени препаратами Chl. Рацион содержал 112 частей на миллион DBC и 2000 частей на миллион Chl или CHL. Форель исследовали на предмет образования опухолей через 9 месяцев после прекращения воздействия DBC. Заболеваемость опухолью была представлена ​​как наблюдаемое среднее значение (± стандартная ошибка).

3,6 Ингибирование аддуктов DBC-ДНК с помощью Chl

Профили аддуктов DBC-ДНК, выделенных из печени форели, были практически идентичны тем, о которых сообщалось в наших более ранних исследованиях с использованием того же протокола пост-метки 33 P (Harttig and Bailey, 1998; Пратт и др. ., 2007). Профиль аддуктов DBC-ДНК печени () имеет полярные пики аддукта, элюируемые через 10–20 мин, и менее полярные пики, элюируемые через 35–65 минут. Добавление 2000 ppm Chl не изменило профиль аддукта DBC, но действительно изменило величину отклика, означающую снижение общего количества аддукта (). С помощью ВЭЖХ общая концентрация основных аддуктов DBC-ДНК при 112 м.д. DBC была определена как 26 ± 2 пмоль аддуктов / мг ДНК; добавление 2000 ppm Chl в том же самом [DBC] снижало уровни аддуктов DBC-ДНК до 12 ± 1 ppm аддуктов / мг ДНК.Это более чем 50% -ное снижение аддуктов DBC-ДНК за счет воздействия природного Chl в концентрации 2000 ppm, и сравнимо с приблизительным сокращением вдвое конечной заболеваемости опухолью при таком лечении.

Хроматограммы in vivo аддуктов DBC-ДНК радужной форели после пост-мечения 33 P и анализа ВЭЖХ. Профили аддуктов в печени были получены путем 2-недельного воздействия либо 112 ppm DBC (A), либо 112 ppm DBC и 2000 ppm Chl (B). Обратите внимание на тот же профиль с Chl и без него. Уменьшение показано разницей в масштабах по оси ординат.

3.7 Регулирование генов хлорофиллами

Предыдущие исследования (Fahey et al ., 2005) показали, что хлорофиллы могут модулировать паттерны экспрессии генов в культивируемых клетках в направлении, благоприятствующем путям детоксикации канцерогенов. Поскольку это может представлять собой важный механизм химиопротекции, мы провели предварительное исследование влияния пищевых хлорофиллов и DBC на экспрессию генов печени у всего животного. Воздействие 224 ppm диетического DBC приводило к двукратному или большему усилению регуляции 25 аннотированных генов в 11 функциональных категориях в печени форели по сравнению с контролями, не получавшими лечения ().Меньшее количество генов активировалось (13) в печени животных, получавших 80 ppm DBC (данные не показаны), что указывает на то, что изменения экспрессии, вызванные DBC, являются дозозависимыми. Совместное введение 2000 м.д. Chl по существу устраняет индуцированную DBC повышающую экспрессию гена. Не менее важно, что сам по себе Chl практически не оказывает индуктивного действия на транскрипцию, поскольку только один ген из 4000 элементов в этой библиотеке Oncorhynchus продемонстрировал свидетельства повышения регуляции. Общее влияние DBC на понижающее регулирование было менее значительным, но следовало той же тенденции.Как показано на фиг.3, обработка 224 ppm DBC вызывает двукратное или большее подавление активности четырех аннотированных генов форели в четырех функциональных категориях. Опять же, эти эффекты были отменены совместной обработкой 2000 ppm Chl, тогда как Chl сам по себе не оказывал подавляющего действия на транскрипцию. Мы интерпретируем эти результаты как указание на то, что механизм химиопрофилактики Chl согласуется с Chl-опосредованным снижением биодоступности канцерогенов и доступа к органам-мишеням, и не отражает глобальные изменения экспрессии генов печени с помощью Chl.

Таблица III

Гены, активируемые воздействием DBC с пищей по сравнению с химиотерапией

1", "term_text": "BE859102"}} BE859102
Среднее кратное изменение экспрессии генаa a
Ген Аннотация (присоединение к DFCI / присоединение к GenBank) DBC б DBC + Chl c Chl д
Внеклеточная реакция окружающей среды
ARNT TC142567 / {"тип": "энтрез-нуклеотид", "attrs": {"текст": "U73841.1 "," term_id ":" 1695922 "," term_text ":" U73841.1 "}} U73841.1 1,76 - -
Фактор роста
EGFR {"type": "entrez-nucleotide", "attrs": {"text": "FM865854", "term_id": "211970682", "term_text": "FM865854"}} FM865854 1,43 - -
Иммунный ответ
IFITM3 TC146120 / {"type": "entrez-нуклеотид", "attrs": {"text": "AJ320157", "term_id": "20160303", "term_text": "AJ320157"}} AJ320157 1.29 - -
PSME1 {"type": "entrez-nucleotide", "attrs": {"text": "BT074326", "term_id": "225705807", "term_text": "BT074326"}} BT074326 1.00 - -
PSME2 {"type": "entrez-нуклеотид", "attrs": {"text": "BT074299", "term_id": "225705753", "term_text": "BT074299"}} BT074299 1.00 - -
cf H TC162759 / {"type": "entrez-nucleotide", "attrs": {" text ":" AJ627206 "," term_id ":" 869 "," term_text ":" AJ627206 "}} AJ627206 1.12 - -
CD63 TC137037 / {"type": "entrez-нуклеотид", "attrs": {"text": "AY593998", "term_id": "51038280", "term_text ":" AY593998 "}} AY593998 1.00 - -
MHC I TC132378 / {" type ":" entrez-nucleotide "," attrs ": {" text ":" AB012064 " , "term_id": "5688869", "term_text": "AB012064"}} AB012064 1,24 - -
HAMP TC164847 / {"type": "entrez-nucleotide", "attrs ": {" текст ":" AF281354 "," term_id ":" 11095800 "," term_text ":" AF281354 "}} AF281354 1.02
Клеточная пролиферация / апоптоз
P53 TC132531 / {"type": "entrez-нуклеотид", "attrs": {"text": "NM_001124692", "term_id": "185135597", "term_text": "NM_001124692"}} NM_001124692 2,28 - -
PCNA {"type": "entrez-нуклеотид", "attrs": {"text": "NM_131404", "term_id": "563580272", " term_text ":" NM_131404 "}} NM_131404 1.43 - -
MAPK8 {" type ":" entrez-nucleotide "," attrs ": {" text ":" CX028516 "," term_id ":" 56972869 "," term_text ":" CX028516 "}} CX028516 1.34 - -
Метаболизм
CYP1A1 TC158463 / {"type": "entrez-нуклеотид", "attrs": {"text": "U62796", "term_id": "1778054", "term_text": "U62796"}} U62796 2,79 - -
SULT1A2 TC135750 / {"type": "entrez-нуклеотид", "attrs": {"text": "BX867991", "term_id": "598" , "term_text": "BX867991"}} BX867991 1.02 - -
GAPD TC137453 / {"type": "entrez-nucleotide", "attrs": {"text": " NM_001124246 "," term_id ":" 185132745 "," term_text ":" NM_001124246 "}} NM_001124246 1.00 - -
DLAT TC132429 / {"type": "entrez-нуклеотид", "attrs": {"text": "J04051", "term_id": "213775", "term_text ":" J04051 "}} J04051 {" type ":" entrez-нуклеотид "," attrs ": {" text ":" M29099 "," term_id ":" 213775 "}} M29099 1.16 - -
SOD1 NP543739 / {"type": "entrez-нуклеотид", "attrs": {"text": "AF469663", "term_id": "18766890", "term_text": "AF469663"} } AF469663 1,39 - -
Транспортные белки
FXYD TC165305 / {"type": "entrez-нуклеотид", "attrs": {"text": "BT074290", "term_id": "225705735", "term_text": "BT074290"}} BT074290 1.81 - -
Коэффициенты удлинения
EF-1 alpha TC166688 / {"type": "entrez-nucleotide", "attrs": {"text": "AF498320", "term_id": "20269865", "term_text": "AF498320 "}} AF498320 1,31 - -
Внеклеточный матрикс
Лектин C-типа {"type": "entrez-нуклеотид", "attrs": {"text": "NM_001160495", "term_id": "238231566", "term_text": "NM_001160495"} } NM_001160495 1.00
MMP9 TC132759 / {"type": "entrez-нуклеотид", "attrs": {"text": "AJ320533", "term_id": "20160305", "term_text": "AJ320533"} } AJ320533 1,12 - -
Поддержание костей и хрящей
Катепсин K TC8255 / {"type": "entrez-нуклеотид", "attrs": {"text": "U61499", "term_id": "1698588", "term_text": "U61499"} } U61499 1,45 - -
Функция у форели неизвестна
Катепсин S TC8256 / {"type": "entrez-нуклеотид", "attrs": {"text": "AY622858", "term_id": "54300681", "term_text": "AY622858"} } AY622858 1.17 - -
Общая сигнализация клеток
RhoG TC169097 / {"type": "entrez-нуклеотид", "attrs": {"text": "BE859102", "term_id": "13 1.03 - -

Таблица IV

Гены, подавляемые диетическим воздействием DBC по сравнению с химиотерапией

a
9011 9011 9011 Среднее 9011 9011 изменение экспрессии гена
Ген Аннотация (присоединение к DFCI / присоединение к GenBank) DBC б DBC + Chl c Chl д
Фактор роста
FGF6 NP544420 / {"type": "entrez-нуклеотид", "attrs": {"text": "Y16850", "term_id": "3980189", "term_text": "Y16850"}} Y16850 -1.00 - -
Иммунный ответ
IGF1 NP544251 / {"type": "entrez-нуклеотид", "attrs": {"text": "M95183", "term_id": "213435", "term_text": "M95183"}} M95183 −1,25 - -
LECT2 TC154068 / {"type": "entrez-nucleotide", "attrs": {"text": "AF363272", "term_id": "20385164 "," term_text ":" AF363272 "}} AF363272 -1,15 -
Метаболизм
Vtg1 TC132491 / {"type": "entrez-нуклеотид", "attrs": {"text": "X", "term_id": "1296952", "term_text": "X"}} Х -1.20 - -
Внеклеточный матрикс
MMP TC147381 / {"type": "entrez-нуклеотид", "attrs": {"text": "AB043536", "term_id": "11761265", "term_text": "AB043536"}} AB043536 −1,26 - -

4 Обсуждение

4.1 Химиопрофилактика рака с помощью пищевых хлорофиллов

В настоящем исследовании химиопрофилактики использовалась матрица доза-доза на 12000 животных для оценки дозозависимых эффектов совместное лечение Хл с пищей в широком диапазоне воздействий DBC ().Совместное воздействие с Chl-обогащенным экстрактом шпината, как было показано, обеспечивает дозозависимое снижение конечной заболеваемости опухолями желудка при всех дозах DBC и печени при всех дозах DBC, кроме самой высокой (). Химиопрофилактическая эффективность Хл по сравнению с более низким воздействием DBC оценивалась путем успешного моделирования наборов данных в виде серии параллельных кривых доза-ответ, смещенных в сторону более высокого TD 25 с увеличением [Chl] (, вставка панелей). Согласно этому анализу, потребление 500–4000 частей на миллион Хл снижает заболеваемость опухолями печени до DBC с 29–64% и ответ опухоли желудка с 24–45% ().Эти результаты аналогичны нашему предыдущему исследованию доза-матрица с производным CHL, которое подавляло заболеваемость опухолью печени на 62–82% и заболеваемость опухолью желудка на 30–68% с использованием большего диапазона доз CHL, 1500–6000 ppm (Pratt и др., , 2007). Хотя прямые сравнения затруднены, эти два исследования показывают, что синтетический ХЛ и частично очищенный природный Хл обладают по крайней мере сопоставимой молярной химиопрофилактической эффективностью в этой модели. Более прямое сравнение химиопрофилактической эффективности различных препаратов хлорофилла представлено в.По этому результату, CHL и очищенный CCC Chl были сравнимы по снижению опухолевого ответа в желудке и печени, тогда как экстракт Chl, использованный для большей части исследования матрицы дозировки, демонстрировал пониженную эффективность, требуя дополнительной концентрации в рационе для достижения сопоставимой химиопрофилактики.

4.2 Механизмы химиопрофилактики хлорофиллами

Предыдущие фармакокинетические эксперименты на крысах, фореле и людях-добровольцах предоставили достаточно доказательств того, что пероральное совместное лечение с CHL или очищенным Chl препятствует пероральной абсорбции таких канцерогенов, как DBC, AFB 1 , и некоторые гетероциклические амины, что снижает их системную биодоступность и возможность генетического повреждения.Как было показано в этом и предыдущих исследованиях, снижение биодоступности канцерогена сопровождается значительным сокращением повреждения ДНК органа-мишени канцерогеном и инициации опухоли. Альтернативные или дополнительные механизмы блокирования могут включать изменения в экспрессии и / или каталитической активности ферментов, метаболизирующих ксенобиотики, так что реакции детоксикации благоприятствуют. Действительно, в культуре клеток было показано, что различные хлорофиллы изменяют экспрессию генов, важных для метаболизма канцерогенов.Однако попытки продемонстрировать CHL- или Chl-опосредованные изменения в экспрессии таких генов у всего животного в соответствующих органах-мишенях в условиях химиопрофилактического воздействия до сих пор оказались отрицательными (Simonich et al. , 2007). Настоящий небольшой эксперимент с микрочипами обеспечивает дополнительную поддержку гипотезе о том, что химиопрофилактика Chl происходит просто за счет секвестрации канцерогена в желудочно-кишечном тракте для быстрого выведения из организма. Общий эффект с точки зрения транскрипции заключается в том, что и без того низкая биодоступность DBC дополнительно снижается при совместной обработке хлорофиллом, в то время как хлорофиллы сами по себе не могут изменить экспрессию ни одного из генов форели и семейств генов, доступных для анализа.Привлекательность механически простого механизма секвестрации канцерогенов для вмешательства человека очевидна. Дополнительные эффекты после инициации для Chl могут быть не менее важны для защиты человека. Недавно мы определили, что диета, содержащая 10% шпината, существенно подавляла развитие опухоли в нескольких органах-мишенях (тонкая кишка, толстая кишка, кожа, селезенка, печень, легкие) у крыс, когда эта диета применялась в течение 34 недель после лечения канцерогенами (Dashwood et al., неопубликованные результаты).Механизмы, связанные с этим подавлением опухоли, явно не имеют ничего общего с взаимодействиями Chl-канцероген, но в настоящее время отсутствуют данные, указывающие на то, что подавление может быть приписано самому Chl.

4.3 Ограничения для химиопрофилактики при высокой дозе канцерогена

Ранее пилотные исследования продемонстрировали способность очищенного природного Хл защищать от инициированного DBC онкогенеза печени и желудка у форели (Simonich et al. , 2008) и AFB 1 канцерогенность у крыс (Simonich et al., 2007). Однако в наших первоначальных исследованиях Хл, как и почти во всех других исследованиях химиопрофилактики, использовалась однократная высокая концентрация канцерогена, направленная на обеспечение высокой заболеваемости опухолями в положительном контроле. Это делается регулярно, чтобы максимизировать статистическую мощность для обнаружения значительного снижения конечных точек (биомаркеров, предраковых поражений и опухолей) на доступном количестве животных. Однако центральное предположение таких экспериментов заключается в том, что эффекты вмешательства при высокой дозе канцерогена и высокие конечные реакции будут одинаково применяться при более низких дозах канцерогенов и заболеваемости, более актуальной для воздействия на человека и уровней риска.Это предположение было проверено дважды с использованием моделей доза-доза для 10 000 и 12 000 животных с недорогой моделью радужной форели. В этих исследованиях использовались дифференцированные диетические дозы DBC, сопоставленные с дифференцированными диетическими дозами либо CHL (Pratt et al. , 2007), либо натурального обогащенного Chl экстракта шпината (настоящее исследование). Как и ожидалось, результаты показали, что эффективность Хл, а также ХЛ в обоих органах-мишенях зависела от дозы ингибитора. Однако, вопреки обычному предположению, результаты в основном органе-мишени сильно зависели от дозы канцерогена.При более низких дозах DBC совместная обработка градуированных CHL или Chl обеспечивала сильную защиту от начального образования аддуктов DBC-ДНК в печени, заболеваемости опухолями и множественности опухолей. Однако при высоких дозах DBC совместное лечение любым агентом не защищало от возникновения опухолей и фактически значительно увеличивало множественность опухолей. Мы подчеркиваем, что CHL не смог защитить от опухолевого ответа при высокой дозе DBC, несмотря на защиту от исходных биомаркеров аддукта DBC-ДНК во всем диапазоне доз DBC (Pratt et al., 2007). Это явление произошло из-за того, что частота и множественность дозозависимых ответов для DBC в этом органе-мишени не являются ни линейными, ни даже монотонными, а достигают оптимума при умеренной дозе и снижаются при более высокой дозе. Поскольку чистым эффектом лечения Chl было снижение эффективных воздействий DBC и, таким образом, сдвиг кривых доза-ответ на все более и более высокие уровни обработки DBC, совместные обработки Chl, которые были ингибирующими при более низких обработках DBC, становились неэффективными или усиливались при высоком воздействии DBC.Если бы этот конкретный эксперимент проводился с традиционной однократной высокой дозой DBC, можно было бы сделать вывод, что CHL является либо неэффективным (заболеваемость), либо ко-канцерогенным (множественность) и, следовательно, бесполезен для снижения риска рака человека при воздействии экологически значимого канцерогена. выдержки. Это было бы неудачным выводом и упущенной возможностью, поскольку недавние исследования на людях показывают очевидные перспективы защиты как от Chl, так и от CHL (Dashwood et al. , 1989; Hayashi et al., 1999; Jubert et al. , 2009), при воздействии афлатоксина в окружающей среде.

4.4. Выводы

Результаты настоящего исследования демонстрируют, что увеличение диетических доз Chl-обогащенного экстракта шпината обеспечивает усиление и мощную защиту от начального ответа опухоли, инициированного DBC, в двух органах-мишенях, что защита экстрактом была умеренно снижена по сравнению с эквивалентные дозы CHL или очищенного Chl, и эта защита происходила в отсутствие очевидных изменений в паттернах экспрессии генов.Мы также определили, что защитная эффективность совместного воздействия Хл с пищей сильно зависит от концентрации DBC в рационе, с хорошей защитой в обоих органах-мишенях при низкой дозе канцерогена и ответом опухоли, но очевидным усилением ответа опухоли печени при высоких дозах канцерогена. и опухолевые реакции, не встречающиеся в человеческих популяциях. Эти результаты подчеркивают необходимость в разработке исследований химиопрофилактики рака для выбора доз канцерогена в пределах известного линейного или монотонного диапазона доза-реакция.В отсутствие этой информации результаты, полученные при высоких дозах канцерогенов и высоких ответах опухоли, могут не иметь отношения к вмешательству человека.

Матричный биомаркер на 12000 животных и исследование опухолей

Резюме

Недавние пилотные исследования показали, что природный хлорофилл (Хл) ингибирует поглощение канцерогенов и онкогенез на моделях грызунов и рыб, а также изменяет поглощение и биораспределение следов 14 C-афлатоксин B1 у людей-добровольцев. Настоящее исследование расширяет эти многообещающие результаты, используя дизайн матрицы доз-доза для изучения Chl-опосредованных эффектов на индуцированное дибензо ( def, p) хризен (DBC) образование аддуктов ДНК, частоту опухолей, множественность опухолей и изменения в генах. регулирование в форели.В матрице «доза-доза» использовались исходные 12360 радужной форели, которую лечили 0–4000 ч. / Млн диетического Хл вместе с 0–225 ч. / Млн ДБК в течение до 4 недель. Было обнаружено, что диетический DBC вызывает дозозависимые изменения в экспрессии генов, которые устраняются совместной обработкой Chl, тогда как Chl сам по себе не влияет на те же гены. Совместная обработка Chl обеспечила дозозависимое снижение общих аддуктов DBC-ДНК без изменения относительной интенсивности аддуктов по хроматографическому профилю. У животных, получавших только DBC, частота опухолей печени (как logit) и множественность опухолей были линейными в зависимости от дозы DBC (как log) вплоть до их максимальной эффективной дозы и после этого снижались.Совместное лечение Хл существенно снижало частоту и множественность при дозах DBC до их максимальной эффективной дозы. Эти результаты показывают, что концентрации Chl, встречающиеся в богатых Chl зеленых овощах, могут обеспечивать существенную химиопротекцию рака, и предполагают, что они делают это за счет снижения биодоступности канцерогенов. Однако при дозах DBC, превышающих оптимальные, совместное лечение Chl не смогло снизить заболеваемость опухолью и значительно увеличить множественность. Это открытие ставит под сомнение уместность исследований химиопрофилактики, проводимых на людях с высокими дозами канцерогенов, которые, как не доказано, лежат в линейном или, по крайней мере, монотонном диапазоне конечной точки доза-реакция.

Ключевые слова: хлорофилл, хлорофиллин, дибензо ( def, p ) хризен, заболеваемость опухолями, биодоступность, рак печени, рак желудка, химиопрофилактика

1 Введение

Полициклический ароматический углеводород дибензо, p def хризен (DBC), ранее известный как дибензо ( a, l ) пирен или DBP, может быть легко обнаружен в твердых частицах при сжигании древесного угля, угля и мазута (Deraat et al. , 1987; Mumford et al. al., 1987; Мамфорд и др. , 1995) в образцах почвы и донных отложений (Kozin et al. , 1995), в конденсате выхлопных газов автомобилей (Seidel et al. , 2004) и в конденсате табачного дыма (Snook et al. , 1977; Hoffmann и Hoffmann, 1998). DBC демонстрирует сильную мутагенность in vitro в анализах бактериальных и животных клеток (Busby et al. , 1995; Durant et al. , 1999), образует множественные аддукты ДНК in vitro и in vivo (Mahadevan и другие., 2005), и может действовать на in vivo через промоторные механизмы, а также механизмы инициации опухоли (Baird et al. , 2005). Сравнительные исследования на моделях грызунов показали, что DBC является наиболее канцерогенным полициклическим ароматическим углеводородом, испытанным на сегодняшний день, значительно превосходящим эффективность хорошо известных канцерогенов бензо [ a ] пирен и 7,12-диметилбенз [ a ] антрацен ( Кавальери и др. , 1989; Кавальери и др. , 1991; Хиггинботам и др., 1993; LaVoie et al. , 1993). Кожное нанесение DBC мышам привело к опухолям кожи и легких и злокачественной лимфоме, поражающей несколько органов (Higginbotham et al. , 1993). Внутрибрюшинное введение DBC мышам вызывало опухоли легких (Prahalad et al. , 1997), а внутримолочная инъекция крысам приводила к опухолям молочной железы (Cavalieri et al. , 1991). У радужной форели воздействие DBC с пищей приводило к опухолям желудка, печени и плавательного пузыря (Reddy et al., 1999; Pratt et al. , 2007; Simonich et al. , 2008).

Исключительно высокая канцерогенная активность DBC (Bailey et al. , 2009), наряду с неизбежным и потенциально значительным воздействием на человека в городских районах, делает меры по смягчению его неблагоприятных эффектов особенно привлекательными. Эксперименты на животных моделях выявили множество природных и синтетических химиопрофилактических агентов, которые могут резко ингибировать вызванное канцерогеном повреждение и, как следствие, заболеваемость раком (см. Обзор (Barrett, 2002; Guyton and Kensler, 2002; Hirose et al., 2002; Кенслер, 2004; Аггарвал и Шисодиа, 2006 г .; Kelloff et al. , 2006; Райт и др. , 2006)). Один из таких агентов, хлорофиллин (CHL), натрий-медное производное хлорофилла (Chl), кажется многообещающим в качестве нетоксичного агента, который может защитить от нескольких классов пищевых канцерогенов, включая DBC, на животных моделях. В исследовании vivo механистические исследования на млекопитающих и рыбах показывают, что диетический ХЛ блокирует инициирование опухоли (Reddy et al. , 1999; Pratt et al., 2007; Simonich et al. , 2008) и in vitro Исследования предполагают, что это может происходить частично за счет образования прочных комплексов с такими канцерогенами, как афлатоксины, DBC и некоторые гетероциклические амины (Breinholt et al. , 1995; Dashwood et al. др. , 1996; Hayashi и др. , 1999), которые разделяют частично плоские ароматические структурные элементы. Независимо от того, за счет образования комплекса или какого-либо другого неопределенного транспортного механизма, совместное лечение CHL эффективно ингибирует абсорбцию этих канцерогенов, тем самым снижая биодоступность для ткани-мишени, аддукцию ДНК и окончательный ответ опухоли (Dashwood et al., 1998). Трансляционные эксперименты продемонстрировали, что CHL может значительно снизить биомаркеры эффективного воздействия канцерогенов у людей в Китае с хроническим, неизбежно высоким воздействием афлатоксина B 1 (AFB 1 ) и высокой заболеваемостью раком печени (Qian et al. , 1994; Якобсон и др. , 1997; Эгнер и др. , 2001; Эгнер и др. , 2003). Недавнее исследование микродозирования показало, что совместное воздействие CHL достигает этого за счет значительного изменения фармакокинетических параметров AFB 1 и снижения его биодоступности для людей (Jubert et al., 2009), как и в моделях на животных. Дополнительное подтверждение полезности CHL для вмешательства человека обеспечивается недавним исследованием Shaughnessy (Shaughnessy et al. ), который обнаружил, что таблетки CHL в сочетании с овощами семейства крестоцветных и йогуртом снижают повреждение колоректальной ДНК и системную генотоксичность у людей, потребляющих мясо. приготовленные при высокой температуре.

Хотя эти результаты предполагают значительный потенциал добавок CHL в снижении риска рака у человека, имеется относительно мало информации о химиопротективном потенциале природных хлорофиллов, поскольку они могут присутствовать в рационе человека.Недавно мы сообщили, что в модели канцерогенеза радужной форели совместное воздействие с пищей в течение одного месяца до 1000–6000 частей на миллион высокоочищенного хлора резко снижает частоту возникновения опухолей печени и желудка, инициированных DBC (Simonich et al. , 2008). . Мы также сообщили об аналогичной степени защиты от ранних и поздних предраковых биомаркеров у крыс, когда 2000 ppm очищенного Chl вводили совместно с 250 ppb AFB 1 (Simonich et al. , 2007). Наконец, наше недавнее исследование микродозирования показало, что совместное лечение очищенным Chl было так же эффективно, как и CHL, в изменении фармакокинетических параметров AFB 1 и снижении его поглощения у людей-добровольцев (Jubert et al., 2009 г.). Хотя эти результаты предполагают, что природные хлорофиллы могут иметь защитную эффективность, сравнимую с производной CHL, проблемы со стабильностью и стоимостью в настоящее время ограничивают использование высокоочищенных хлорофиллов в качестве долгосрочной стратегии вмешательства человека. Одна из целей настоящего исследования состояла в том, чтобы сравнить химиопрофилактическую эффективность более доступного экстракта шпината, обогащенного Хл, с таковым очищенного Хл и коммерческого ХЛ. Дополнительная и важная цель исследования состояла в том, чтобы определить, были ли наши предыдущие наблюдения зависимости от дозы канцерогена в химиопрофилактике рака (Pratt et al., 2007) можно было подтвердить. Уместен вопрос, могут ли химиопрофилактические эффекты или отсутствие эффектов, наблюдаемые на данной животной модели при высокой дозе канцерогена, экстраполировать на более низкие воздействия канцерогенов и опухолевые реакции, характерные для людей. Чтобы решить эту проблему, мы использовали матрицу «доза-доза» для 12 000 животных, которая обеспечивает количественное исследование химиопрофилактической эффективности как функции канцерогена, а также дозы Хл. Конечными точками и оцененными биомаркерами были начальная аддукция DBC-ДНК, изменения в профилях экспрессии генов и окончательные ответы опухоли в печени и желудке.

3 Результаты

3.1 Образование опухоли, инициированное DBC

Диетическое введение DBC молоди радужной форели в течение 4 недель привело к дозозависимому образованию опухолей печени и желудка при отборе проб через 9 месяцев после прекращения лечения DBC с помощью диеты (). Опухолевые ответы в печени и желудке для этого исследования полностью совпадают с таковыми в нашем исследовании мега-доза-реакция на 40 800 животных ED 01 с DBC (Reddy et al ., 1999; Bailey et al ., 2009) (Reddy и др. ., 1999) и демонстрируют явные различия в дозозависимости DBC в двух основных органах-мишенях. Как видно на фиг.2, частота поражения печени увеличивалась прямо пропорционально дозе DBC по логит-шкале в диапазоне 14–112 ppm, тогда как ответ на следующую более высокую дозу 224 ppm был ниже, чем ответ на 112 ppm (p <0,0001, квазивероятность f-тест с масштабным параметром, оцениваемым по всему набору данных). Таким образом, доза-реакция на DBC в этой модели и органе-мишени немонотонна и демонстрирует дозу с максимальным эффектом.Это резко контрастирует с AFB 1 , который дает ответ с частотой, прямо пропорциональной дозе, в широком диапазоне воздействия в модели форели (Dashwood et al ., 1998). В желудке реакция на DBC не была значительно выше фона при двух самых низких дозах, как ожидалось в нашем предыдущем исследовании (Bailey et al ., 2009). Это исключает возможность изучения химиопрофилактических эффектов на этот орган при использовании этих двух доз. Мы не рассматриваем это очевидное отставание в обнаруживаемой реакции как свидетельство порогового значения в этом органе, скорее это пример недостаточного количества животных, чтобы отличить вызванный канцерогеном ответ от фонового при этих сверхмалых дозах (Bailey et al ., 2009). Мы также отмечаем, что токсичность DBC для молоди форели (Bailey et al ., 2009) исключает тестирование при дозах, намного превышающих 224 ppm, если также не вводится эффективное химиопротекторное средство, такое как Chl (например, как в группе лечения 24). Заболеваемость опухолью желудка, по-видимому, увеличивалась прямо пропорционально дозе по логит-шкале при дозах в диапазоне 56–224 ppm, что дает полезный диапазон для изучения химиопрофилактических эффектов хлорофиллов в этом органе.

3.2 Ингибирование ответа опухоли диетическими хлорофиллами

Потенциал совместного лечения с диетой с экстрактом Chl ингибировать ответ опухоли на DBC в печени показан на и.Степень ингибирования, по-видимому, увеличивалась с дозой Chl и наблюдалась при всех дозах DBC, вплоть до максимальной эффективной дозы при 112 ppm DBC. Однако при концентрации DBC 224 ppm, что превышает максимальную эффективную дозу, не было доказательств ингибирования опухоли при любой дозе Chl (). В желудке () имелись четкие доказательства ингибирования заболеваемости опухолями при каждой из четырех испытанных доз Chl для доз DBC, превышающих фоновый уровень 56, 112 и 224 ppm. Визуальный осмотр данных печени и желудка, нанесенных на график. Шкала логарифмической заболеваемости в сравнении с логарифмической шкалой [DBC] (соответственно) дает общее представление о кривых доза-ответ опухоли DBC, сдвигающихся дальше вправо с увеличением доз Chl.То есть каждая доза Chl сдвигала кривую зависимости зависимости от дозы только канцерогена в обоих органах, так что для достижения любого конкретного опухолевого ответа потребовались бы более высокие дозы DBC. Как уже отмечалось, заболеваемость опухолью желудка при самых низких дозах DBC, 14 и 28 ppm, существенно не отличалась от фона (p = 0,06 и p = 0,3, соответственно). При более высоких дозах DBC Хл сдвигала кривую доза-реакция только для DBC вправо. Отметим, однако, что максимальная степень сдвига при 4000 ppm Chl была лишь примерно вдвое меньше, чем в печени.Как следствие, степень сдвига между промежуточными дозами Хл 500–2000 ppm Хл в желудке различить менее легко, чем в печени. В целом, однако, визуальный осмотр кривых доза-ответ DBC при 0, промежуточном и 4000 ppm Chl подтверждает прогрессивный сдвиг вправо (ингибирование ответа опухоли) с увеличением совместной обработки Chl (вставка). В отличие от печени, кривая доза-реакция только для DBC в желудке не проходит через оптимум в пределах диапазона доз DBC, протестированного здесь, следовательно, нет никаких доказательств отсутствия защиты Chl при максимальной дозе DBC.

Также нет доказательств влияния дозы DBC или Chl на фенотип опухоли. Опухоли печени, инициированные DBC, были в первую очередь гепатоцеллюлярными карциномами (HCC) и аденомами (HCA), с относительно небольшим количеством смешанных гепатоцеллюлярных / холангиоцеллюлярных карцином (MC) или аденом (MA) () в соответствии с предыдущими данными (Reddy et al ., 1999. ; Pratt et al ., 2007). Не было дозозависимого изменения DBC в относительных процентах HCC, HCA или MC, трех наиболее распространенных фенотипов печени форели (P≥0.1, все три фенотипа). Добавление Chl в любой дозе не изменило фенотипический ответ (P ≥ 0,1 для HCC, HCA и MC) по сравнению с ответом от одного DBC. Все опухоли желудка были одного фенотипа - папиллярная аденома, независимо от дозы DBC или Chl.

3.3 Моделирование ответов опухоли

Исследование было разработано частично для того, чтобы определить, остается ли степень защиты Chl постоянной в диапазоне доз DBC. Эта информация жизненно важна, если мы хотим рассмотреть возможность экстраполяции степени защиты Chl при высоких дозах и заболеваемости канцерогенов, что было бы типично для исследований химиопрофилактики на грызунах, до более низких доз и заболеваемости, более репрезентативных для риска рака человека.Использование дизайна матрицы доза-доза позволяет оценить степень защиты от химиопрофилактики рака для любой из нескольких доз антиканцерогенов путем моделирования влияния каждой дозы на форму и положение всей кривой доза-ответ (Pratt et al. ., 2007). Как мы показали ранее, степень защиты при любой дозе химиопрофилактического агента не будет зависеть от дозы канцерогена в тех условиях, если таковые имеются, где кривые зависимости logit [частота] от log [канцерогена] доза-ответ с агентом и без него такая же форма, но со смещением по горизонтали (Dashwood et al ., 1989). Эти наборы данных также можно использовать для получения количественных оценок эффективности Chl для ингибирования образования опухоли при любой или всех дозах DBC. Для этого доза канцерогена, необходимая для получения ρ% заболеваемости опухолью, определяется как значение TDρ. Например, при ρ = 25% кривая ответа для каждой дозы Chl даст оценку TD 25 , которую можно использовать для расчета величины ингибирования опухоли для этой дозы Chl, используя следующее:% ингибирования = 100 ( 1- (TD 25Chlo / TD Chlx )), где Chlo относится к лечению без Chl, а Chlx относится к лечению в любой дозе X (Dashwood et al ., 1989). Когда кривые логит-ответ-логарифмическая доза являются линейными и параллельными, процент ингибирования, рассчитанный на основе любой заболеваемости опухолью в линейном диапазоне, будет эквивалентным, то есть степень ингибирования не зависит от дозы канцерогена. Это было бы тем обстоятельством, при котором существует больше оснований для экстраполяции данных ингибирования от высоких доз канцерогенов и ответов опухоли на воздействия и уровни рака, более актуальные для людей.

Ответ опухоли печени на различные дозы DBC был достаточным () для получения полного набора из пяти немоделированных кривых доза-ответ ().Используя данные до максимальной эффективной дозы включительно, кривые были успешно смоделированы с помощью логистической регрессии в виде серии линейных и параллельных кривых доза-реакция (общее несоответствие (11df) p> 0,45) с каждым увеличением. в Chl обеспечивает последовательные смещения в сторону более высоких значений TD (, вставка). Эти данные подтверждают вывод о том, что величина ингибирования опухоли печени увеличивается с дозой Chl и не зависит от дозы DBC для каждой из четырех исследованных доз Chl и для всех доз DBC до оптимальной.Напротив, включение точек данных за пределами оптимума (более 112 ppm DBC для [Chl] 2000 ppm и ниже; и выше 224 ppm DBC при 4000 ppm) приводит к отказу от модели параллельного смещения (). Это условие препятствует экстраполяции данных при наивысшей дозе DBC, чтобы предсказать что-либо о возможных химиопрофилактических эффектах Chl при более низком воздействии канцерогенов и заболеваемости раком, потенциально значимой для человека.

Поскольку DBC является мультиорганным канцерогеном для форели, мы смогли сравнить химиопрофилактическую эффективность Chl в желудке и печени.Однако есть некоторые ограничения из-за снижения чувствительности желудка к DBC и Chl (Bailey et al ., 2009). Как видно на фиг.3, реакция опухоли желудка на различные дозы DBC также давала пять кривых зависимости ответа от дозы. Если исследовать весь набор данных опухоли желудка среди всех доз DBC, он не соответствует регрессионной модели с линейными и параллельными линиями (p <0,013). Однако уже было известно, что диапазон доз DBC неотличим от фона во втором органе для двух самых низких доз DBC (Bailey et al ., 2009), так что эти точки данных DBC не будут использоваться при моделировании откликов параллельного смещения. Дополнительная проблема возникает из-за того, что эффективность ингибирования Хл в желудке меньше, чем в печени. Это означает, что конструкция, оптимизированная для печени, имеет меньшую чувствительность для демонстрации возрастающего ингибирования с увеличением дозы Хл в этом органе. В частности, наблюдается значительное совпадение наблюдаемой заболеваемости опухолями между кривыми 500–2000 ppm Chl (). Это происходит как естественное следствие уменьшенного ингибирования Хл в желудке по сравнению с печенью, а также статистических ограничений обнаружения тонких различий в модуляторах, несмотря на использование более 9000 животных для оценки ответа опухоли.Эти ограничения были устранены путем моделирования упрощенной матрицы набора данных для доз DBC выше фона (56, 112, 224 ppm), сопоставленных с 0, 2000 и 4000 ppm Chl. Для этого подмножества данных кривые доза-реакция успешно соответствуют регрессионной модели с линейными и параллельными линиями достаточно хорошо, отсутствие соответствия, p = 0,66 (, вставка).

После того, как данные были успешно сопоставлены с моделями с параллельным смещением, можно было определить% ингибирования, как указано выше. Для печени это вычисление дает мощности доза-ответ для% ингибирования Chl (± S.E.) 29 (± 7), 36 (± 7), 46 (± 8) и 63 (± 7)% при дозах Хл 500, 1000, 2000 и 4000 ppm соответственно (см.). Для желудка ингибирование% Chl составляет 24 (± 9)% для 2000 ppm Chl и 45 (± 7)% для 4000 ppm Chl (). Следовательно, DBC проявляет меньшую активность в отношении инициации опухоли в желудке, чем в печени, а диетический Chl менее эффективен в качестве блокирующего агента против DBC в этом органе. Взятые вместе, эти результаты подтверждают идею о том, что концентрации Chl, обычно встречающиеся в богатых Chl зеленых овощах, таких как шпинат, могут обеспечить существенную химиопротекцию рака против таких многоорганных генотоксинов, как DBC.Они также ясно показывают, что дизайн матрицы дозы, оптимизированный для одного органа (печени), может не дать оптимальных результатов для другого органа.

Процент ингибирования конечной заболеваемости опухолью в печени (панель A) и желудке (панель B) при различных концентрациях пищевого Chl. Процент ингибирования рассчитывали для каждой дозы Хл на основе изменения значения DBC TD 25 (см. Текст). Значения ингибирования опухоли печени определяли, как описано в разделе результатов. Рацион содержал 14, 28, 56, 112, 224 или 448 ppm DBC и 500, 1000, 2000 или 4000 ppm Chl.Планки погрешностей представляют собой 95% доверительные интервалы.

3,4 Влияние Хл на кажущуюся множественность опухоли печени

Из-за масштабов исследования мы не смогли провести исчерпывающую патологию на каждом поражении в печени, несущем несколько грубо наблюдаемых поражений. Однако было возможно изучить данные о макроскопических поражениях на предмет возможных эффектов доз DBC и Chl на «кажущуюся множественность опухолей». Подобно данным о заболеваемости опухолями, кажущаяся множественность опухолей печени показала максимальный ответ, который имел место около 56 ppm DBC для этой конечной точки ().Увеличение доз совместного лечения с Хл сдвигало кривую доза-ответ вправо в сторону более высоких доз DBC. Однако доза-ответ для множественности опухоли не является простой линейной или монотонной функцией дозы DBC, и, как следствие, эффекты вмешательства Chl в значительной степени зависят от дозы DBC. При трех наименьших испытанных дозах DBC (14, 28, 56 ppm) концентрации Chl 500–4000 ppm снижали наблюдаемую видимую множественность опухоли по сравнению с одним DBC, что значительно выше при 56 ppm DBC (p <0.02). Однако эффекты добавок Chl при дозах DBC, превышающих оптимальную, равную 56 ppm, дали совершенно разные результаты. Например, добавление 500, 1000 или 2000 ppm Chl не привело к снижению кажущейся множественности, но вместо этого значительно увеличило ее по сравнению с 112 ppm DBC (p = 0,059, 0,014, 0,008, соответственно; попарный точный тест Вилкоксина). Это открытие резюмирует и подкрепляет наши предыдущие наблюдения с совместным лечением CHL, которые продемонстрировали ту же картину, что и Chl, по уменьшению видимой множественности опухоли печени при низких дозах DBC, но усиливая ее при более высоких дозах DBC (Pratt et al ., 2007).

Воздействие Chl на видимую множественность опухолей в печени. Форель исследовали на предмет образования опухолей через 9 месяцев после прекращения воздействия DBC. Видимая множественность опухоли используется для обозначения включения некоторых грубых, а также гистологически подтвержденных поражений среди людей с более чем одним поражением. Планки погрешностей представляют собой стандартное отклонение.

3.5 Относительная химиопрофилактическая эффективность препаратов CHL и Chl

Все виды хлорофилла при тестировании в концентрации 2000 ppm значительно снижали заболеваемость опухолями печени ().Хорошо зарекомендовавший себя положительный контроль для химиопрофилактики, 2000 ppm CHL, показал существенное и значительное снижение с 57% заболеваемости только DBC до 12% (p <0,0001). Chl, очищенный с помощью CCC, давал аналогичный ответ, от 57% до 14% (p <0,05). Экстракт Chl, использованный в части исследования, посвященной матрице дозы и дозы, снизил заболеваемость опухолями печени с 57% до 31% (p <0,005). Экстракт Chl, очищенный CCC Chl и CHL также показали значительное снижение частоты возникновения опухоли желудка, инициированной DBC (p = 0.002; p <0,0001, p <0,0001 соответственно). Основываясь на этих результатах, экстракт Chl, содержащий 2000 ppm Chl, оказался менее эффективным, чем 2000 ppm очищенного Chl (p <0,0001) или 2000 ppm CHL (p <0,0001) в снижении частоты опухолей. Основа пониженной эффективности Хл в экстракте в настоящее время неизвестна, но может отражать некоторую степень секвестрации Хл другими компонентами экстракта. В любом случае дополнительной защиты легко добиться, просто увеличив дозу экстракта Chl в рационе (,;).

Уменьшение DBC-индуцированных опухолей печени препаратами Chl. Рацион содержал 112 частей на миллион DBC и 2000 частей на миллион Chl или CHL. Форель исследовали на предмет образования опухолей через 9 месяцев после прекращения воздействия DBC. Заболеваемость опухолью была представлена ​​как наблюдаемое среднее значение (± стандартная ошибка).

3,6 Ингибирование аддуктов DBC-ДНК с помощью Chl

Профили аддуктов DBC-ДНК, выделенных из печени форели, были практически идентичны тем, о которых сообщалось в наших более ранних исследованиях с использованием того же протокола пост-метки 33 P (Harttig and Bailey, 1998; Пратт и др. ., 2007). Профиль аддуктов DBC-ДНК печени () имеет полярные пики аддукта, элюируемые через 10–20 мин, и менее полярные пики, элюируемые через 35–65 минут. Добавление 2000 ppm Chl не изменило профиль аддукта DBC, но действительно изменило величину отклика, означающую снижение общего количества аддукта (). С помощью ВЭЖХ общая концентрация основных аддуктов DBC-ДНК при 112 м.д. DBC была определена как 26 ± 2 пмоль аддуктов / мг ДНК; добавление 2000 ppm Chl в том же самом [DBC] снижало уровни аддуктов DBC-ДНК до 12 ± 1 ppm аддуктов / мг ДНК.Это более чем 50% -ное снижение аддуктов DBC-ДНК за счет воздействия природного Chl в концентрации 2000 ppm, и сравнимо с приблизительным сокращением вдвое конечной заболеваемости опухолью при таком лечении.

Хроматограммы in vivo аддуктов DBC-ДНК радужной форели после пост-мечения 33 P и анализа ВЭЖХ. Профили аддуктов в печени были получены путем 2-недельного воздействия либо 112 ppm DBC (A), либо 112 ppm DBC и 2000 ppm Chl (B). Обратите внимание на тот же профиль с Chl и без него. Уменьшение показано разницей в масштабах по оси ординат.

3.7 Регулирование генов хлорофиллами

Предыдущие исследования (Fahey et al ., 2005) показали, что хлорофиллы могут модулировать паттерны экспрессии генов в культивируемых клетках в направлении, благоприятствующем путям детоксикации канцерогенов. Поскольку это может представлять собой важный механизм химиопротекции, мы провели предварительное исследование влияния пищевых хлорофиллов и DBC на экспрессию генов печени у всего животного. Воздействие 224 ppm диетического DBC приводило к двукратному или большему усилению регуляции 25 аннотированных генов в 11 функциональных категориях в печени форели по сравнению с контролями, не получавшими лечения ().Меньшее количество генов активировалось (13) в печени животных, получавших 80 ppm DBC (данные не показаны), что указывает на то, что изменения экспрессии, вызванные DBC, являются дозозависимыми. Совместное введение 2000 м.д. Chl по существу устраняет индуцированную DBC повышающую экспрессию гена. Не менее важно, что сам по себе Chl практически не оказывает индуктивного действия на транскрипцию, поскольку только один ген из 4000 элементов в этой библиотеке Oncorhynchus продемонстрировал свидетельства повышения регуляции. Общее влияние DBC на понижающее регулирование было менее значительным, но следовало той же тенденции.Как показано на фиг.3, обработка 224 ppm DBC вызывает двукратное или большее подавление активности четырех аннотированных генов форели в четырех функциональных категориях. Опять же, эти эффекты были отменены совместной обработкой 2000 ppm Chl, тогда как Chl сам по себе не оказывал подавляющего действия на транскрипцию. Мы интерпретируем эти результаты как указание на то, что механизм химиопрофилактики Chl согласуется с Chl-опосредованным снижением биодоступности канцерогенов и доступа к органам-мишеням, и не отражает глобальные изменения экспрессии генов печени с помощью Chl.

Таблица III

Гены, активируемые воздействием DBC с пищей по сравнению с химиотерапией

1", "term_text": "BE859102"}} BE859102
Среднее кратное изменение экспрессии генаa a
Ген Аннотация (присоединение к DFCI / присоединение к GenBank) DBC б DBC + Chl c Chl д
Внеклеточная реакция окружающей среды
ARNT TC142567 / {"тип": "энтрез-нуклеотид", "attrs": {"текст": "U73841.1 "," term_id ":" 1695922 "," term_text ":" U73841.1 "}} U73841.1 1,76 - -
Фактор роста
EGFR {"type": "entrez-nucleotide", "attrs": {"text": "FM865854", "term_id": "211970682", "term_text": "FM865854"}} FM865854 1,43 - -
Иммунный ответ
IFITM3 TC146120 / {"type": "entrez-нуклеотид", "attrs": {"text": "AJ320157", "term_id": "20160303", "term_text": "AJ320157"}} AJ320157 1.29 - -
PSME1 {"type": "entrez-nucleotide", "attrs": {"text": "BT074326", "term_id": "225705807", "term_text": "BT074326"}} BT074326 1.00 - -
PSME2 {"type": "entrez-нуклеотид", "attrs": {"text": "BT074299", "term_id": "225705753", "term_text": "BT074299"}} BT074299 1.00 - -
cf H TC162759 / {"type": "entrez-nucleotide", "attrs": {" text ":" AJ627206 "," term_id ":" 869 "," term_text ":" AJ627206 "}} AJ627206 1.12 - -
CD63 TC137037 / {"type": "entrez-нуклеотид", "attrs": {"text": "AY593998", "term_id": "51038280", "term_text ":" AY593998 "}} AY593998 1.00 - -
MHC I TC132378 / {" type ":" entrez-nucleotide "," attrs ": {" text ":" AB012064 " , "term_id": "5688869", "term_text": "AB012064"}} AB012064 1,24 - -
HAMP TC164847 / {"type": "entrez-nucleotide", "attrs ": {" текст ":" AF281354 "," term_id ":" 11095800 "," term_text ":" AF281354 "}} AF281354 1.02
Клеточная пролиферация / апоптоз
P53 TC132531 / {"type": "entrez-нуклеотид", "attrs": {"text": "NM_001124692", "term_id": "185135597", "term_text": "NM_001124692"}} NM_001124692 2,28 - -
PCNA {"type": "entrez-нуклеотид", "attrs": {"text": "NM_131404", "term_id": "563580272", " term_text ":" NM_131404 "}} NM_131404 1.43 - -
MAPK8 {" type ":" entrez-nucleotide "," attrs ": {" text ":" CX028516 "," term_id ":" 56972869 "," term_text ":" CX028516 "}} CX028516 1.34 - -
Метаболизм
CYP1A1 TC158463 / {"type": "entrez-нуклеотид", "attrs": {"text": "U62796", "term_id": "1778054", "term_text": "U62796"}} U62796 2,79 - -
SULT1A2 TC135750 / {"type": "entrez-нуклеотид", "attrs": {"text": "BX867991", "term_id": "598" , "term_text": "BX867991"}} BX867991 1.02 - -
GAPD TC137453 / {"type": "entrez-nucleotide", "attrs": {"text": " NM_001124246 "," term_id ":" 185132745 "," term_text ":" NM_001124246 "}} NM_001124246 1.00 - -
DLAT TC132429 / {"type": "entrez-нуклеотид", "attrs": {"text": "J04051", "term_id": "213775", "term_text ":" J04051 "}} J04051 {" type ":" entrez-нуклеотид "," attrs ": {" text ":" M29099 "," term_id ":" 213775 "}} M29099 1.16 - -
SOD1 NP543739 / {"type": "entrez-нуклеотид", "attrs": {"text": "AF469663", "term_id": "18766890", "term_text": "AF469663"} } AF469663 1,39 - -
Транспортные белки
FXYD TC165305 / {"type": "entrez-нуклеотид", "attrs": {"text": "BT074290", "term_id": "225705735", "term_text": "BT074290"}} BT074290 1.81 - -
Коэффициенты удлинения
EF-1 alpha TC166688 / {"type": "entrez-nucleotide", "attrs": {"text": "AF498320", "term_id": "20269865", "term_text": "AF498320 "}} AF498320 1,31 - -
Внеклеточный матрикс
Лектин C-типа {"type": "entrez-нуклеотид", "attrs": {"text": "NM_001160495", "term_id": "238231566", "term_text": "NM_001160495"} } NM_001160495 1.00
MMP9 TC132759 / {"type": "entrez-нуклеотид", "attrs": {"text": "AJ320533", "term_id": "20160305", "term_text": "AJ320533"} } AJ320533 1,12 - -
Поддержание костей и хрящей
Катепсин K TC8255 / {"type": "entrez-нуклеотид", "attrs": {"text": "U61499", "term_id": "1698588", "term_text": "U61499"} } U61499 1,45 - -
Функция у форели неизвестна
Катепсин S TC8256 / {"type": "entrez-нуклеотид", "attrs": {"text": "AY622858", "term_id": "54300681", "term_text": "AY622858"} } AY622858 1.17 - -
Общая сигнализация клеток
RhoG TC169097 / {"type": "entrez-нуклеотид", "attrs": {"text": "BE859102", "term_id": "13 1.03 - -

Таблица IV

Гены, подавляемые диетическим воздействием DBC по сравнению с химиотерапией

a
9011 9011 9011 Среднее 9011 9011 изменение экспрессии гена
Ген Аннотация (присоединение к DFCI / присоединение к GenBank) DBC б DBC + Chl c Chl д
Фактор роста
FGF6 NP544420 / {"type": "entrez-нуклеотид", "attrs": {"text": "Y16850", "term_id": "3980189", "term_text": "Y16850"}} Y16850 -1.00 - -
Иммунный ответ
IGF1 NP544251 / {"type": "entrez-нуклеотид", "attrs": {"text": "M95183", "term_id": "213435", "term_text": "M95183"}} M95183 −1,25 - -
LECT2 TC154068 / {"type": "entrez-nucleotide", "attrs": {"text": "AF363272", "term_id": "20385164 "," term_text ":" AF363272 "}} AF363272 -1,15 -
Метаболизм
Vtg1 TC132491 / {"type": "entrez-нуклеотид", "attrs": {"text": "X", "term_id": "1296952", "term_text": "X"}} Х -1.20 - -
Внеклеточный матрикс
MMP TC147381 / {"type": "entrez-нуклеотид", "attrs": {"text": "AB043536", "term_id": "11761265", "term_text": "AB043536"}} AB043536 −1,26 - -

4 Обсуждение

4.1 Химиопрофилактика рака с помощью пищевых хлорофиллов

В настоящем исследовании химиопрофилактики использовалась матрица доза-доза на 12000 животных для оценки дозозависимых эффектов совместное лечение Хл с пищей в широком диапазоне воздействий DBC ().Совместное воздействие с Chl-обогащенным экстрактом шпината, как было показано, обеспечивает дозозависимое снижение конечной заболеваемости опухолями желудка при всех дозах DBC и печени при всех дозах DBC, кроме самой высокой (). Химиопрофилактическая эффективность Хл по сравнению с более низким воздействием DBC оценивалась путем успешного моделирования наборов данных в виде серии параллельных кривых доза-ответ, смещенных в сторону более высокого TD 25 с увеличением [Chl] (, вставка панелей). Согласно этому анализу, потребление 500–4000 частей на миллион Хл снижает заболеваемость опухолями печени до DBC с 29–64% и ответ опухоли желудка с 24–45% ().Эти результаты аналогичны нашему предыдущему исследованию доза-матрица с производным CHL, которое подавляло заболеваемость опухолью печени на 62–82% и заболеваемость опухолью желудка на 30–68% с использованием большего диапазона доз CHL, 1500–6000 ppm (Pratt и др., , 2007). Хотя прямые сравнения затруднены, эти два исследования показывают, что синтетический ХЛ и частично очищенный природный Хл обладают по крайней мере сопоставимой молярной химиопрофилактической эффективностью в этой модели. Более прямое сравнение химиопрофилактической эффективности различных препаратов хлорофилла представлено в.По этому результату, CHL и очищенный CCC Chl были сравнимы по снижению опухолевого ответа в желудке и печени, тогда как экстракт Chl, использованный для большей части исследования матрицы дозировки, демонстрировал пониженную эффективность, требуя дополнительной концентрации в рационе для достижения сопоставимой химиопрофилактики.

4.2 Механизмы химиопрофилактики хлорофиллами

Предыдущие фармакокинетические эксперименты на крысах, фореле и людях-добровольцах предоставили достаточно доказательств того, что пероральное совместное лечение с CHL или очищенным Chl препятствует пероральной абсорбции таких канцерогенов, как DBC, AFB 1 , и некоторые гетероциклические амины, что снижает их системную биодоступность и возможность генетического повреждения.Как было показано в этом и предыдущих исследованиях, снижение биодоступности канцерогена сопровождается значительным сокращением повреждения ДНК органа-мишени канцерогеном и инициации опухоли. Альтернативные или дополнительные механизмы блокирования могут включать изменения в экспрессии и / или каталитической активности ферментов, метаболизирующих ксенобиотики, так что реакции детоксикации благоприятствуют. Действительно, в культуре клеток было показано, что различные хлорофиллы изменяют экспрессию генов, важных для метаболизма канцерогенов.Однако попытки продемонстрировать CHL- или Chl-опосредованные изменения в экспрессии таких генов у всего животного в соответствующих органах-мишенях в условиях химиопрофилактического воздействия до сих пор оказались отрицательными (Simonich et al. , 2007). Настоящий небольшой эксперимент с микрочипами обеспечивает дополнительную поддержку гипотезе о том, что химиопрофилактика Chl происходит просто за счет секвестрации канцерогена в желудочно-кишечном тракте для быстрого выведения из организма. Общий эффект с точки зрения транскрипции заключается в том, что и без того низкая биодоступность DBC дополнительно снижается при совместной обработке хлорофиллом, в то время как хлорофиллы сами по себе не могут изменить экспрессию ни одного из генов форели и семейств генов, доступных для анализа.Привлекательность механически простого механизма секвестрации канцерогенов для вмешательства человека очевидна. Дополнительные эффекты после инициации для Chl могут быть не менее важны для защиты человека. Недавно мы определили, что диета, содержащая 10% шпината, существенно подавляла развитие опухоли в нескольких органах-мишенях (тонкая кишка, толстая кишка, кожа, селезенка, печень, легкие) у крыс, когда эта диета применялась в течение 34 недель после лечения канцерогенами (Dashwood et al., неопубликованные результаты).Механизмы, связанные с этим подавлением опухоли, явно не имеют ничего общего с взаимодействиями Chl-канцероген, но в настоящее время отсутствуют данные, указывающие на то, что подавление может быть приписано самому Chl.

4.3 Ограничения для химиопрофилактики при высокой дозе канцерогена

Ранее пилотные исследования продемонстрировали способность очищенного природного Хл защищать от инициированного DBC онкогенеза печени и желудка у форели (Simonich et al. , 2008) и AFB 1 канцерогенность у крыс (Simonich et al., 2007). Однако в наших первоначальных исследованиях Хл, как и почти во всех других исследованиях химиопрофилактики, использовалась однократная высокая концентрация канцерогена, направленная на обеспечение высокой заболеваемости опухолями в положительном контроле. Это делается регулярно, чтобы максимизировать статистическую мощность для обнаружения значительного снижения конечных точек (биомаркеров, предраковых поражений и опухолей) на доступном количестве животных. Однако центральное предположение таких экспериментов заключается в том, что эффекты вмешательства при высокой дозе канцерогена и высокие конечные реакции будут одинаково применяться при более низких дозах канцерогенов и заболеваемости, более актуальной для воздействия на человека и уровней риска.Это предположение было проверено дважды с использованием моделей доза-доза для 10 000 и 12 000 животных с недорогой моделью радужной форели. В этих исследованиях использовались дифференцированные диетические дозы DBC, сопоставленные с дифференцированными диетическими дозами либо CHL (Pratt et al. , 2007), либо натурального обогащенного Chl экстракта шпината (настоящее исследование). Как и ожидалось, результаты показали, что эффективность Хл, а также ХЛ в обоих органах-мишенях зависела от дозы ингибитора. Однако, вопреки обычному предположению, результаты в основном органе-мишени сильно зависели от дозы канцерогена.При более низких дозах DBC совместная обработка градуированных CHL или Chl обеспечивала сильную защиту от начального образования аддуктов DBC-ДНК в печени, заболеваемости опухолями и множественности опухолей. Однако при высоких дозах DBC совместное лечение любым агентом не защищало от возникновения опухолей и фактически значительно увеличивало множественность опухолей. Мы подчеркиваем, что CHL не смог защитить от опухолевого ответа при высокой дозе DBC, несмотря на защиту от исходных биомаркеров аддукта DBC-ДНК во всем диапазоне доз DBC (Pratt et al., 2007). Это явление произошло из-за того, что частота и множественность дозозависимых ответов для DBC в этом органе-мишени не являются ни линейными, ни даже монотонными, а достигают оптимума при умеренной дозе и снижаются при более высокой дозе. Поскольку чистым эффектом лечения Chl было снижение эффективных воздействий DBC и, таким образом, сдвиг кривых доза-ответ на все более и более высокие уровни обработки DBC, совместные обработки Chl, которые были ингибирующими при более низких обработках DBC, становились неэффективными или усиливались при высоком воздействии DBC.Если бы этот конкретный эксперимент проводился с традиционной однократной высокой дозой DBC, можно было бы сделать вывод, что CHL является либо неэффективным (заболеваемость), либо ко-канцерогенным (множественность) и, следовательно, бесполезен для снижения риска рака человека при воздействии экологически значимого канцерогена. выдержки. Это было бы неудачным выводом и упущенной возможностью, поскольку недавние исследования на людях показывают очевидные перспективы защиты как от Chl, так и от CHL (Dashwood et al. , 1989; Hayashi et al., 1999; Jubert et al. , 2009), при воздействии афлатоксина в окружающей среде.

4.4. Выводы

Результаты настоящего исследования демонстрируют, что увеличение диетических доз Chl-обогащенного экстракта шпината обеспечивает усиление и мощную защиту от начального ответа опухоли, инициированного DBC, в двух органах-мишенях, что защита экстрактом была умеренно снижена по сравнению с эквивалентные дозы CHL или очищенного Chl, и эта защита происходила в отсутствие очевидных изменений в паттернах экспрессии генов.Мы также определили, что защитная эффективность совместного воздействия Хл с пищей сильно зависит от концентрации DBC в рационе, с хорошей защитой в обоих органах-мишенях при низкой дозе канцерогена и ответом опухоли, но очевидным усилением ответа опухоли печени при высоких дозах канцерогена. и опухолевые реакции, не встречающиеся в человеческих популяциях. Эти результаты подчеркивают необходимость в разработке исследований химиопрофилактики рака для выбора доз канцерогена в пределах известного линейного или монотонного диапазона доза-реакция.В отсутствие этой информации результаты, полученные при высоких дозах канцерогенов и высоких ответах опухоли, могут не иметь отношения к вмешательству человека.

Что такое хлорофилл? Этот растительный пигмент продемонстрировал основные преимущества

Возможно, вы слышали недавний шум о хлорофилле, и, хотя у вас есть смутные воспоминания о том, что он имеет какое-то отношение к зеленеющим растениям, не совсем ясно, что это за вещество. Что ж, читатели, вы попали в нужное место. Здесь мы разберем, что такое хлорофилл, как он может помочь вашему организму, и расскажем о лучших хлорофилловых продуктах из этой группы.Готовы узнать больше? Зеленый на ... кхм ... Readi on.

Что такое хлорофилл?

«Хлорофилл - это зеленый пигмент, который содержится в растениях», - поясняет диетолог Кайли Иванир, MS, RD. «Этот пигмент помогает растениям преобразовывать солнечный свет в энергию, которую они могут использовать», - продолжает она, добавляя, что его можно найти в зеленых овощах, особенно в зеленых листовых овощах, таких как шпинат, капуста, петрушка и кресс-салат.

В дополнение к его присутствию в зеленых фруктах, овощах, травах и спирулине, по словам Эшли Шоу, MS, RD, для Preg Appetit !, вы также можете купить его в виде добавок в виде хлорофиллина.«Употребление хлорофилла может повысить иммунитет, помочь в похудании, повысить энергию и даже защитить от рака», - отмечает Шоу. В этой связи давайте рассмотрим некоторые преимущества хлорофилла для здоровья, который, как шутит Шоу, далек от «борофилла».

Хлорофилл может снизить риск рака

Шоу сначала указывает на исследование 2018 года на мышах, которое показало, что у этих животных, потреблявших хлорофилл (в виде зеленых растений), наблюдалось снижение заболеваемости раком, особенно раком поджелудочной железы.«Хлорофилл фактически изменил статус раковых клеток в организме, замедляя прогрессирование рака и потенциально останавливая его распространение», - говорит она. В случае рака на ранней стадии хлорофилл может действовать как более мягкий тип химиотерапевтического препарата, добавляет она, ссылаясь на этот критический обзор. «Это потрясающая новость, учитывая, сколько продуктов естественно содержат хлорофилл и насколько легко их употреблять», - заключает она.

Доктор Райан Грин, DO, MS, для Preg Appetit! проливает дополнительный свет на сферу исследований хлорофилла и рака: «Хлорофилл также может способствовать снижению риска рака, особенно благодаря определенным пищевым токсинам (афлатоксин был оценен в академических исследованиях), связывая и уменьшая всасывание в нашу систему через кишечник», - говорит он со ссылкой на это исследование.«Это преимущество может быть полезным для снижения риска рака печени и толстой кишки, хотя данные еще недостаточно хорошо описаны».

Хлорофилл богат антиоксидантами, как и ваши любимые фрукты и овощи

«Было доказано, что хлорофилл обладает антиоксидантными свойствами», - говорит Иванир, указывая на это исследование, а также на второе здесь. «Это может помочь уменьшить окислительное повреждение за счет свободных радикалов, которые будут стремиться связываться с клетками нашего тела. Когда они связываются, они вызывают повреждение этих клеток, что в конечном итоге может привести к раку.

Ссылаясь на терапевтическую ценность хлорофилла, особенно для нашей иммунной системы, Триста К. Бест, магистр здравоохранения, доктор медицинских наук, из Balance One Supplements уточняет, что «антиоксиданты обладают побочным противовоспалительным действием, которое может улучшить иммунную функцию и реакцию организма».

Хлорофилл может увеличить количество красных кровяных телец в организме

Быстрое обновление науки: красные кровяные тельца содержат гемоглобин, который переносит кислород из ваших легких в остальную часть вашего тела, а затем возвращает углекислый газ из вашего тела обратно в легкие , так что вы можете выдохнуть.

Вот как наука обыгрывает ваш кровоток: «Хлорофилл имеет структуру, очень похожую на молекулы гемоглобина в нашей крови. Гемоглобин составляет большую часть ваших красных кровяных телец и отвечает за транспортировку кислорода по всему телу », - говорит Иванир, ссылаясь на этот обзор и это пилотное исследование. «Поскольку хлорофилл и гемоглобин имеют очень похожую структуру, хлорофилл обладает способностью увеличивать снабжение эритроцитов и способствовать переносу большего количества кислорода по [телу].»

Хлорофилл может помочь в похудании

« Вы можете задаться вопросом, почему сок сельдерея и другие зеленые соки всегда пользуются популярностью у любителей здоровья и хорошего самочувствия, и для этого есть веская причина. Эти напитки содержат хлорофилл, который обладает способностью воздействовать на гормоны голода, подавляя чувство голода и усиливая чувство сытости », - говорит Шоу со ссылкой на это исследование. «Следовательно, это приводит к тому, что человек потребляет меньше калорий в целом и худеет. Конечно, потеря веса не всегда является целью, но эти напитки также богаты антиоксидантами, витаминами и минералами, которые улучшают общее состояние здоровья.”

Хлорофилл может улучшить цвет лица

Быстрый поиск в Google по запросу« средства по уходу за кожей с хлорофиллом »дает много-много результатов, и эти косметические лакомства могут очень хорошо улучшить внешний вид вашей кожи. «Многие энтузиасты и исследователи хлорофилла утверждают, что хлорофилл полезен для здоровья кожи из-за антивозрастных свойств антиоксидантов, а также для здоровья красных кровяных телец, здоровья клеток и потери веса», - объясняет Бест.

6 продуктов с хлорофиллом, которые мы любим

Конечно, получение питательных веществ из настоящих цельных продуктов - всегда отличный вариант.Но если вы ищете другие отличные способы пополнить запасы хлорофилла, вот наши советы. Как всегда, проконсультируйтесь со своим врачом или диетологом, прежде чем добавлять какие-либо новые добавки в свой распорядок дня.

1. Водные капли Sakara Detox, (39 долларов США)

Считается, что эти водные капли с хлорофиллом помогают пищеварению, здоровью кишечника, иммунитету и функции печени. Все, что вам нужно сделать, это добавить в чашку h3O и выпить.

2. YourSuper.com Super Green Mix, (34,90 $)

Не любите есть овощи? Повысьте потребление богатой питательными веществами зелени с помощью этого универсального порошка, содержащего богатые хлорофиллом ростки пшеницы, а также ячмень, баобаб, морингу, спирулину и хлореллу, которые, как говорят, содержат больше хлорофилла, чем любое другое растение, известное человечеству.Всего одна ложка смузи или овсяных хлопьев на ночь эквивалентна горсти зелени.

3. Лапша Sun Chlorella Udon, 7,99 долларов США

Помимо того, что эта лапша богата хлорофиллом (порция равна примерно двум-двум с половиной чашкам шпината или капусты на порцию), хлорелла содержит витамин С, бета-каротин, ликопин и другие полезные антиоксиданты. Easy Vegan Pad Thai на ужин с лапшой Sun Chlorella Udon, кто-нибудь?

4. Добавка с хлорофиллином для продления жизни, 18 долларов

Эти вегетарианские капсулы без ГМО - хороший вариант, если вы предпочитаете принимать добавку, вместо того, чтобы не забывать добавлять порошок в свой смузи AM или взбивать порцию хлорофилла. лапша с начинкой.Стоит отметить: рекомендованной суточной нормы хлорофилла не существует, поэтому, опять же, перед началом проконсультируйтесь с проверенным специалистом в области здравоохранения.

5. Hum Daily Cleanse, $ 26

Еще один надежный вариант, если вы хотите пойти по пути пищевых добавок, эти веганские капсулы предназначены для улучшения чистоты кожи, улучшения пищеварения и детоксикации. Внутри вы найдете хлореллу, спирулину, свеклу, красный клевер, экстракт листьев одуванчика, корень орегонского винограда, расторопшу и другие травы и ингредиенты, предназначенные для укрепления вашего здоровья.

6. Вода с хлорофиллом, 44,99 доллара за ящик 12

Создатели этой воды добавили несколько мощных антиоксидантов, чтобы вы могли получить все необходимые витамины одним глотком. Каждая бутылка содержит хлорофилл, мяту и лимон (чтобы было вкуснее) с витамином A, витамином B12, витамином C и витамином D. Мы были готовы сделать заказ), и они предлагают скидку, если вы подпишетесь на их электронные письма) . «Прямо сейчас мне нравится вода с хлорофиллом, потому что это удобный способ взять и уйти, и мне нравится, что она имеет дополнительные преимущества для здоровья в виде очищенной воды и витаминов», - говорит Холли Перкинс, эксперт по фитнесу
и автор книги Lift to Get Lean, и основатель организации Women's Strength Nation.Купите Erehwon Market, Alo, Inscape или их веб-сайт.

Опосредованные хлорофиллом изменения окислительно-восстановительного статуса раковых клеток поджелудочной железы связаны с его противораковыми эффектами

Факторы питания, которые проявляют антиоксидантные свойства, такие как содержащиеся в зеленых растениях, могут защищать от рака. Хлорофилл и другие тетрапиррольные соединения, которые структурно связаны с гемом и билирубином (желчный пигмент с антиоксидантной активностью), входят в число тех молекул, которые предположительно ответственны за эти эффекты.Таким образом, целью нашего исследования было оценить как антипролиферативный, так и антиоксидантный эффекты хлорофиллов (хлорофилл a / b , хлорофиллин и феофитин a ) при экспериментальном раке поджелудочной железы. Было показано, что хлорофиллы оказывают антипролиферативное действие в клеточных линиях рака поджелудочной железы (PaTu-8902, MiaPaCa-2 и BxPC-3) в зависимости от дозы (10–125 мк моль / л). Также было обнаружено, что хлорофиллы ингибируют экспрессию мРНК гемоксигеназы (HMOX) и ферментативную активность HMOX, существенно влияя на окислительно-восстановительную среду клеток рака поджелудочной железы, включая производство митохондриальных / общеклеточных активных форм кислорода, и изменяют соотношение восстановленных и восстановленных форм кислорода. -окисленный глутатион.Важно отметить, что опосредованное хлорофиллом подавление жизнеспособности клеток рака поджелудочной железы было воспроизведено в экспериментах in vivo , где введение хлорофилла a привело к значительному уменьшению размера опухоли поджелудочной железы у ксенотрансплантированных голых мышей. В заключение, эти данные предполагают, что опосредованные хлорофиллом изменения окислительно-восстановительного статуса раковых клеток поджелудочной железы могут быть ответственны за их антипролиферативные и противораковые эффекты и, таким образом, способствовать снижению заболеваемости раком среди людей, потребляющих зеленые овощи.

1. Введение

Биоактивные факторы питания, такие как те, что содержатся в зеленых растениях, могут участвовать в защите людей от развития рака [1]. Фактически, заметный эффект защиты от рака наблюдается при увеличении диетического потребления зеленых овощей [2]. Хлорофилл и другие тетрапиррольные соединения, которые структурно родственны билирубину (мощный антиоксидантный желчный пигмент) [3], являются одними из важных молекул-кандидатов, которые считаются ответственными за этот защитный эффект [1, 4].Хлорофилл, фитолэтерифицированный порфирин магния, является одной из самых распространенных биомолекул на Земле [5]. В природе встречается несколько видов хлорофилла, наиболее важными из которых являются хлорофилл a и хлорофилл b [4, 6]. Кроме того, хлорофиллин, более полярный полусинтетический хлорофилл, используется в качестве добавки в пищевой промышленности и, таким образом, довольно широко используется в некоторых частях пищевой цепи человека [4]. Эта характеристика также верна для феофитина a , производного пищевого метаболита хлорофилла, не содержащего металлов, который широко используется как в свежих, так и в обработанных пищевых продуктах, а также в пищевых добавках [4] (рис. 1).


Из-за множества биологических эффектов, включая антигенотоксичность [7], улавливание мутагена [8], иммуномодуляцию, а также антиоксидантную и апоптотическую активность (см. Обзор [4]), хлорофиллы были предложены в качестве важных пищевых химиопрофилактических агентов [ 4] . Хлорофиллы прочно связываются с широким спектром канцерогенов в просвете кишечника, что препятствует их всасыванию в организме [1]. Этот механизм наблюдался в клиническом исследовании, проведенном в Китае, в котором добавка хлорофиллина существенно снизила доступность афлатоксина у подвергшихся воздействию субъектов [9].Аналогичным образом, в клиническом исследовании, проведенном в Нидерландах, у пациентов, у которых было снижено потребление хлорофилла с пищей, наблюдалось увеличение заболеваемости раком толстой кишки [10]. В последнем исследовании авторы предположили, что хлорофилл играет важную роль в блокировании потенциальных канцерогенных эффектов гема в просвете кишечника [11]. Хотя обычно предполагается, что хлорофиллы не абсорбируются из просвета кишечника, не исключено, что значительная часть хлорофиллов, а также их производных могут быть биодоступными и, следовательно, активными даже в периферических тканях [4].

Гемоксигеназа 1 (HMOX1) и биливердинредуктаза (BLVRA) являются ключевыми ферментами катаболизма гема и образования билирубина, системные концентрации которых имеют прямое и отрицательное отношение к распространенности рака [12]. HMOX1 является важным цитопротекторным и антиоксидантным ферментом не только в организме человека [13], но и в царстве растений [14], хотя его потенциальная роль в канцерогенезе еще не выяснена [15]. Многочисленные эпидемиологические исследования показали, что увеличение экспрессии HMOX1 связано со снижением заболеваемости раком [16].С другой стороны, было обнаружено, что экспрессия HMOX1 препятствует противораковому лечению рака поджелудочной железы [17]. Кроме того, было высказано предположение, что BLVRA играет роль в стимулировании канцерогенеза [18]. Фактически, повышенная экспрессия BLVRA наблюдалась у пациентов с гепатоцеллюлярным раком [19] и в клеточных линиях рака груди и легких [20].

Поскольку существует очень мало опубликованных данных, описывающих антипролиферативные эффекты хлорофиллов, целью нашего исследования было оценить эти эффекты и определить, могут ли они опосредоваться посредством модуляции HMOX1 и / или путей передачи сигналов окислительно-восстановительного потенциала.

2. Материалы и методы
2.1. Chemicals

Spirulina (Arthrospira) platensis была приобретена у Martin Bauer GmbH (Вестенбергсгройт, Германия). Гемин был получен от Frontier Scientific (Логан, Юта, США), а хлорофиллин, хлорофилл a , хлорофилл b , кристаллический фиолетовый, тиазолиловый синий тетразолий бромид (MTT), диметилсульфоксид (DMSO), среды для культивирования клеток и добавки были приобретен у Sigma-Aldrich (Сент-Луис, Миссури, США).Ацетон, метанол, диоксан, ацетонитрил и глутаральдегид (25% раствор), используемые во всех экспериментах, были получены от Penta (Прага, Чехия). Метанол и ацетонитрил были получены от Merck (Дармштадт, Германия).

2.2. Получение феофитина
и

. Для получения феофитина а собирали культуру цианобактерии Synechocystis PCC 6803 (ATCC, Манассас, Вирджиния, США) (4 л). Клетки разбивали стеклянными шариками в 20 мМ K-фосфатном буфере (pH 7.8). Мембранную фракцию клеток отделяли от растворимых белков высокоскоростным центрифугированием (65000 × g, 20 мин). Гранулированные мембраны лиофилизировали в течение ночи. Пигменты экстрагировали из высушенных мембран 2 × 2,5 мл метанола и разделяли с помощью системы ВЭЖХ Agilent-1200 (Agilent, Санта-Клара, Калифорния, США).

Разделение проводили на обращенно-фазовой колонке (Luna C8, 5 мкм, м, 250 × 10 мм; Phenomenex) с использованием 35% метанола и 15% ацетонитрила в растворе 0.25 M пиридин (растворитель A) и 20% метанол и 20% ацетон в ацетонитриле (растворитель B). Пигменты элюировали линейным градиентом растворителя B (30–95% за 25 мин), затем 95% растворителя B при скорости потока 2 мл мин –1 при 40 ° C. Собирали пик, представляющий собой хлорофилл a , и полученный раствор (8 мл) подкисляли (pH ~ 3) уксусной кислотой для превращения хлорофилла a в феофитин a . Для удаления пиридина и других полярных примесей раствор смешивали в соотношении 1: 1 с 0.25 M NaCl с последующим добавлением 10 мл гексана. После перемешивания раствор инкубировали в течение 15 мин при комнатной температуре и отбирали верхнюю гексановую фазу, содержащую феофитин a . Гексан упаривали на роторном испарителе, а затем высушенный феофитин растворяли в ДМСО.

Чистота всех пигментов (гемина, хлорофиллина, хлорофилла a , хлорофилла b и феофитина a ), использованных в этом исследовании, была проверена хроматографически с помощью ВЭЖХ.

2.3. Культуры клеток

Для исследований in vitro использовали следующие клеточные линии аденокарциномы поджелудочной железы человека: PaTu-8902 (DSMZ, Брауншвейг, Германия), MiaPaCa-2 и BxPC-3 (ATCC). Все клеточные линии поддерживали в увлажненной атмосфере (5% CO 2 при 37 ° C) в среде DMEM, содержащей 10% фетальной бычьей сыворотки (PaTu-8902, MiaPaCa-2) или RPMI (BxPC-3). Клеточные линии были аутентифицированы в ATCC с помощью STR-профилирования перед распространением, а также повторно аутентифицированы в конце исследования внешней лабораторией (Generi Biotech, Градец Кралове, Чешская Республика).

2.4. Анализы жизнеспособности клеток

Жизнеспособность каждой линии опухолевых клеток определяли с помощью анализа МТТ. После 24 ч инкубации клеточных линий с тестируемыми соединениями культуральную среду заменяли свежей средой, содержащей МТТ (1 мг / мл). После дополнительных 2 ч инкубации полученный комплекс формазана растворяли в ДМСО. Затем измеряли оптическую плотность при 540 нм с использованием ридера Sunrise ELISA и данные оценивали с помощью программы Magelan-6 (Tecan, Австрия).

2.5. Определение активности гемоксигеназы

PaTu-8902 клетки рака поджелудочной железы человека инкубировали в течение 24 часов с экспериментальными соединениями. После инкубации клетки промывали фосфатно-солевым буфером (PBS, 0,1 M, pH 7,4), собирали, центрифугировали и ресуспендировали в PBS. Суспензию клеток, хранящуюся на льду, разрушали обработкой ультразвуком и инкубировали в течение 15 мин при 37 ° C с метгемальбумином (50 мкл М) и НАДФН (1,5 мМ). Активность HMOX определяли путем измерения образования окиси углерода с помощью газовой хроматографии, как описано ранее [21].Клетки, обработанные гемином, использовали в качестве положительного контроля для индукции активности HMOX.

2.6. Выделение РНК и ПЦР в реальном времени

После четырех часов инкубации с экспериментальными соединениями мРНК из клеток рака поджелудочной железы человека PaTu-8902 выделяли с использованием набора PerfectPure RNA Cell Kit (5Prime, Гамбург, Германия) в соответствии с инструкциями производителя. Затем выделенную мРНК растворяли в воде, свободной от нуклеаз, и ее качество и концентрацию измеряли на спектрофотометре Nanodrop 2000 (Thermo Fisher Scientific, Франклин, Массачусетс, США).Обратную транскрипцию мРНК в кДНК проводили с использованием набора кДНК высокой емкости (5Prime, Гамбург, Германия). Последовательности праймеров HMOX1 , BLVRA и HPRT (таблица 1) использовали, как описано ранее [22].

90_348 BLVRA HPRT

Гены Регистрационный номер GenBank Прямой праймер Обратный праймер Фрагмент (п.н.)
02000 2 GGGTGATAGAAGAGGCCAAGA AGCTCCTGCAACTCCTCAAA 67
NM_000712.3 TCCCTCTTTGGGGAGCTTTC GGACCCAGACTTGAAATGGAAG 180
NM_000194.2 CACTGGCAAAACAATGCAGAC GGGTCCTTTTCACCAGCAAG 92

HMOX1: гемоксигеназа 1; BLVRA: биливердинредуктаза; HPRT: гипоксантинфосфорибозилтрансфераза 1. HPRT использовали в качестве гена домашнего хозяйства. Два референсных гена ( HPRT и GAPD ) были выбраны как наиболее стабильные среди 4 константных генов ( HPRT , GAPD , 18S RNA и UBC ) на основании анализа лейкоцитов периферической крови и ДНК 10 здоровых людей в контрольной группе с использованием geNORM 3.5 (https://genorm.cmgg.be/, по состоянию на 15 декабря 2009 г.). На основании аналогичных уровней экспрессии, что и в генах-мишенях, HPRT был выбран в качестве более подходящего контрольного гена по сравнению с GAPD .

Для определения относительного уровня экспрессии HMOX1 и BLVRA измеряли уровень экспрессии HPRT , действуя в качестве внутреннего контроля. Были отобраны два референсных гена ( HPRT и GAPD ), которые наблюдались как наиболее стабильные среди четырех константных генов ( HPRT , GAPD , 18S RNA и UBC ) на основании анализа ДНК в лейкоцитах периферической крови от 10 здоровых людей в контрольной группе с использованием geNORM 3.5 (https://genorm.cmgg.be/ (по состоянию на 27 мая 2018 г.)). На основании аналогичных уровней экспрессии, что и в генах-мишенях, HPRT был выбран в качестве более подходящего контрольного гена. Относительное изменение было рассчитано как 2 -ΔΔCT . кПЦР выполняли в реакционном объеме 20 мкл л, содержащем 4 мкл мкл матрицы кДНК, которая была разбавлена ​​в 5 раз из завершенной реакции обратной транскрипции (ОТ), 1x SYBR Green Master Mix (Applied Biosystems, Foster City, CA , США) и 200 нМ прямого и обратного праймеров.Все RT-PCR проводили в 96-луночных оптических планшетах и ​​запускали в трех экземплярах на системе определения последовательности ABI PRISM 7500 (Applied Biosystems). Условия цикла включали активацию полимеразы при 95 ° C в течение 10 мин, затем 40 циклов при 95 ° C в течение 15 с и 60 ° C в течение 60 с [22].

2.7. Определение продукции митохондриального супероксида

Производство супероксид-аниона в митохондриальном матриксе рассчитывали как зависящее от времени увеличение интенсивности флуоресценции селективного красителя MitoSOX (Life Technologies, Плезантон, Калифорния, США) в клетках, которые были инкубированы с потенциальные терапевтические средства.Окончательное определение проводили методом проточной цитометрии (BD LSRII, BD Biosciences, Сан-Хосе, Калифорния, США). После 24 часов инкубации с интересующими терапевтическими средствами к клеткам добавляли MitoSOX на 15 минут. Перед каждым измерением клетки обрабатывали 10 мк М ротеноном для увеличения продукции митохондриального супероксида. Изменение флуоресценции измеряли с интервалом в одну минуту в течение 16 минут.

2,8. Определение отношения GSH / GSSG

Образцы клеток PaTu-8902 собирали, осаждали и промывали PBS.После центрифугирования клеточной суспензии (200 × g, 5 мин) PBS удаляли и осадки лизировали в растворе ацетонитрил: вода (62,5: 37,5, v / v ) и тщательно перемешивали. Лизаты центрифугировали при 20000 × g в течение 20 мин при 4 ° C; затем супернатант, содержащий глутатион, собирали, быстро замораживали в жидком азоте и хранили в жидком азоте до анализа. Образцы анализировали с помощью капиллярного электрофореза (Agilent 7100), снабженного капилляром из плавленого кварца с полиимидным покрытием (60 см × 50 мкм мкм).Разделение проводили в 40 мМ фосфатном буфере (pH 7) (Sigma-Aldrich) при напряжении 30 кВ и измеряли при длине волны 195 нм. Восстановленный и окисленный глутатион определяли как отдельные пики и идентифицировали путем сравнения с коммерческими стандартами (Sigma-Aldrich). Процент дисульфида глутатиона (GSSG) рассчитывали по площадям индивидуальных пиков глутатиона (GSH) и GSSG.

2.9. Определение H
2 O 2 Производство

Производство перекиси водорода клетками PaTu-8902 измеряли как скорость окисления флуорогенного индикатора Amplex red (Life Technologies) в присутствии пероксидазы хрена (HRP, тип VI-A, Sigma-Aldrich), как описано ранее [23].Вкратце, клетки предварительно инкубировали в течение 24 часов с пигментами, затем промывали PBS и ресуспендировали в кварцевой кювете. Затем к суспензии добавляли красный амплекс (5 мкМ, M) и HRP (10 Ед / мл) и измеряли флуоресценцию (565/585) в течение 10-минутного периода спектрофлуориметрически (RF-5301-PC, Shimadzu Corporation. , Киото, Япония).

2.10. Определение антиоксидантной способности

Способность улавливать пероксильные радикалы была измерена в растворах с различной концентрацией различных хлорофиллов на основании доли потребления антиоксиданта по сравнению с Trolox, как описано ранее [24].

2.11. Определение восстановительного карбоксилирования

Степень восстановительного карбоксилирования и глутаминолиза оценивали, как описано ранее [25]. Клетки инкубировали до достижения 80% слияния, после чего среду заменяли свежей средой, содержащей 13 CL-глутамин (Cambridge Isotope Laboratories Inc., Кембридж, Массачусетс, США), и инкубировали при 37 ° C в течение дополнительных шести часов. . Наконец, клетки собирали, осадки экстрагировали водой / метанолом / хлороформом (1: 1: 2, v / v / v ; Penta, Чешская Республика) и центрифугировали при 1000 × g в течение 10 мин.Верхнюю полярную фазу переносили в стеклянный флакон и лиофилизировали в течение ночи. Аналиты были модифицированы смесью пиридин / N- (триметилсилил) ацетамид / хлортриметилсилан (9: 3: 1, v / v / v ; Sigma-Aldrich) при 65 ° C в течение одного часа. Дериватизированные образцы вводили непосредственно в устройство для газовой хроматографии / масс-спектрометрии (GC-MS, GC 6890N, MD 5973, Agilent), оборудованное дифенилдиметилполисилоксаном с перекрестными связями (колонка Restek). Температурный градиент (10 ° C в минуту) использовался во время анализа ГХ, и выбранные ионы отслеживались с помощью масс-детектора.Активность восстановительного карбоксилирования определяли по скорости включения 13 C из глутамина как в цитрат ( m, / z , 273 и 274), так и в малат ( m / z , 335 и 336). Кроме того, наблюдался синтез 2-гидроксиглутарата ( m, / z , 349 и 350). Скорость восстановительного карбоксилирования рассчитывали как процентное содержание 13 C-метаболита (цитрат, малат) вместе со скоростью синтеза 2-гидроксиглутарата.Концентрацию лактата (пмоль лактата на миллион клеток) измеряли согласно аналогичному протоколу с двумя исключениями: (1) клетки обрабатывали в течение 12 часов перед сбором и пополнением культуры свежей немеченой средой (без 13 C-меченного глутамина ) и (2) внутренний стандарт (оксалат, m / z 190, Sigma-Aldrich) добавляли перед аналитической подготовкой гранул.

2.12. Определение активации ERK и AKT

Клетки, выросшие при 50% конфлюэнтности, лизировали в буфере RIPA, который был дополнен ингибиторами фосфатазы и протеаз (смесь ингибиторов протеаз G и смесь ингибиторов фосфатаз I, Serva, Гейдельберг, Германия).Лизаты клеток осветляли центрифугированием, разделяли с помощью SDS-PAGE, блотировали до 0,45 мкм мкм нитроцеллюлозных мембран, блокировали 5% обезжиренным молоком в PBS и зондировали первичными антителами. Флуоресцентно меченые вторичные антитела против IRDye 700 кролика и против IRDye 800 мыши (LI-COR Biosciences, Lincoln, NE, USA) использовали для визуализации с использованием системы инфракрасной визуализации Odyssey (LI-COR Biosciences). Кроличий фосфо-p44 / 42 MAPK (Erk1 / 2), кроличий фосфо-Akt (Ser473), мышиный p44 / 42 MAPK (Erk1 / 2) и кроличьи первичные антитела AKT были получены от Cell Signaling Technology (Danvers, MA, USA). ).Мышиное антитело p120RasGAP было получено от ECM Biosciences LLC (Версаль, Кентукки, США).

2.13. Эксперименты in vivo

Исследования in vivo были выполнены на бестимусных мышах nu / nu (Charles River Wiga, Зульцфельд, Германия), ксенотрансплантированных подкожно клетками аденокарциномы поджелудочной железы человека PaTu-8902 (10 7 клеток / мышь; контрольная группа () и обработанная группа ()). После достижения базального размера опухоли (от 0,15 до 0,2 см 3 , через 7 дней после ксенотрансплантации) лечение хлорофиллом было начато путем внутрижелудочного введения один раз в день через желудочный зонд (1.5 мг / кг массы тела / сут) в течение 30 дней. Хлорофилл a растворяли в небольшом количестве 96% этанола и разбавляли до подходящего объема чистым растительным маслом. Контрольную группу лечили чистым растительным маслом. Размеры опухолей оценивали путем измерения двух наибольших перпендикулярных диаметров подкожных опухолей, которые измеряли каждые три дня штангенциркулем [26]. Все аспекты этих исследований на животных, а также все протоколы соответствовали принятым критериям ухода и экспериментального использования лабораторных животных и были одобрены Комитетом по исследованиям на животных 1-го медицинского факультета Карлова университета в Праге.

2.14. Статистический анализ

Различия между переменными оценивались с помощью критерия суммы рангов Манна – Уитни. Средние групповые различия в размере опухоли измеряли с помощью дисперсионного анализа повторных измерений (RM ANOVA) с апостериорным тестированием Holm-Šidák, когда значения были значительными. Анализ линейной регрессии использовали для сравнения эффектов обработки A. platensis на общую активность по улавливанию пероксилов in vitro . В зависимости от их нормальности данные представлены в виде среднего значения ± стандартное отклонение или медианы и диапазона 25–75%.Различия считались статистически значимыми, когда значения были меньше 0,05.

3. Результаты
3.1. Влияние хлорофиллов на жизнеспособность раковых клеток поджелудочной железы

Все протестированные хлорофиллы снижали жизнеспособность клеток дозозависимым образом в диапазоне концентраций от 10 до 125 мк моль / л (Таблица 2). В целом, биологически значимый эффект постоянно наблюдался при концентрациях 50 мк М в хлорофиллах a и b , тогда как эффекты феофитина a и хлорофиллина были незначительными или отсутствовали (Таблица 2).Клеточной линией рака поджелудочной железы, наиболее чувствительной к антипролиферативным эффектам хлорофиллов, была линия PaTu-8902 (таблица 2), которую использовали для дальнейших исследований.


Клеточная линия Концентрация ( мк M) Хлорофилл a Хлорофилл b Хлорофиллин Хлорофиллин
PaTu-8902 10 48.8 87,8 94,8 91,6
50 18,6 65,6 94,2 90,2
90,2
12545 900,19 45,8 62,9 76,7

MiaPaCa-2 10 96,2 103.4 116,5 NT
50 69,6 91,4 117,1 NT
125 40,3 87,6 110400 9069 9069
BxPC-3 10 97,3 107,2 104,9 NT
50 76,3 54.5 98,4 NT
125 64,8 75,7 84,5 NT

Данные выражены как% от контроля. Жирным шрифтом выделены данные со значением
3.2. Влияние хлорофиллов на экспрессию мРНК HMOX1 и BLVRA при раке поджелудочной железы человека

Из-за структурного сходства между хлорофиллами и желчными пигментами человека и огромной роли катаболического пути гема в модуляции окислительного стресса и биологии окислительно-восстановительного потенциала мы изучили эффект хлорофиллов на экспрессии мРНК HMOX1 и BLVRA в клетках рака поджелудочной железы человека PaTu-8902.Хотя никакого эффекта на экспрессию мРНК BLVRA не наблюдалось при обработке любым из протестированных хлорофиллов, экспрессия мРНК HMOX1 была значительно подавлена ​​всеми хлорофиллами (рис. 2 (а)). Соответственно, активность HMOX в раковых клетках поджелудочной железы также значительно подавлялась всеми хлорофиллами (), причем хлорофиллин выступал в качестве наиболее мощного ингибитора HMOX (до 44 ± 10% (рис. 2 (b))).

3.3. Влияние хлорофиллов на параметры окислительного стресса и окислительно-восстановительный статус раковых клеток поджелудочной железы человека PaTu-8902

Затем мы исследовали антиоксидантную активность хлорофиллов.Используя анализ in vitro , все протестированные хлорофиллы показали способность улавливать пероксильные радикалы дозозависимым образом, причем хлорофиллин является наиболее эффективным (рис. 3).

На основании этих результатов мы затем исследовали, могут ли хлорофиллы снижать митохондриальную продукцию супероксида в обработанных клетках рака поджелудочной железы. Фактически, во всех протестированных хлорофиллах даже такие низкие концентрации, как 10 мкл М, существенно снижали выработку митохондриального супероксида в клетках рака поджелудочной железы (рис. 4).Кроме того, при воздействии любого из протестированных хлорофиллов в раковых клетках поджелудочной железы наблюдались повышенные пропорции восстановленного глутатиона, что свидетельствует об ослаблении выработки внутриклеточных оксидантов (рис. 5). Кроме того, производство перекиси водорода клетками рака поджелудочной железы человека также значительно зависело от более высоких концентраций исследуемых хлорофиллов (50 мкл моль / л (рис. 6)), в то время как более низкие концентрации не оказывали влияния (10 мкл моль / л, данные не показаны).




3.4. Влияние хлорофиллов на восстановительное карбоксилирование и глутаминолиз раковых клеток поджелудочной железы человека PaTu-8902

Из-за очевидного ингибирующего действия хлорофиллов на продукцию митохондриальных активных форм кислорода (АФК) мы интересовались, могут ли хлорофиллы модулировать митохондриальный глутаминолиз. восстановительное карбоксилирование, которое способствует антиоксидантной защите митохондрий [25, 27]. В этих исследованиях воздействие на раковые клетки поджелудочной железы человека PaTu-8902 хлорофиллом a , хлорофиллом b , феофитином a и хлорофиллином (50 мк моль / л для всех пигментов) не привело к каким-либо значительным изменениям. изменения включения 13 C из глутамина в 2-гидроксиглутарат и α -кетоглутарат (оба маркера активного глутаминолиза), а также в цитрат и малат (оба маркера восстановительного карбоксилирования).Кроме того, не наблюдалось никаких изменений в производстве лактата, что свидетельствует о ненарушенном балансе между митохондриальным дыханием и гликолизом (данные не показаны).

3.5. Влияние хлорофиллов на активацию ERK и AKT в клетках рака поджелудочной железы человека PaTu-8902

Поскольку сообщалось, что хлорофиллин ингибирует пролиферацию клеток карциномы молочной железы MCF-7, дезактивируя ERK [28], а также подавляя PI3K / Akt. сигнальный путь [29], мы проверили, может ли этот антипролиферативный механизм играть некоторую роль в раковых клетках поджелудочной железы.Однако воздействие на раковые клетки поджелудочной железы PaTu-8902 человека хлорофиллом a или хлорофиллином (50 мк моль / л) в течение 1 часа не приводило к каким-либо значительным изменениям фосфорилирования и, следовательно, к активации AKT или ERK. (Рисунок 7).


3.6. Влияние хлорофиллов на жизнеспособность рака поджелудочной железы человека, ксенотрансплантированного мышам

Поскольку хлорофиллы значительно снижают жизнеспособность клеток рака поджелудочной железы, мы протестировали влияние хлорофилла a на рост опухоли в исследовании in vivo на бестимусных мышах, ксенотрансплантированных подкожно. с клетками рака поджелудочной железы человека PaTu-8902.Ежедневное пероральное введение хлорофилла и привело к значительному уменьшению размера опухоли у обработанных животных (фиг. 8). Следует отметить, что после месяца лечения опухоли поджелудочной железы были примерно в три раза меньше тех, которые получали плацебо (1,04 ± 0,8 против 2,86 ± 1,6 см 3 , (Рисунок 8)), что указывает на то, что даже пероральное введение Относительно плохо растворимый хлорофилл a - очень эффективный подход к предотвращению прогрессирования этого злокачественного рака.


4. Обсуждение

Хлорофиллы, самые распространенные пигменты на Земле, которые естественным образом включены в пищевую цепь человека, представляют собой природные соединения с мощным биологическим действием. Хотя об их потенциально благоприятном воздействии на здоровье человека уже сообщалось в первой половине 20-го века [30], и если также принять во внимание их изобилие, количество убедительных экспериментальных и клинических данных по этой теме на удивление невелико.Принято считать, что химиопрофилактические эффекты хлорофиллов, скорее всего, связаны с их способностью задерживать канцерогены в просвете кишечника [1], что продемонстрировано как в китайских [9], так и в голландских клинических исследованиях [10].

Несмотря на длительные дискуссии об их биодоступности, хлорофиллы, по-видимому, важны для их потенциальных системных профилактических эффектов от рака [31]. Фактически, недавние исследования показали, что биологически значимая фракция хлорофиллов (или их производных) даже присутствует в периферических тканях [4].Это было показано в исследовании Гандул-Рохаса и его коллег, которые обнаружили, что биодоступность дефитилированного хлорофилла увеличена в 65 раз по сравнению с материнским пигментом [32].

Хотя хлорофилл a является основным видом хлорофилла, присутствующим в царстве растений, большое количество других хлорофиллов и их метаболитов существует в различных растениях, водорослях и животных [6] и, таким образом, попадает в пищевую цепочку человека. Кроме того, в течение жизненного цикла растений хлорофиллы активно метаболизируются в клетках растений, и эти производные хлорофилла, действуя как мощные антиоксиданты, как полагают, играют важную роль в старении, аналогично тому, как билирубин в организме человека [5 ].Кроме того, известно, что хлорофилл превращается в феофитин, пирофеофитин и феофорбид в обработанных овощных продуктах, и после приема внутрь люди могут извлечь выгоду из их потенциальной биологической активности [33]. Действительно, как безметалловые, так и производные металлохлорофилла, представляющие собой пищевые метаболиты хлорофилла, которые преобладают как в свежих, так и в обработанных пищевых продуктах (а также в пищевых добавках), обладают антиоксидантной, антимутагенной и противоопухолевой активностью [34, 35] .Кроме того, части метаболизируемых хлорофиллов, такие как фитановая кислота, могут проявлять специфическую активность, модулирующую ядерные рецепторы [6, 36], благодаря которой они могут вносить вклад в биологические эффекты, которые наблюдались как в экспериментальных, так и в клинических исследованиях. Однако следует подчеркнуть, что судьба хлорофиллов в организме человека, а также их потенциальные биологические эффекты до сих пор остаются практически неизученными. Фактически, в настоящее время неизвестно, связаны ли потенциальные противораковые эффекты хлорофиллов только с нативными тетрапирроловыми соединениями или с продуктами их распада (или с обоими), образующимися в пищеварительной системе человека.Кроме того, в зеленых растениях может быть множество других биологически активных соединений, которые способствуют или модифицируют противораковые эффекты.

Тем не менее, о широком спектре химиопрофилактических действий сообщалось для хлорофиллина, наиболее часто изучаемого производного хлорофилла, который влияет на множество внутриклеточных мишеней и путей, способствующих канцерогенезу (см. Обзор [37]). Фактически, в нашем исследовании in vitro на раковых клетках поджелудочной железы человека мы продемонстрировали мощную антипролиферативную активность для всех протестированных хлорофиллов и обнаружили, что хлорофилл a был наиболее эффективным.Мы также описали эти противораковые эффекты в нашем исследовании in vivo на голых мышах, которым были ксенотрансплантированы клетки PaTu-8902 (наиболее чувствительная линия клеток рака поджелудочной железы человека в наших экспериментах).

Антиоксидантное действие - одно из наиболее признанных видов деятельности хлорофиллов. Например, документально подтверждено, что хлорофиллин обеспечивает более высокую степень защиты от свободных радикалов по сравнению с другими антиоксидантами, такими как аскорбиновая кислота и глутатион [38].Фактически, мы недавно заметили, что антиоксидантные эффекты тетрапирролов, билирубина и фикоцианобилина резко отличаются от таковых других антиоксидантов. Наиболее заметной особенностью их действия было ослабление продукции митохондриальных АФК [39, 40]. Здесь мы показали, что то же самое верно и для хлорофиллов. Все протестированные хлорофиллы не только постоянно улучшали общую активность по улавливанию пероксильных радикалов, но также подавляли выработку митохондриальных АФК и общего клеточного перекиси водорода раковыми клетками, что сопровождалось сдвигом окислительно-восстановительного статуса глутатиона в сторону снижения.

Важно отметить, что митохондриальные АФК управляют передачей клеточного окислительно-восстановительного сигнала, и было показано, что увеличение их продукции имеет решающее значение для туморогенеза [41, 42]. Однако раковые клетки также активируют антиоксидантную защиту, чтобы поддерживать баланс между окислительной передачей сигналов и окислительным стрессом [43]. Действительно, несколько сообщений предполагают, что добавление антиоксидантов, включая N-ацетилцистеин и токоферол, на самом деле может способствовать прогрессированию рака благодаря их защите от окислительного стресса [44, 45].Однако здесь мы сообщаем, что хлорофиллы, в отличие от других антиоксидантов, подавляли прогрессирование рака поджелудочной железы. Этот эффект сопровождался ослаблением экспрессии и активности HMOX1, важнейшего компонента внутренней антиоксидантной системы клетки. Это может действительно иметь отношение к их противоопухолевым эффектам, поскольку, как сообщается, экспрессия HMOX1 предотвращает чувствительность рака поджелудочной железы к цитостатической терапии [17]. Интересно отметить, что этот эффект может быть специфическим для (раковых) клеток, поскольку противоположная активность против экспрессии HMOX1 наблюдалась для обработанных хлорофиллином эндотелиальных клеток пупочной вены человека [46].Наше наблюдение не может показаться удивительным в свете взаимосвязи между хлорофиллом и HMOX в растениях [47]. Также было высказано предположение, что BLVRA, другой важный фермент катаболического пути гема, способствует канцерогенезу [18]. Фактически, повышенная экспрессия BLVRA была продемонстрирована у пациентов с гепатоцеллюлярным раком [19], а также в клеточных линиях рака груди и легких [20]. Тем не менее, в наших исследованиях in vitro на раковых клетках поджелудочной железы человека мы не наблюдали каких-либо эффектов хлорофиллов на экспрессию BLVRA .

Интересно, что мы не наблюдали никакого эффекта хлорофиллов на глутаминолиз или восстановительное карбоксилирование, что указывает на то, что обработка хлорофиллом не влияет ни на гликолиз, ни на митохондриальное дыхание [25]. Следовательно, кажется, что антипролиферативные эффекты хлорофиллов связаны с подавлением продукции АФК и не связаны с биоэнергетикой клетки.

В предыдущих исследованиях сообщалось, что хлорофиллин подавляет сигнальный путь PI3K / Akt [29] и ингибирует пролиферацию клеток карциномы молочной железы MCF-7 путем деактивации ERK [28].Однако ни хлорофилл a , ни хлорофиллин не оказали какого-либо ингибирующего действия на фосфорилирование AKT или ERK в наших исследованиях клеток рака поджелудочной железы.

5. Выводы

Хлорофиллы опосредуют изменения окислительно-восстановительного статуса клеток рака поджелудочной железы, которые могут частично отвечать за их противораковые эффекты и способствовать снижению заболеваемости раком среди потребителей зеленых овощей, наблюдаемых в клинических исследованиях.

Доступность данных

Все необработанные данные, подтверждающие результаты, полностью доступны по запросу от соответствующего автора.

Конфликт интересов

Авторы заявляют, что у них нет финансовых или коммерческих конфликтов интересов.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *