Перинатальная диагностика генетических нарушений: Sorry, this page can’t be found.

Содержание

В Петербурге обсудили перспективы расширения дородовой диагностики

https://ria.ru/20201114/beremennost-1584585502.html

В Петербурге обсудили перспективы расширения дородовой диагностики

В Петербурге обсудили перспективы расширения дородовой диагностики — РИА Новости, 14.11.2020

В Петербурге обсудили перспективы расширения дородовой диагностики

Ведущие российские ученые обсудили на конференции в Санкт-Петербурге перспективы расширения дородовой диагностики, в том числе имплантационной диагностики и… РИА Новости, 14.11.2020

2020-11-14T08:19

2020-11-14T08:19

2020-11-14T08:25

санкт-петербург

здоровье — общество

/html/head/meta[@name=’og:title’]/@content

/html/head/meta[@name=’og:description’]/@content

https://cdnn21.img.ria.ru/images/95433/73/954337334_0:154:2872:1770_1920x0_80_0_0_1a78d7d9cb59550b3ea226abc43fc65e.jpg

С.-ПЕТЕРБУРГ, 14 ноя — РИА Новости. Ведущие российские ученые обсудили на конференции в Санкт-Петербурге перспективы расширения дородовой диагностики, в том числе имплантационной диагностики и неинвазивного тестирования. С 11 по 13 ноября в Петербурге прошла VII всероссийская онлайн-конференция с международным участием «Геномная медицина в пренатальной диагностике, генетическом паспорте и в генной терапии», приуроченная к 80-летию ведущего российского ученого-генетика Владислава Баранова.Этические аспекты»Самая главная наша задача — действительно обратить внимание еще раз на генетику. И в нашем институте всегда были два направления — это пренатальная диагностика и медицинская генетика. Это два раздела медицины. В одном случае мы уделяем внимание здоровью плода, в другом случае мы изучаем генетические основы любых признаков любых заболеваний человека», — сказал РИА Новости руководитель отдела геномной медицины НИИ акушерства, гинекологии и репродуктологии имени Д.О. Отта Андрей Глотов.Он отметил, что важное значение в генетике имеют и этические аспекты, связанные в частности, с рождением детей с тяжелыми хромосомными патологиями. Соответственно, возникает вопрос: давать ли развиваться такому эмбриону.»Понятно, что рождение любого ребенка или аборт – это решение женщины. Но не будем скрывать, что врачи формируют эту точку зрения пациента, и сегодня мы должны четко понимать… в каких случаях мы можем допустить прерывание беременности, в каких случаях можем помочь. Особенно это касается того, когда есть мутации или какие-то врожденные пороки развития, совместимые с сохранением интеллекта. Именно для этих потенциальных людей мы должны сделать максимально много», — сказал Глотов.Как рассказала ведущий научный сотрудник ФГБУ «НМИЦ эндокринологии», заместитель председателя Российского общества молодых эндокринологов Мария Воронцова, генетические исследования в целом существенно облегчают работу врачей, позволяя им получить всестороннюю информацию о состоянии пациентов. «Я не думаю, что генетика сможет ответить на все вопросы, но она позволяет с большей точностью поставить диагноз, назначить терапию. Чем полнее картина, тем лучше для врача и пациента», — отметила она.Она назвала «прорывным решением» в современной клинической медицине рост доступности генетических исследований для широкого круга пациентов, в том числе и детей. «Если раньше врач мог назначить генетические исследования только в сложных случаях, то сейчас врач назначит их тому, кому нужно, и тогда, когда нужно. Эту доступность широкому кругу пациентов… можно считать наибольшим прорывом. Технологии стали ближе к людям — пациентам и врачам, и это сверхважно», — сказала Воронцова.»В ближайшем будущем методы генетической диагностики должны стать чем-то само-собой разумеющимся, частью жизни», — добавила она.У неинвазивного тестирования большой потенциалВ числе ключевых тем конференции Глотов также назвал неинвазивное пренатальное тестирование, которое позволяет с достаточно высокой точностью прогнозировать состояние здоровья плода.»Это самый распространенный в мире генетический тест, потому что он востребован. Это одна из немногих технологий, которая востребована не благодаря ученым-коммерсантам, а благодаря желанию женщин получить максимально неинвазивными способами информацию о своем плоде», — сказал он.При этом, по оценке Глотова, сейчас в России потенциал неивазивного дородового тестирования использован «на 20-30 процентов». Как отметил ученый, это связано в частности с тем, что пока генетические исследования пациентов «не встроены» в региональные системы здравоохранения. Кроме того, ряд генетических тестов не прошли регистрацию в Минздраве.»Мы надеемся, что разумные решения в этом вопросе тоже будут достигнуты. Как минимум, многим компаниям-производителям придется пройти систему регистрации или же будет введен другой механизм, который позволит использовать незарегистрированные технологии», — сказал Глотов.Как рассказала в своем докладе руководитель направления пренатальной диагностики ООО «Эвоген» Александра Галактионова, пилотный проект внедрения неинвазивного пренатального теста для выявления возможных патологий продолжится в Москве в 2021 году. Она пояснила, что неинвазивный пренатальный тест позволяет повысить выявляемость хромосомной патологии до 99% и увеличить эффективность всей пренатальной диагностики в целом.По словам Глотова, участники конференции обсудили также пренатальную имплантационную диагностику, позволяющую «подсадить» будущей матери эмбрион без генетических нарушений. «Это очень важная задача, потому что у нас сейчас растет число позднеродящих женщин… У нас сейчас есть тренд на появление второго и третьего ребенка у женщин старшей возрастной группы, а риски после 39 лет того же заболевания болезнью Дауна возрастают в 10 раз, то есть риск рождения такого ребенка – каждая сотая беременность после 39 лет», — отметил он.Генетики изучают коронавирусУчастники конференции также не обошли вниманием и изучение генетической чувствительности к новой коронавирусной инфекции. «С точки зрения текущей ситуации это оценка груза, который нам дает собственный геном, и то, что нам дает геном вируса. Мы должны понимать, какие мутации вирусные и человеческие сходятся в этом неблагоприятном сочетании и приводят либо к осложнениям, либо, не дай бог, к смерти», — сказал Глотов.»Здесь есть большое поле деятельности. Мы понимаем, что генетика инфекционных заболеваний в самое ближайшее время будет иметь определенный ренессанс», — заключил ученый.НИПТ – это неинвазивный пренатальный тест, с помощью которого можно выявить наследственные генетические заболевания (синдром Дауна, Эдвардса, Патау и другие). Еще недавно женщины с высоким риском наличия хромосомной аномалии плода могли подтвердить или опровергнуть страшные диагнозы только после проведения инвазивной пренатальной диагностики. А это вмешательство, во время которого есть риск прерывания беременности. НИПТ не заменяет полностью инвазивную диагностику, но значительно сокращает число женщин, которым необходима такая процедура.С появлением НИПТ в области пренатального тестирования произошли революционные изменения. НИПТ — обычная процедура забора крови у будущей мамы. Так как анализ проводится без инвазивного вмешательства, нет риска прерывания беременности или инфицирования плода. Высокая чувствительность и специфичность теста позволяет выявлять не только частые патологии, например, синдром Дауна определяется с точностью до 99%, но и другие хромосомные аномалии, не имеющие выраженных пороков развития плода, которые обычно определяются на УЗИ.

https://ria.ru/20200217/1564800066.html

https://ria.ru/20190321/1551974817.html

https://ria. ru/20201015/stvolovye-kletki-1579834630.html

https://ria.ru/20200806/1575417295.html

https://ria.ru/20200606/1572571269.html

https://ria.ru/20200219/1564930704.html

https://ria.ru/20190523/1554852622.html

санкт-петербург

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

2020

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

Новости

ru-RU

https://ria.ru/docs/about/copyright.html

https://xn--c1acbl2abdlkab1og.xn--p1ai/

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

https://cdnn21.img.ria.ru/images/95433/73/954337334_154:0:2718:1923_1920x0_80_0_0_7a4665ab687165034f987c89b3e4e5f9. jpg

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

санкт-петербург, здоровье — общество

С.-ПЕТЕРБУРГ, 14 ноя — РИА Новости. Ведущие российские ученые обсудили на конференции в Санкт-Петербурге перспективы расширения дородовой диагностики, в том числе имплантационной диагностики и неинвазивного тестирования.

С 11 по 13 ноября в Петербурге прошла VII всероссийская онлайн-конференция с международным участием «Геномная медицина в пренатальной диагностике, генетическом паспорте и в генной терапии», приуроченная к 80-летию ведущего российского ученого-генетика Владислава Баранова.

17 февраля 2020, 08:00НаукаГенетика — не приговор: помощь придет из России

Этические аспекты

«Самая главная наша задача — действительно обратить внимание еще раз на генетику. И в нашем институте всегда были два направления — это пренатальная диагностика и медицинская генетика. Это два раздела медицины. В одном случае мы уделяем внимание здоровью плода, в другом случае мы изучаем генетические основы любых признаков любых заболеваний человека», — сказал РИА Новости руководитель отдела геномной медицины НИИ акушерства, гинекологии и репродуктологии имени Д.О. Отта Андрей Глотов.

Он отметил, что важное значение в генетике имеют и этические аспекты, связанные в частности, с рождением детей с тяжелыми хромосомными патологиями. Соответственно, возникает вопрос: давать ли развиваться такому эмбриону.

«Понятно, что рождение любого ребенка или аборт – это решение женщины. Но не будем скрывать, что врачи формируют эту точку зрения пациента, и сегодня мы должны четко понимать… в каких случаях мы можем допустить прерывание беременности, в каких случаях можем помочь. Особенно это касается того, когда есть мутации или какие-то врожденные пороки развития, совместимые с сохранением интеллекта. Именно для этих потенциальных людей мы должны сделать максимально много», — сказал Глотов.

21 марта 2019, 03:38НаукаНазваны факторы, влияющие на возможность рождения ребенка с синдромом Дауна

Как рассказала ведущий научный сотрудник ФГБУ «НМИЦ эндокринологии», заместитель председателя Российского общества молодых эндокринологов Мария Воронцова, генетические исследования в целом существенно облегчают работу врачей, позволяя им получить всестороннюю информацию о состоянии пациентов. «Я не думаю, что генетика сможет ответить на все вопросы, но она позволяет с большей точностью поставить диагноз, назначить терапию. Чем полнее картина, тем лучше для врача и пациента», — отметила она.

Она назвала «прорывным решением» в современной клинической медицине рост доступности генетических исследований для широкого круга пациентов, в том числе и детей. «Если раньше врач мог назначить генетические исследования только в сложных случаях, то сейчас врач назначит их тому, кому нужно, и тогда, когда нужно. Эту доступность широкому кругу пациентов… можно считать наибольшим прорывом. Технологии стали ближе к людям — пациентам и врачам, и это сверхважно», — сказала Воронцова.

«В ближайшем будущем методы генетической диагностики должны стать чем-то само-собой разумеющимся, частью жизни», — добавила она.

15 октября 2020, 09:00НаукаБорьба с раком и COVID-19: ученые делают ставку на стволовые клетки

У неинвазивного тестирования большой потенциал

В числе ключевых тем конференции Глотов также назвал неинвазивное пренатальное тестирование, которое позволяет с достаточно высокой точностью прогнозировать состояние здоровья плода.

«Это самый распространенный в мире генетический тест, потому что он востребован. Это одна из немногих технологий, которая востребована не благодаря ученым-коммерсантам, а благодаря желанию женщин получить максимально неинвазивными способами информацию о своем плоде», — сказал он.

При этом, по оценке Глотова, сейчас в России потенциал неивазивного дородового тестирования использован «на 20-30 процентов».

6 августа 2020, 08:00НаукаТемные секреты ДНК. Ученые рассказали об опасности «чистоты крови»

Как отметил ученый, это связано в частности с тем, что пока генетические исследования пациентов «не встроены» в региональные системы здравоохранения. Кроме того, ряд генетических тестов не прошли регистрацию в Минздраве.

«Мы надеемся, что разумные решения в этом вопросе тоже будут достигнуты. Как минимум, многим компаниям-производителям придется пройти систему регистрации или же будет введен другой механизм, который позволит использовать незарегистрированные технологии», — сказал Глотов.

Как рассказала в своем докладе руководитель направления пренатальной диагностики ООО «Эвоген» Александра Галактионова, пилотный проект внедрения неинвазивного пренатального теста для выявления возможных патологий продолжится в Москве в 2021 году. Она пояснила, что неинвазивный пренатальный тест позволяет повысить выявляемость хромосомной патологии до 99% и увеличить эффективность всей пренатальной диагностики в целом.

6 июня 2020, 18:02

Эксперт рассказал, зачем нужна Национальная база генетической информации

По словам Глотова, участники конференции обсудили также пренатальную имплантационную диагностику, позволяющую «подсадить» будущей матери эмбрион без генетических нарушений.

«Это очень важная задача, потому что у нас сейчас растет число позднеродящих женщин… У нас сейчас есть тренд на появление второго и третьего ребенка у женщин старшей возрастной группы, а риски после 39 лет того же заболевания болезнью Дауна возрастают в 10 раз, то есть риск рождения такого ребенка – каждая сотая беременность после 39 лет», — отметил он.

Генетики изучают коронавирус

Участники конференции также не обошли вниманием и изучение генетической чувствительности к новой коронавирусной инфекции. «С точки зрения текущей ситуации это оценка груза, который нам дает собственный геном, и то, что нам дает геном вируса. Мы должны понимать, какие мутации вирусные и человеческие сходятся в этом неблагоприятном сочетании и приводят либо к осложнениям, либо, не дай бог, к смерти», — сказал Глотов.

«Здесь есть большое поле деятельности. Мы понимаем, что генетика инфекционных заболеваний в самое ближайшее время будет иметь определенный ренессанс», — заключил ученый.

19 февраля 2020, 08:00НаукаУченые объяснили, какие мутации могут помешать браку

НИПТ – это неинвазивный пренатальный тест, с помощью которого можно выявить наследственные генетические заболевания (синдром Дауна, Эдвардса, Патау и другие). Еще недавно женщины с высоким риском наличия хромосомной аномалии плода могли подтвердить или опровергнуть страшные диагнозы только после проведения инвазивной пренатальной диагностики. А это вмешательство, во время которого есть риск прерывания беременности. НИПТ не заменяет полностью инвазивную диагностику, но значительно сокращает число женщин, которым необходима такая процедура.

С появлением НИПТ в области пренатального тестирования произошли революционные изменения. НИПТ — обычная процедура забора крови у будущей мамы. Так как анализ проводится без инвазивного вмешательства, нет риска прерывания беременности или инфицирования плода. Высокая чувствительность и специфичность теста позволяет выявлять не только частые патологии, например, синдром Дауна определяется с точностью до 99%, но и другие хромосомные аномалии, не имеющие выраженных пороков развития плода, которые обычно определяются на УЗИ.

23 мая 2019, 18:26НаукаУченые открыли ген, который поможет вылечить болезнь Дауна

Генетические тесты — Клиника Екатерининская

Для каждой мамы важна уверенность в благополучном развитии своего малыша и спокойствие на протяжении всей беременности. Оценить внутриутробное развитие ребенка помогает рекомендованный Минздравом РФ (приказ №1130 н) комплекс исследований – скрининговое УЗИ в I триместре беременности и анализ крови на материнские сывороточные маркеры (β-ХГЧ и PAPP-A). К сожалению, такая пренатальная диагностика позволяет исключить только 3 наиболее частые анеуплоидии – синдром Дауна, синдром Эдвардса и Патау – лишь на 80%.  Эти методы исследований не дают оснований для полной уверенности в отсутствии у плода хромосомных аномалий.

Неинвазивное пренатальное тестирование (НИПС) позволяет с точностью выше 99% выявить или исключить наличие генетических патологий у малыша уже на ранних сроках беременности, а также в ряде случаев избежать инвазивной диагностики, которая сопряжена с риском осложнений беременности.

В Клинике Екатерининская представлены 4 вида ДНК-тестов для выявления генетических аномалий – НИПС Т21, НИПС 5, НИПС 12 и НИПС расширенный.

Преимущества НИПС:

  • точность выше 99%;
  • безопасно для мамы и малыша;
  • позволяет выявить до 7 хромосомных аномалий, в том числе синдром Дауна, синдром Эдвардса и Патау, микроделеционные синдромы плода и моногенные заболевания матери;
  • в ряде случаев позволяет избежать инвазивной пренатальной диагностики, которая сопровождается угрозой для здоровья и жизни плода;
  • основан на выделении ДНК ребенка из крови матери и ее изучении на предмет анеуплоидий;
  • применение метода секвенирования нового поколения.

Когда выполнять?

Рекомендуется выполнять НИПТ на сроке 10-11 недель беременности в соответствии с признаками УЗИ.

К этому моменту в крови матери циркулирует достаточно генетического материала малыша для высокоинформативного исследования.

Чем отличаются тесты НИПС?

Тесты НИПС отличаются диагностическими возможностями.

НИПС Т21 позволяет оценить риск развития синдрома Дауна;

НИПС 5 – синдром Дауна, синдром Эдвардса, синдром Патау, синдром Тернера, синдром Клайнфельтера;

НИПС 12 – 7 хромосомных аномалий (синдром Дауна, синдром Эдвардса, синдром Патау, синдром Тернера, синдром Клайнфельтера, синдром Якобса и трисомия Х хромосомы) и 18 моногенных заболеваний матери, который могут привести к генным мутациям плода, а также дает возможность установить пол ребенка;

НИПС расширенный –  позволяет оценить риск развития 7 хромосомных аномалий и 6 микроделеционных синдромов (синдром делеции 22q11, Прадера-Вилли, синдром Вольфа — Хиршхорна, синдром кошачьего крика, синдром Ангельмана, синдром делеции 1p36), выявить 18 моногенных заболеваний матери, который могут привести к генным мутациям плода, дает возможность установить пол ребенка.

В каких случаях рекомендуется НИПС?

  • если результаты биохимического скрининга показали высокий риск хромосомной патологии;
  • беременным в возрасте старше 35 лет;
  • если были выявлены генетические нарушения у плода при предыдущих беременностях;
  • желание женщины пройти тестирование;
  • отсутствие возможности провести исследования с проникновением в полость матки из-за угрозы прерывания беременности;
  • прерывание беременности в анамнезе;
  • бесплодие в анамнезе;
  • мертворождение или рождение ребёнка с пороками развития в анамнезе,
  • применение вспомогательных репродуктивных технологий (ЭКО) при данной беременности.

«Американское общество акушеров–гинекологов» рекомендует НИПТ всем беременным в сочетании с УЗ-скринингом.

Неинвазивное пренатальное тестирование информативно при двуплодной беременности на синдромы Дауна, Эдвардса, Патау и определение пола плода.

Сроки готовности результатов НИПС

Срок проведения исследования составляет от 2 до 8 рабочих дней (с момента поступления биоматериала в лабораторию).

Как выявить генетические дефекты будущего ребенка? | Научные открытия и технические новинки из Германии | DW

То, что в крови беременной вскоре после зачатия появляются и фрагменты ДНК эмбриона, было впервые обнаружено 15 лет назад. С тех пор ученые пытаются использовать этот феномен для получения информации о здоровье, а вернее — о возможных генетических и хромосомных дефектах будущего ребенка. И не только пытаются, но уже достигли на этом пути значительных успехов.

Правда, до самого недавнего времени единственным способом пренатальной, то есть дородовой диагностики, позволяющей выявлять генетические аномалии такого рода, был так называемый амниоцентез. Это не только крайне малоприятная, но и связанная с риском выкидыша инвазивная процедура, в ходе которой врач специальной иглой через переднюю брюшную стенку беременной выполняет пункцию зародышевой оболочки с целью получения пробы околоплодных вод для их последующего лабораторного исследования.

Однако совсем недавно был разработан метод, позволяющий на основе анализа крови беременной надежно диагностировать у плода трисомии — прежде всего, трисомию по 21-й хромосоме, то есть синдром Дауна. Этот метод уже применяется в США, в июле ожидается его поступление и на немецкий рынок.

Новый успех дородовой диагностики

Но разработка такого теста на трисомию была, как теперь выяснилось, лишь первым шагом в перспективном направлении. Потому что группа американских медиков добились нового крупного успеха в сфере дородовой диагностики: им удалось на основе анализа проб крови матери и слюны отца полностью реконструировать наследственный материал будущего ребенка и проверить его на наличие так называемых моногенных заболеваний.

Руководитель проекта Джей Шендью (Jay Shendure), профессор генетики Вашингтонского университета в Сиэтле, поясняет: «Это заболевания, вызываемые дефектом какого-то одного гена и передающиеся по наследству по законам классической генетики. Каждое такое заболевание встречается весьма редко, но зато их много, так что в среднем у каждого сотого новорожденного обнаруживается такой дефект».

Учеными описано сегодня уже более трех тысяч моногенных наследственных заболеваний. Среди наиболее известных — муковисцидоз и хорея Хантингтона, однако сюда же относятся и фибродисплазия, и болезнь Гоше, и синдром Марфана, и болезнь Вильсона-Коновалова, и многие другие недуги, названия которых подавляющее большинство непричастных к медицине, да и многое врачи, к счастью, никогда в жизни даже не слышали. И все же та или иная из этих болезней встречается в среднем у одного процента новорожденных. «Один процент — это довольно высокий показатель, — говорит профессор Шендью, — тем более, что речь идет, как правило, об очень тяжелых заболеваниях. И многие из них неизлечимы».

И старые мутации, и новые…

Сегодня, даже когда беременная решается на амниоцентез, медики обычно проверяют ДНК будущего ребенка лишь на трисомии и на наличие вполне определенных опасных мутаций — тех, что ранее были обнаружены у родителей, дедушек или бабушек, — то есть выясняют, передался ли этот генный дефект по наследству следующему поколению. Но дело в том, что моногенные заболевания могут не только передаваться по наследству, но и возникать в результате новых, впервые появившихся у плода мутаций. В геноме каждого ребенка таких новых мутаций в среднем около полусотни, и среди них может оказаться и такая, что чревата развитием тяжелого заболевания.

Сегодняшние методы пренатальной диагностики не способны выявить такие мутации, но вскоре, похоже, ситуация кардинально изменится — благодаря работам профессора Шендью и его коллег. Ученый говорит: «Я думаю, здесь просматриваются два важных потенциальных преимущества. Во-первых, доступ к полной генетической информации о плоде может быть получен без рискованной инвазивной процедуры амниоцентеза. Во-вторых, похоже, нам удастся просканировать геном плода сразу на множество моногенных заболеваний. Мы сможем даже выявить новые мутации. Тут еще есть над чем поработать, но мы показали, что в принципе это функционирует».

Ученые анализировали пробы материнской крови и отцовской слюны от двух супружеских пар. Личного контакта между исследователями и подопытными не было, пробы поступили из базы данных местной клиники. Одна из женщин была на 18-й неделе беременности, другая — на восьмой. Прежде всего, ученые полностью секвенировали геномы родителей — благо, сегодняшнее оборудование позволяет сделать это очень быстро и с высокой точностью. Затем настала очередь генома ребенка. По словам исследователей, в ДНК, содержащейся в плазме материнской крови, наследственный материал плода составляет в среднем 13 процентов. Выделить его, а затем секвенировать было не так уж трудно.

39 из 44 — много это или мало?

Самой сложной и трудоемкой задачей был дальнейший сравнительный анализ генов родителей и эмбриона. «Нам удалось установить, какие варианты генов плод унаследовал от матери, а какие — от отца, — говорит профессор Шендью. — Кроме того, мы смогли выявить и новые мутации, те, что отсутствуют в геномах родителей и впервые появились в ДНК эмбриона».

После того, как дети обеих пар появились на свет, их пуповинная кровь была проанализирована непосредственно, и геномы секвенированы повторно.

При контрольном сравнении результатов оказалось, что из 44 новых мутаций у одного из новорожденных ученые смогли заранее, на стадии внутриутробного развития, обнаружить 39. Неплохо для начала, говорит исследователь, но тут же добавляет: «С другой стороны, прежде чем такой анализ войдет в клиническую практику, его точность и достоверность должны быть существенно повышены».

На это уйдет не один год. Кроме того, нынешний анализ обошелся в 50 тысяч долларов — это терпимо, когда речь идет об исследовательском проекте, но совершенно неприемлемо для рутинного метода диагностики. К тому же полученная генетическая информация, при полной надежности самого метода, может быть интерпретирована очень по-разному. И, наконец, открытыми остаются многие этические вопросы. Но ответа на них бессмысленно ждать от генетиков.

Медико-генетическая консультация

Показания для медико-генетического консультирования

1.Первичное бесплодие супругов после исключения гинекологической патологии у жены, а также при наличии аспермии у мужа.

2.Первичная аменорея с недоразвитием вторичных половых признаков (подозрение на синдром Шерешевского –Тернера, дисгенезию гонад).

3.Нарушение половой дифференцировки, адреногенитальный синдром.

4. Повторные спонтанные аборты, мертворождения, замершие беременности.

5. Рождение ребенка с пороками развития, болезнью Дауна.

6. Наличие любого наследственного заболевания или врожденных пороков развития у мужа, жены или их родственников.

7.Многократная угроза прерывания данной беременности в сроке 8-10 недель.

8. Прием лекарственных препаратов, обладающих тератогенным действием, полученных супругами перед зачатием или в первые недели беременности.

9. Перенесенные во время беременности инфекции, особенно в сроке до 18-20 недель: краснуха, грипп, корь, ветряная оспа, цитомегалия, токсоплазмоз, листериоз.

10. Работа на вредном производстве беременной женщины и ее мужа, рентгеновское обследование беременной женщины, особенно в первом триместре беременности.

11. Многоводие или маловодие при данной беременности.

12. Возраст беременной 37 лет и старше.

13. Кровнородственный брак.

14. На консультацию направляются мужчины, страдающие бесплодием, недоразвитием половых органов, вторичных половых признаков, с подозрением на синдром Клайенфельтера.

15. Направляются дети с задержкой умственного развития, задержкой роста, физического развития, судорожным синдромом, пороками развития, с подозрением на болезнь Дауна, скелетными дисплазиями.

16. Направляются беременные женщины, попавшие в группу риска по результату пренатального скрининга 1 триместра беременности, а также беременные женщины в любом сроке беременности с подозрением на порок развития у плода.

17.Направляются новорожденные дети, попавшие в группу риска по результату неонатального скрининга, с подозрением на врожденный гипотиреоз, фенилкетонурию, муковисцидоз, галактоземию, адреногенитальный синдром.

Консультирующимся необходимо иметь при себе направление лечебного учреждения, беременным дополнительно книжку беременной, выписку из протокола вскрытия мертворожденного или умершего ребенка (патологоанатомический диагноз), данные гистологического соскоба из полости матки при самопроизвольных выкидышах, данные группы крови и резус-фактора обоих супругов, данные сперматограммы мужа при бесплодном браке, амбулаторную карту ребенка или выписку из детской поликлиники.

I. Консультативный прием проводится ежедневно с 8-30 часов до 15-30 часов, кроме субботы и воскресенья. По направлениям из ЛПУ консультация проводится бесплатно, имеется предварительная запись на прием. На приеме врача-генетика осуществляется:

— диагностика наследственного заболевания у детей и взрослых пациентов с использованием компьютерных диагностических программ:

“ Оксфордская медицинская база данных”, баз международных регистров по наследственной и врожденной патологии.

— клинико-генеалогический анализ (составление и анализ родословной)

— консультирование детей с целью уточнения диагноза по результатам неонатального скрининга.

— консультирование беременных женщин с целью дородовой диагностики и прогноза потомства.

— Расчет индивидуального риска рождения ребенка с синдромом Дауна и другими хромосомными заболеваниями у беременной женщины с использованием компьютерной программы «Астрайа».

-Лечение больных с фенилкетонурией, расчет диетического питания использованием компьютерной программы «Диета ФКУ».

-Консультирование семей с бесплодным браком, невынашиванием беременности для исключения генетических причин.

-Диспансеризация больных с наследственными заболеваниями и врожденными пороками развития, ведение генетических регистров.

II Пренатальная (дородовая ) диагностика проводится на базе Медико-генетической консультации и включает в себя:

1 УЗ – исследование беременных женщин с целью подтверждающей диагностики ВПР у плода в I – III триместрах беременности.

2. Проведение допплерометрических исследований в сроке 24 и более недель беременности для диагностика фетоплацентарной недостаточности.

3. Исследование сывороточных маркеров РАРР-А (протеин А, ассоциированный с беременностью) и бетта ХГЧ (хорионический гонадотропин, свободная субъединица) в первом триместре беременности в режиме скрининга с расчетом генетического риска по хромосомной патологии у плода.

4. Инвазивная пренатальная диагностика (кордоцентез, плацентоцентез, хорионбиопсия) для исключения хромосомной патологии у плода – проводится беременным женщинам, попавших в группу риска по результату пренатального скрининга после предварительной консультации врача-генетика, где беременная получает полную информацию о предстоящей процедуре.

В медико-генетической консультации с целью пренатальной диагностики используется оборудование высокого и экспертного класса для выявления врожденных пороков развития у плода, фетоплацентарной недостаточности, диагностики гинекологических заболеваний:

1. УЗ-сканер «VOLUSON –Е8 » с функцией объемной реконструкции, 4D сканированием

2. УЗ-сканер «VOLUSON – 730 Pro V» цифровой сканер с функцией объемной реконструкции и 4D сканирование

III Лабораторные исследования в МГК проводятся по направлению врачей генетиков, а также врачей акушеров-гинекологов, педиатров и врачей других специальностей:

1.Исследование сыворотки крови у беременных женщин на маркеры врожденной патологии у плода:

А) РАРР-А (протеин А, ассоциированный с беременностью) и бетта ХГЧ (хорионический гонадотропин, свободная субъединица) в первом триместре беременности в режиме скрининга.

Б) альфафетопротеин (АФП), хорионический гонадотропин (ХГЧ), во втором триместре беременности по показаниям.

2.Проведение исследований с целью диагностики наследственных заболеваний у детей и взрослых:

— определение аминокислот и углеводов методом тонкослойной хроматографии (ТСХ),

— исследования натрия и хлора в поте на приборе «Нанодакт»

— исследование гликозоаминогликанов в моче,

— анализ мочи на аминоацидурию, кетокислоты, редуцирующие вещества,

— исследование глиадина в сыворотке крови.

Обследования проводятся для диагностики нарушения аминокислотного и углеводного обмена, при подозрении на дисплазию соединительной ткани, для уточнения синдрома мальабсорбции, муковисцидоза, целиакии.

  1. Массовый скрининг новорожденных на наследственные заболевания фенилкетонурию, врожденный гипотиреоз, галактоземию, муковисцидоз, адреногенитальный синдром.

Обследование проводится всем новорожденным детям, взятие крови из пятки ребенка на специальный тест-бланк осуществляется в родильном доме. Тест-бланк доставляется в лабораторию МГК, где проводится исследование. Новорожденные, попавшие в группу риска вызываются на прием к врачу-генетику для уточнения диагноза.

  1. Исследования сыворотки крови методом ИФА на инфекции у детей и взрослых:

— вирус простого герпеса, тип I, II, иммуноглобулин M, G

— цитомегаловирус, иммуноглобулин M, G, авидность

— вирус краснухи, иммуноглобулин M, G, авидность

— вирус Эпштейна-Барра, иммуноглобулин M, G

— токсоплазмоз, иммуноглобулин M, G, авидность

  1. Иммунно-аллергологические исследования сыворотки крови методом ИФА у детей и взрослых.

1.специфический иммуноглобулин Е ( пищевая, бытовая, грибковая панель)

2.антитела к гельминтам, лямблиям.

3.антитела к аскаридам

Лаборатория МГК оснащена современным, высококлассным оборудованием:

1. Иммунологическая лаборатория «Дельфия» с анализатором «Виктор» и комплектом специальных устройств – используется для проведения массового скрининга новорожденных на наследственные заболевания, ИФА анализов.

2. Иммунодиагностический анализатор “Делфия Экспресс” используется для пренатальной диагностики. Автоматический анализатор, позволяющий производить и выдавать результаты анализов в течение одного дня.

3. Анализатор флюорометрический Авто-Делфия используется для пренатальной диагностики.

3. «Нанодакт» — прибор для сбора и анализа проводимости пота — единственный в Брянской области области, используется для диагностики муковисцидоза.

Капустина Наталья Кондратьевна- стаж работы 43года.

Занимается консультированием пациентов с редкой наследственной патологией, невынашивания беременности , бесплодие, хромосоной патологией ,владеет навыками инвазивной пренатальной диагностики.

Образование :

В 1975году закончила 1-ый Московский медицинский институт им И.М. Сеченова, специальность «Лечебное дело». 1975-1976 год интернатура «Акушерство и гинекология» на базе Смоленского государственного медицинского института.

Профессиональная переподготовка:

В 1985 году прошла переподготовку « Наследственные болезни и медико-генетическое консультирование» ЦОЛИУВ г. Москва.

Повышение квалификаци:

2015 год по специальности «Генетика» на базе РМАПО МЗ РФ г. Москва

Смирнова Лилия Ивановна – стаж работы 56 лет .

Консультирует пациентов с редкой генетической патологией,невынашивая беременности , бесплодие, занимается лечением больных с фенилкетонурией ,

хромосомной патологией.

Образование: В 1962 году закончила Вороженский медицинский институт,специальность « Педиатрия»

Профессиональная переподготовка:

В 1977году переподготовка по специальности «Медицинская генетика»

На базе ЦОЛИУВ г. Москва

В 1997году « Вопросы клиники диагностики и лечение болезней неврной системы с медицинской генетикой» Смоленская государственная медицинская академия.

Повышение квалификации:

В 2016году прошла обучение на базе РАМПО МЗ РФ г. Москва по циклу «Генетика»

Величко Светлана Михайловна – стаж рабоы 24 года

Консультирет пациенто с генетической патологией, невынашиванием беременности , нервно-мышечными заболевания, хромосомной патологией

Образование: В 1994 году закончила Красноярский медицинский институт по специальности «Педиатрия».

1994-1995год интернатура по специальности « Педиатрия» на базе ГУЗ администрации края г. Красноярска.

Профессиональная переподготовка :

В 1998году по специальности «Генетика» на базе РМАПО МЗ РФ г. Москва.

Повышение квалификации:

В 2016году прошла обучение на базе РАМПО МЗ РФ г. Москва по циклу «Генетика»

Герасютина Елена Васильевна — стаж работы 21 год .

Консультирует пациентов с редкой генетической патологией ,хромосомной патологией, бесплодие,невынашивания беременности, муковисцидозом ,мукополисахаридозом.

Образование:

1991-1997г. обучение «Смоленская государственная медицинская академия»

1997-1998 год интернатура на базе Детской областной больницы г. Брянска по специальности «Педиатрия»

Профессиональная переподготовка

В 2001 году переподготовка на базе РМАПО МЗ РФ г. Москва по специальности

«Медицинская генетика»

Лоцманова Наталья Михайловна – стаж работы 19 лет

Вид образования

Год обучения

Название цикла, курса обучения

Номер и дата выдачи документа об образовании, наименование организации, выдавшей документ об образовании

интернатура

1999-2000

«Акушерство и гинекология»

№124 30. 06.2000г., г.Смоленск, СГМА кафедра акушерства и гинекологии при КБСМП

тематическое усовершенствование

2001

«Ультразвуковые исследования в акушерстве и гинекологии»

№559/20 10.05-06.06.2001г.

РМАПО г. Москвы

тематическое усовершенствование

2003

«Инвазивные методы пренатальной диагностики».

№1605 31.03-12.04.2003г.

Институт повышения квалификации ФУ МБ и ЭП при МЗ РФ г. Москвы

курс общего усовершенствования

2008

«Акушерство и гинекология»

№93/39 14. 01-09.02.2008г.

РМАПО г. Москвы

курс общего усовершенствования

2012

«Акушерство и гинекология»

№3436 22.10-17.12.2012г.

г. Смоленск, ФПК и ППС ГБОУ ВПО СГМА Минздрава России

тематическое усовершенствование

2013

«Вульвовагинальная патология и эстетика:диагностика,лечение, кольпоскопия и эстетическая коррекция»

№62/2013 15.04-27.04.2013г.

ФБГУ»Учебно-медицинский центр» Управления делами Президента РФ г. Москва

тематическое усовершенствование

2014

«Шейка матки и вульвовагинальные болезни»

СДО13 №001672

27. 02-01.03.2014г. факультет повышения квалификации медицинских работников РУДН

тематическое усовершенствование

2014

«Актуальные вопросы акушерства и гинекологии: диагностика, терапия и профилактика с позиции доказательной медицины»

СДО 14№003334,

Регистрационный номер 3334,

06-09.09.2017

Факультет повышения квалификации медицинских работников РУДН

Курс общего усовершенствования

2015

«Ультразвуковая диагностика»

№040000000272, регистрационный номер 1409, 12.05-08.06.2015г.

СГМУ

Курс общего усовершенствования

2017

«Акушерство и гинекология»

№180001323391, регистрационный номер 07-С/ 688. 19 05.06- 03.07.17

РМАНПО г. Москва

тематическое усовершенствование

2014

«Шейка матки и вульвовагинальные болезни»

СДО13 №001672

27.02-01.03.2014г. факультет повышения квалификации медицинских работников РУДН

тематическое усовершенствование

2014

«Актуальные вопросы акушерства и гинекологии: диагностика, терапия и профилактика с позиции доказательной медицины»

СДО 14№003334,

Регистрационный номер 3334,

06-09.09.2017

Факультет повышения квалификации медицинских работников РУДН

Курс общего усовершенствования

2015

«Ультразвуковая диагностика»

№040000000272, регистрационный номер 1409, 12. 05-08.06.2015г.

СГМУ

Курс общего усовершенствования

2017

«Акушерство и гинекология»

№180001323391, регистрационный номер 07-С/ 688.19 05.06- 03.07.17

РМАНПО г. Москва

тематическое усовершенствование

2018

«Пренатальная (дородовая) диагностика нарушений развития ребенка»

№060000124968, регистрационный номер 05-У/ 624.21 14.05- 26.05.17

РМАНПО г. Москва

Врач акушер-гинеколог медико-генетической консультации Лоцманова Наталья Михайловна работает в ГАУЗ «БКДЦ» с марта 2001 года по настоящее время.

Врач акушер-гинеколог Лоцманова Н.М. проводит приём беременных и гинекологических пациенток. В силу своей специальности много работает с семьями, имеющими отягощенный наследственный и акушерско-гинекологический анамнез (невынашивание беременности, бесплодие, урогенитальные инфекции, НМЦ, аменорея, АФС, миома, эндометриоз, гиперпластические процессы эндометрия, менопаузальный синдром, заболевания молочных желез ), занимается их обследованием, постановкой диагноза, лечением , а также подбором контрацепции, установкой и удалением внутриматочных контрацептивов.

Владеет ультразвуковым исследованием плода беременным женщинам с целью исключения врожденных пороков развития, допплерометрическими исследованиями маточно-плацентарного кровотока, трансвагинальными и трансабдоминальными исследованиями органов малого таза.

С 2003 года участвует в проведении инвазивной пренатальной диагностики ( хориоцентеза, плацентоцентеза ,кордоцентеза ) с целью исключения хромосомной патологии у плода, участвует в консилиуме по решению вопросов о прерывании беременности по медицинским показаниям.

Занимается ведением пациенток с патологией шейки матки, проводит расширенную кольпоскопию, взятие биопсии,лечение шейки матки при помощи радиоволновой хирургии, аргоноплазменной аблации.

Владеет методикой медикаментозного прерывания беременности. В 2008 году прошла обучающий семинар «Безопасный аборт», медикаментозное прерывание беременности с применением препарата «Пенкрофтон».

Ежегодно принимает участие в международных конференциях, конгрессах, семинарах и мастер-классах по вопросам диагностики, лечения и профилактике гинекологических воспалительных заболеваний, эндокринных нарушений, вопросам контрацепции.

Является членом Российского общества акушеров-гинекологов, ассоциации гинекологов-эндокринологов, членом ассоциации генетиков, Российской Ассоциации по генитальным инфекциям и неоплазии (РАГИН), состоит в Международном союзе по борьбе с инфекциями, передаваемыми половым путем (IUSTI).

Кробова Нина Петровна – стаж работы 32 года

Образование: В 1986 году заколнчила Курский ордена Трудового Красного Знамени госудаоственный медицинский институт, специальность «Лечебное дело» . 1986-1987год интернатура на базе Брянской областной больнице по специальности «Акушерство и гинекология». 1990-1992год ординатура на базе Курского медицинского института специальность « Акушерство и гинекология».

Профессиональная переподготовка:В 1997году переподготовка на базе РМАПО МЗ РФ г.Москва по специальности « Ультразвуковая диагностика».

Повышение квалификации : В 2014год прошла обучение на базе ГБОУ ВПО «СГМА» МЗ РФ по специальности « Ультрозвуковая диагностика».

Сертификат FMF получен в 2012году.

Исаревич Ольга Давидовна- стаж работы 21 год.

Образование: 1991-1997год обучение Смоленская государственная медицинская академия по специальности «Лечебное дело». 1997-1998г интернатура по специальности « Ультрозвуковая и функциональная диагностика» на базе Брянской областной больнице.

Первичная специализация в 2008году на базе СГМА специальность «Ультрозвуковая и функциональная диагностика» .

Повышение квалификации:

2014 год на базе ФМБА г. Москва цикл « Ультрозвуковая диагностика».

Сертификат FMFполучен в 2013году

Наши координаты: тел\факс 8 (4832) 71-51-34/71-51-21,

эл. почта: [email protected]

Наследственные заболевания — ДНК-диагностика — Центр Молекулярной Генетики

1 Аарскога-Скотта синдром FGD1 Наследственные синдромы 305400
2 Абиотрофия сетчатки, тип Франческетти ABCA4, ABCR, RMP Болезни органов зрения 248200
3 Адреногенитальный синдром CYP21A2, CYP21, P450C21, CYP21B, CA21H Патология эндокринных желез 201910
4 Азооспермия null null 415000
5 Айкарди-Гутьереса синдром ADAR, ADAR1, DRADA, IFI4, G1P1, RNASEh3B, DLEU8, FLJ11712, TREX1, DNase III null 225750
6 Акродерматит энтеропатический SLC39A4, ZIP4 Патология кожи и ее придатков, подкожной клетчатки и соединительной ткани, и лимфатической системы 201100
7 Аксенфельда-Ригера синдром PITX2, FOXC1, FKHL7, FREAC3, PTX2, RIEG1, RIEG, ARP1 null 180500
8 Альбинизм глазокожный TYR, OCA2 Болезни органов зрения 203100
9 Альстрема синдром ALMS1, KIAA0328 null 203800
10 Андерсена синдром null Заболевания сердечно-сосудистой системы и легких 170390
11 Анемия Даймонда-Блекфена RPS19 Болезни крови и иммунной системы 105650
12 Анеуплоидии null Хромосомная патология ———
13 Антли-Бикслера синдром null Наследственные синдромы 207410
14 Апера синдром null Наследственные синдромы 101200
15 Арта синдром PRPS1 Нервно-мышечные болезни 301835
16 Артрогрипоз дистальный (синдром Фримена-Шелдона) MYh4, MYHSE1 Скелетные дисплазии 193700
17 Атаксия Фридрейха FXN, FRDA, X25 null 229300
18 Атаксия, хорея, судороги и деменция ATN1 125370
19 Атрофия зрительного нерва Лебера null Болезни органов зрения 535000
20 Атрофия зрительного нерва с глухотой null Болезни органов зрения 125250
21 Аутоиммунный лимфопролиферативный синдром FAS, TNFRSF6, APT1, APO1, CD95 Болезни крови и иммунной системы 601859
22 Аутоиммунный полиэндокринный синдром null Болезни органов зрения 240300
23 Афазия первичная прогрессирующая GRN, PGRN, PEPI, GEP, PCDGF, GP88 null 607485
24 Ахондроплазия FGFR3, TACC3 null 100800
25 Баллера-Герольда синдром null null 218600
26 Банаян-Райли-Рувалькаба синдром PTEN, PTEN1, MMAC1 Наследственные синдромы 153480
27 Барта синдром null Заболевания сердечно-сосудистой системы и легких 302060
28 Беста болезнь BEST1, VMD2, TU15B Болезни органов зрения 153700
29 Бёрта-Хога-Дьюба синдром FLCN, FLCL, BHD Опухоли 135150
30 Блефарофимоз, обратный эпикант и птоз null null 110100
31 Блоха-Сульцбергера синдром IKBKG, NEMO, FIP3 Патология кожи и ее придатков, подкожной клетчатки и соединительной ткани, и лимфатической системы 308300
32 Блума синдром RECQL3, RECQ2, BLM null 210900
33 Боковой амиотрофический склероз VAPB, ALSIN, FIG4, ALS2, KIAA1563, SAC3, KIAA0274, DVAP33A Нервно-мышечные болезни 205100
34 Боуэна-Конради синдром EMG1, NEP1, C2F Наследственные синдромы 211180
35 Брахидактилия HOXD13, NOG, ROR2, HOX4I, NTRKR2 Скелетные дисплазии 113000
36 Бьёрнстада синдром BCS1L null 262000
37 Ваарденбурга синдром PAX3, HUP2 Наследственные синдромы 193500
38 Ваарденбурга-Шаха синдром EDNRB, ETB, ETBR Наследственные синдромы 277580
39 Ван дер Вуда синдром IRF6 Наследственные синдромы 119300
40 Велокардиофациальный синдром TBX1 Заболевания сердечно-сосудистой системы и легких 192430
41 Вильсона-Коновалова болезнь ATP7B Нейродегенеративные заболевания с поражением экстрапирамидной и мозжечковой систем и спастическая параплегия Штрюмпеля 277900
42 Вильямса синдром null Наследственные синдромы 194050
43 Вискотта-Олдрича синдром WAS, WASP Болезни крови и иммунной системы 301000
44 Врожденная нечувствительность к боли с ангидрозом NTRK1, TRK, TRKA Нервно-мышечные болезни 256800
45 Врожденной центральной гиповентиляции синдром PHOX2B, PMX2B, NBPHOX Заболевания сердечно-сосудистой системы и легких 209880
46 Галлервордена-Шпатца болезнь PANK2 Нейродегенеративные заболевания с поражением экстрапирамидной и мозжечковой систем и спастическая параплегия Штрюмпеля 234200
47 Гелеофизическая дисплазия null Скелетные дисплазии 231050
48 Гемофилия F8, F9, F8C, PTC Болезни крови и иммунной системы 306700, 306900
49 Генитопателлярный синдром null null 606170
50 Германски-Пудлака синдром HPS1 Наследственные синдромы 203300
51 Герстманна-Штреусслера-Шейнкера болезнь PRNP, PRP, PRIP null 137440
52 Гидроцефалия, обусловленная врожденнным стенозом Сильвиева водопровода L1CAM, MIC5, CAML1 null 307000
53 Гипер-IgD синдром MVK Болезни крови и иммунной системы 260920
54 Гипер-IgM синдром CD40LG, CD40L, CD154, TRAP, TNFSF5 Болезни крови и иммунной системы 308230
55 Гиперкалиемический периодический паралич SCN4A, NAV1. 4 Нервно-мышечные болезни 170500
56 Гипертрофическая кардиомиопатия CAV3, TNNT2 Заболевания сердечно-сосудистой системы и легких 192600
57 Гиперфенилаланинемия с дефицитом тетрагидробиоптерина GCh2, PTS, QDPR, PTPS, DHPR Наследственные болезни обмена веществ 261640
58 Гипокалиемический периодический паралич null null 170400
59 Гипофосфатемический рахит PHEX Скелетные дисплазии 307800
60 Гипохондроплазия null Скелетные дисплазии 146000
61 Гиппеля-Линдау синдром VHL null 193300
62 Глазо-зубо-пальцевой синдром null null 164200
63 Глаукома врожденная CYP1B1, P4501B1 Болезни органов зрения 231300
64 Глаукома ювенильная открытоугольная MYOC, TIGR Болезни органов зрения 137750
65 Гломеруоцитоз почек гипопластического типа HNF1B, TCF2, HNF2 Патология почек 137920
66 Грейга синдром GLI3 Наследственные синдромы 175700
67 Грисцелли синдром RAB27A, RAB27, RAM Болезни крови и иммунной системы+Наследственные синдромы+Нейродегенеративные заболевания с поражением экстрапирамидной и мозжечковой систем и спастическая параплегия Штрюмпеля 607624
68 Дауна синдром null Хромосомная патология 190685
69 Делеции хромосомы 1p36 синдром null Хромосомная патология 607872
70 Дефицит гормона гипофиза, комбинированный null null 262600
71 Дефицит иммуноглобулина A TNFRSF13B, TACI null 609529
72 Дефицит карнитина системный первичный SLC22A5, OCTN2 Наследственные болезни обмена веществ 212140
73 Дефицит фактора F12 null null 234000
74 Джексона-Вейсса синдром FGFR2, FGFR1, TK14, FLT2, FLG Пороки развития nullа, умственная отсталость, судороги 123150
75 Ди Джорджи синдром null Хромосомная патология 188400
76 Диастрофическая дисплазия SLC26A2, DTDST Скелетные дисплазии 222600
77 Дисплазия де ля Шапеля (Ателостеогенез) null Скелетные дисплазии 256050
78 Дистальная моторная нейропатия BSCL2, GARS, HSPB8, HSPB1,  IGHMBP2, TRPV4, SEIPIN, HSP22, h21, E2IG1, HSP27, CATF1, SMUBP2, VROAC, OTRPC4, TRP12 null 182960
79 Дистальная спинальная амиотрофия, врождённая с параличом диафрагмы null Нервно-мышечные болезни 604320
80 Дистальная спинальная амиотрофия, врожденная, непрогрессирующая null Нервно-мышечные болезни 600175
81 Дисхондростеоз Лери—Вейлля null null 127300
82 Дорфмана-Чанарина синдром null null 275630
83 Жильбера синдром UGT1A1, UGT1 null 143500
84 Жубер синдром NPHP1, NPh2 Нейродегенеративные заболевания с поражением экстрапирамидной и мозжечковой систем и спастическая параплегия Штрюмпеля 213300
85 Инверсия пола 46 XX SRY, TDF, TDY null 400045
86 Инверсия пола 46 XY NR5A1, FTZ1, FTZF1, SF1, AD4BP null 400044
87 Ихтиоз буллезный KRT2, KRT2A, KRT2E Патология кожи и ее придатков, подкожной клетчатки и соединительной ткани, и лимфатической системы+Нейродегенеративные заболевания с поражением экстрапирамидной и мозжечковой систем и спастическая параплегия Штрюмпеля 146800
88 Ихтиоз врожденный аутосомно-рецессивный TGM1, NIPAL4, ALOX12B, ICHYN, TGK null 242300
89 Ихтиоз вульгарный FLG Патология кожи и ее придатков, подкожной клетчатки и соединительной ткани, и лимфатической системы 146700
90 Ихтиоз, спастическая квадриплегия и умственная отсталость ELOVL4 null 614457
91 Кампомелическая дисплазия SOX9 null 114290
92 Карпентера синдром RAB23 Наследственные синдромы 201000
93 Кератита-ихтиоза-тугоухости синдром GJB2, CX26 Болезни органов зрения 148210
94 Клайнфельтера синдром null Хромосомная патология ——
95 Клиппеля-Фейля синдром GDF6, CDMP2 Скелетные дисплазии 118100
96 Коккейна синдром ERCC6, CSB Болезни органов зрения 133540
97 Комбинированный дефицит витамин K-зависимых факторов свертывания крови VKORC1, VKOR Болезни крови и иммунной системы 607473
98 Косолапость врожденная с или без дефицита длинных костей и/или зеркальной полидактилией null null 119800
99 Костелло синдром HRAS, HRAS1, RASh2, p21(RAS) Патология кожи и ее придатков, подкожной клетчатки и соединительной ткани, и лимфатической системы+Наследственные синдромы+Пороки развития nullа, умственная отсталость, судороги 218040
100 Костная гетероплазия прогрессирующая GNAS, GNAS1 Скелетные дисплазии 166350
101 Коудена болезнь null Тугоухость+Патология кожи и ее придатков, подкожной клетчатки и соединительной ткани, и лимфатической системы+Патология эндокринных желез+Наследственные синдромы+Опухоли+Болезни органов зрения 158350
102 Коффина-Лоури синдром RPS6KA3, RSK2, ISPK1, MAPKAPK1B Наследственные синдромы+Пороки развития nullа, умственная отсталость, судороги 303600
103 Кошачьего глаза синдром null Хромосомная патология 115470
104 Краниометафизарная дисплазия ANKH, GJA1, HANK, CX43 Скелетные дисплазии 123000
105 Краниосиностоз MSX2, TWIST1 Скелетные дисплазии 604757
106 Краниофациальной дисморфии-тугоухости-ульнарной девиации кистей синдром null Наследственные синдромы 122880
107 Крейтцфельда-Якоба болезнь null Нейродегенеративные заболевания с поражением экстрапирамидной и мозжечковой систем и спастическая параплегия Штрюмпеля 123400
108 Криглера-Найяра синдром null null 218800
109 Крузона с черным акантозом синдром null Наследственные синдромы 612247
110 Крузона синдром null Наследственные синдромы 123500
111 Лермитт-Дуклос болезнь null null 158350
112 Липодистрофия семейная частичная LMNA Патология кожи и ее придатков, подкожной клетчатки и соединительной ткани, и лимфатической системы 151660
113 Макла-Уэллса синдром NLRP3, CIAS1, NALP3, PYPAF1 Патология почек+Тугоухость 191900
114 Маклеода синдром XK, KX Болезни крови и иммунной системы 300842
115 Мандибулоакральная дисплазия с липодистрофией null Патология кожи и ее придатков, подкожной клетчатки и соединительной ткани, и лимфатической системы 248370
116 Маринеску-Шегрена синдром SIL1, BAP null 248800
117 Маршалла-Смита синдром NFIX, NF1A null 602535
118 Мевалоновая ацидурия null Наследственные болезни обмена веществ 610377
119 Мезомелическая дисплазия Лангера null null 249700
120 Метгемоглобинемия CYB5R3, DIA1, B5R Болезни крови и иммунной системы 250800
121 Метилглутаконовая ацидурия null Наследственные болезни обмена веществ 258501
122 Микрофтальм изолированный null Болезни органов зрения 613094
123 Микрофтальм с катарактой CRYBA4 Болезни органов зрения 610426
124 Микроцефалии с капиллярными мальформациями синдром 614261
125 Миллера-Дикера синдром PAFAh2B1, LIS1 Пороки развития nullа, умственная отсталость, судороги 247200
126 Милроя болезнь (лимфедема наследственная) FLT4, VEGFR3 Патология кожи и ее придатков, подкожной клетчатки и соединительной ткани, и лимфатической системы 153100
127 Миоклоническая дистония SGCE Нейродегенеративные заболевания с поражением экстрапирамидной и мозжечковой систем и спастическая параплегия Штрюмпеля 159900
128 Миопатия Миоши null null 613319
129 Миопатия с диспропорцией типов мышечных волокон ACTA1, SEPN1, SELN, ASMA Нервно-мышечные болезни 255310
130 Миотоническая дистрофия DMPK, ZNF9, DMK, CNBP1 Нервно-мышечные болезни 160900
131 Миотония Томсена/Беккера CLCN1, CLC1 Нервно-мышечные болезни 160800, 255700
132 Множественной эндокринной неоплазии второго типа (МЭН2) синдром null Патология эндокринных желез 171400, 162300
133 Множественные вывихи суставов, задержка роста, черепно-лицевые аномалии и врожденные пороки сердца B3GAT3, GLCATI Патология эндокринных желез 245600
134 Множественных птеригиумов синдром null null 265000
135 Множественных синостозов синдром NOG null 186500
136 Моуат-Вильсон синдром ZEB2, ZFHX1B, SMADIP1, SIP1, KIAA0569 Патология эндокринных желез+Болезни органов зрения 235730
137 Муковисцидоз CFTR, ABCC7 Заболевания сердечно-сосудистой системы и легких 219700
138 Мышечная дистрофия врождённая ITGA7 Нервно-мышечные болезни 613204
139 Мышечная дистрофия Дюшенна-Беккера DMD Нервно-мышечные болезни 310200
140 Мышечная дистрофия поясноконечностная SGCG, SGCA, POMT1, CAPN3, Нервно-мышечные болезни 253600
141 Мышечная дистрофия тип Фукуяма null Нервно-мышечные болезни 253800
142 Мышечная дистрофия Эмери-Дрейфуса null Нервно-мышечные болезни 310300, 181350
143 Мюнке синдром null null 602849
144 Накопления нейтральных липидов с миопатией болезнь null null 610717
145 Нанизм MULIBREY TRIM37, MUL, KIAA0898 Скелетные дисплазии 253250
146 Наследственная моторно-сенсорная нейропатия (болезнь Шарко-Мари-Тута) тип II
147 Наследственная моторно-сенсорная нейропатия (Шарко-Мари-Тута) тип I PMP22, EGR2, FGD4, GJB1, GDAP1, LITAF, MPZ, NDRG1, Sh4TC2, YARS, DNM2, MFN2, NEFL, GAS3, KROX20, FRABIN, CX32, P0, MPP, PROXY1, KIAA1985, TYRRS, YTS, YRS, DYN2, KIAA0214, NFL, NF68 Нервно-мышечные болезни 118200, 118210
148 Наследственная нейропатия с подверженностью параличу от сдавления null Нервно-мышечные болезни 162500
149 Наследственный амилоидоз TTR, TBPA Нейродегенеративные заболевания с поражением экстрапирамидной и мозжечковой систем и спастическая параплегия Штрюмпеля 105210
150 Наследственный ангионевротический отек C1NH, C1INH, SERPING1 Патология кожи и ее придатков, подкожной клетчатки и соединительной ткани, и лимфатической системы 106100
151 Незаращение родничков ALX4 Пороки развития nullа, умственная отсталость, судороги 609597
152 Нейромиотония и аксональная нейропатия HINT1 137200
153 Нейросенсорная несиндромальная тугоухость GJB3, GJB6, SLC26A4, CX31, CX30, PENDRIN, PDS Тугоухость 220290
154 Нейтропения тяжёлая врождённая ELANE, ELA2, NE, HNE, HLE Болезни крови и иммунной системы 202700
155 Некомпактного левого желудочка синдром null Заболевания сердечно-сосудистой системы и легких 300183
156 Немалиновая миопатия null null 161800
157 Нефронофтиз null Патология почек 256100
158 Нефротический синдром NPHS2, PDCN Патология почек 256300
159 Ниймеген синдром NBN, NBS1 Болезни крови и иммунной системы 251260
160 Ногтей-надколенника синдром LMX1B, LMX1. 2 Патология кожи и ее придатков, подкожной клетчатки и соединительной ткани, и лимфатической системы 161200
161 Нормокалиемический периодический паралич null Нервно-мышечные болезни 170600
162 Норри болезнь NDP, NORRIN Болезни органов зрения 310600
163 Окулофарингеальная мышечная дистрофия PABPN1, PAB2 Нервно-мышечные болезни 164300
164 Опица GBBB синдром MID1, MIDIN, FXY Патология эндокринных желез 300000
165 Ослера-Рендю-Вебера синдром ENG, CD105 null 187300
166 Остеолиз карпотарзальный, мультицентрический null null 166300
167 Остеопетроз рецессивный (мраморная болезнь костей) TCIRG1, ATP6V0A3 Скелетные дисплазии 259700
168 Охдо синдром, SBBYSS вариант KAT6B 603736
169 Паллистера синдром TBX3 Патология эндокринных желез 181450
170 Паллистера-Холла синдром null Патология эндокринных желез 146510
171 Патау синдром null Хромосомная патология ——
172 Пахионихия врожденная KRT6B, K6B, CK6B Патология кожи и ее придатков, подкожной клетчатки и соединительной ткани, и лимфатической системы 167210
173 Пейтца-Егерса синдром null null 175200
174 Первичная гипертрофическая остеоартропатия (пахидермопериостоз) HPGD, PGDh2, PGDH Патология кожи и ее придатков, подкожной клетчатки и соединительной ткани, и лимфатической системы 259100
175 Первичная легочная гипертензия BMPR2 Заболевания сердечно-сосудистой системы и легких 178600
176 Периодическая болезнь MEFV, PYRIN, MARENOSTRIN null 249100
177 Пигментная дегенерация сетчатки RP2, NRL, CA4, CA IV, D14S46E Болезни органов зрения 268000
178 Пикнодизостоз CTSK Патология эндокринных желез 265800
179 Пневмоторакс первичный спонтанный null Заболевания сердечно-сосудистой системы и легких 173600
180 Подколенного птеригиума синдром null Патология кожи и ее придатков, подкожной клетчатки и соединительной ткани, и лимфатической системы 119500
181 Полидактилия LMBR1, ZRS Скелетные дисплазии 174700, 174200
182 Понтоцеребеллярная гипоплазия VRK1 Нейродегенеративные заболевания с поражением экстрапирамидной и мозжечковой систем и спастическая параплегия Штрюмпеля 607596
183 Потоцки-Лупски синдром null Хромосомная патология 610883
184 Почечная аплазия/гипоплазия UPK3A, UPK3, UPIII Патология почек 191830
185 Проверка результатов NGS (МПС) null null
186 Прогерия Хатчинсона-Гилфорда null Патология кожи и ее придатков, подкожной клетчатки и соединительной ткани, и лимфатической системы 176670
187 Псевдоахондроплазия COMP, THBS5 Скелетные дисплазии 177170
188 Псевдоксантома эластическая ABCC6, ARA, MRP6 Патология кожи и ее придатков, подкожной клетчатки и соединительной ткани, и лимфатической системы 264800
189 Пфайффера синдром null Скелетные дисплазии 101600
190 Рабдомиолиз (миоглобинурия) LPIN1, PAP1, KIAA0188 Нервно-мышечные болезни 268200
191 Ретиношизис RS1 Болезни органов зрения 312700
192 Ретта синдром MECP2 Пороки развития nullа, умственная отсталость, судороги 312750
193 Робинова синдром null null 268310
194 Ротмунда-Томсона синдром null null 268400
195 Рубинштейна-Тейби синдром null Патология эндокринных желез 180849
196 Семейная периодическая лихорадка TNFRSF1A, TNFR1, TNFAR null 142680
197 Семейный гемофагоцитарный лимфогистиоцитоз PRF1, STX11, STXBP2, UNC13D, PFN1, UNC18B, MUNC18-2, MUNC13-4 Болезни крови и иммунной системы 267700
198 Семейный медуллярный рак щитовидной железы null Патология эндокринных желез+Опухоли 155240
199 Семейный холодовой аутовоспалительный синдром null Патология кожи и ее придатков, подкожной клетчатки и соединительной ткани, и лимфатической системы 120100
200 Сениора-Локена синдром null null 266900
201 Сенсорная полинейропатия (врожденная нечувствительность к боли) NGF, WNK1, NGFB, PSK, PRKWNK1, KDP Нервно-мышечные болезни 608654, 201300
202 Септо-оптическая дисплазия HESX1, RPX Болезни органов зрения 182230
203 Сетре-Чотзена синдром HESX1 Патология эндокринных желез 101400
204 Симпсона-Голаби-Бемель синдром GPC3 Патология эндокринных желез 312870
205 Синдром CINCA null Патология эндокринных желез 607115
206 Синдром CRASH null null 303350
207 Синдром ESC NR2E3, PNR Патология эндокринных желез 268100
208 Синдром MASA null null 303350
209 Синдром RAPADILINO null null 266280
210 Синдром TAR RBM8A, RBM8 Патология эндокринных желез 274000
211 Скапулоперонеальная миопатия FHL1, SLIM1 null 300695
212 Смит-Магенис синдром null Патология эндокринных желез 182290
213 Смита-Лемли-Опица синдром DHCR7 Патология эндокринных желез 270400
214 Спинальная амиотрофия типы I, II, III, IV SMN1, SMNT, SMN, T-BCD541 Нервно-мышечные болезни 253300
215 Спинальная и бульбарная амиотрофия Кеннеди AR, DHTR, NR3C4 Нервно-мышечные болезни 313200
216 Спиноцеребеллярная атаксия ATXN1, ATXN2, ATXN3, ATXN7, ATXN8, AT3, MJD1, SCA3 Нейродегенеративные заболевания с поражением экстрапирамидной и мозжечковой систем и спастическая параплегия Штрюмпеля 164400
217 Спонгиоформная энцефалопатия с нейропсихическими проявлениями null Пороки развития nullа, умственная отсталость, судороги 606688
218 Спондилокостальный дизостоз DLL3 Скелетные дисплазии 277300
219 Спондилоэпифизарная дисплазия (SEDT) TRAPPC2, SEDL Скелетные дисплазии 313400, 183900
220 Суперактивность фосфорибозилпирофосфат синтетазы null Наследственные болезни обмена веществ 300661
221 Тестикулярной феминизации синдром null null 300068
222 Торсионная дистония PRRT2, SPR, TOR1A, DYT1 Нейродегенеративные заболевания с поражением экстрапирамидной и мозжечковой систем и спастическая параплегия Штрюмпеля 128100
223 Трихоринофалангеальный синдром TRPS1 Патология эндокринных желез 190350
224 Тричера Коллинза-Франческетти синдром TCOF1, TREACLE Патология эндокринных желез 154500
225 Тромбоцитопения врожденная MPL, TPOR, MPLV Болезни крови и иммунной системы 604498
226 Унферрихта-Лундборга болезнь CSTB, STFB null 254800
227 Уокера-Варбург синдром null null 236670
228 Ушера синдром null null 276900
229 Фатальная семейная инсомния null null 600072
230 Фенилкетонурия PAH Наследственные болезни обмена веществ 261600
231 Фибродисплазия оссифицирующая прогрессирующая ACVR1, ACVRLK2, ALK2 Скелетные дисплазии 135100
232 Фокальная кожная гипоплазия (Горлина-Гольца синдром) null null 305600
233 Х-сцепленная агаммаглобулинемия CYBB Болезни крови и иммунной системы 300300
234 Х-сцепленный лимфопролиферативный синдром Sh3D1A, XIAP, SAP, BIRC4, API3, MIHA Болезни крови и иммунной системы 308240
235 Х-сцепленный моторный нистагм FRMD7 Болезни органов зрения 310700
236 Х-сцепленный тяжелый комбинированный иммунодефицит IL2RG, CD132 Болезни крови и иммунной системы 300400
237 Хайду-Чейни синдром null null 102500
238 Хондродисплазия метафизарная тип Мак-Кьюсика RMRPR, RMRP Скелетные дисплазии 250250
239 Хондродисплазия точечная Конради-Хюнермана EBP Скелетные дисплазии 302960
240 Хондрокальциноз null Скелетные дисплазии 118600
241 Хореоатетоз, гипотиреоидизм и неонатальная дыхательная недостаточность NKX2-1, TITF1, TTF1 null 610978
242 Хорея Гентингтона HTT, IT15 Нейродегенеративные заболевания с поражением экстрапирамидной и мозжечковой систем и спастическая параплегия Штрюмпеля 143100
243 Хорея доброкачественная наследственная null null 118700
244 Хороидермия CHM, REP1, GGTA Болезни органов зрения 303100
245 Хроническая гранулематозная болезнь CYBB, NOX2 Болезни крови и иммунной системы 306400
246 Центронуклеанарная миопатия MTM1 Нервно-мышечные болезни 310400
247 Цереброокулофациоскелетный синдром null Скелетные дисплазии+Патология эндокринных желез 214150
248 Цистиноз нефропатический null null 219800
249 Швахмана-Даймонда синдром SBDS null 260400
250 Шегрена-Ларссона синдром ALDh4A2 null 270200
251 Шерешевского-Тернера синдром null Хромосомная патология ——
252 Шпринтцена-Гольдберга синдром SKI null 182212
253 Штаргардта болезнь null null 248200
254 Эдвардса синдром null Хромосомная патология ——
255 Экссудативная витреохореоретинальная дистрофия null Болезни органов зрения 305390
256 Эктодермальная дисплазия EDA, EDAR, EDARADD, EDA1, ED1, EDA1R Патология кожи и ее придатков, подкожной клетчатки и соединительной ткани, и лимфатической системы 305100
257 Элерса-Данло синдром null Патология кожи и ее придатков, подкожной клетчатки и соединительной ткани, и лимфатической системы 225400
258 Эпилепсия прогрессирующая миоклоническая KCTD7 null 611726
259 Эпифизарная дисплазия, множественная null Скелетные дисплазии 226900
260 Эритрокератодермия GJB4, CX30. 3 Патология кожи и ее придатков, подкожной клетчатки и соединительной ткани, и лимфатической системы 133200
261 Эритроцитоз рецессивный null null 263400
262 Эскобара синдром CHRNG, ACHRG Патология эндокринных желез 265000

Пренатальный скрининг в Иркутске, цена в Medical On Group

Пренатальное тестирование представляет собой комплексное исследование, которое проводится для своевременного выявления генетической патологии развивающегося плода. Такой скрининг может включать в себя проведение УЗИ, определение биохимических показателей и генетическое исследование.

Пренатальный скрининг должны проходить все женщины, потому как хромосомные мутации могут возникнуть, даже если будущие родители ребенка совершенно здоровы. Если у семейной пары значительно повышен риск появления ребенка с хромосомными перестройками, то такое исследование должно проводиться в обязательном порядке. Это позволяет вовремя выявить патологию и принять соответствующее решение.

Факторами риска, которые влияют на появление ребенка с хромосомными мутациями, являются:

  • Наличие определенных генетических отклонений у самих родителей;
  • Наличие в роду наследственных заболеваний;
  • Возраст будущих родителей;
  • Воздействие на организм женщины мутагенных факторов, особенно в период зачатия и на первых неделях беременности;
  • Выкидыши, мертворождения и случаи замершей беременности у женщины.

Проведение генетического скрининга

Для проведения исследования на наличие хромосомных мутаций плода у матери берется небольшое количество крови из вены. В условиях лаборатории из крови выделяется ДНК плода, которая в небольших количествах присутствует с первых недель беременности. Чувствительность современного оборудования и запатентованные технологии позволяют проводить анализ даже по такому небольшому количеству генетического материала.

Исследование занимает несколько рабочих дней. После этого результат выдается в виде экспертного заключения, в котором с 99% вероятностью указано, обнаружена ли хромосомная аномалия у будущего ребенка.

При обнаружении одного из этих симптомов семейная пара должна принять взвешенное решение либо о прерывании этой беременности, либо о рождении ребенка с хромосомной патологией. Если же ни одно из этих заболеваний не обнаружено, будущие родители могут быть спокойны за судьбу своего малыша.

Генетическое определение пола ребенка

Кроме выявления хромосомных нарушений проведение генетического анализа позволяет определить пол будущего ребенка на ранних сроках, когда ни один другой анализ или исследование еще не может достоверно ответить на волнующий многих родителей вопрос: «Мальчик или девочка?».

Начиная с 8 недель беременности уровень ДНК плода в крови матери становится достаточным, для того чтобы провести этот анализ. При выявлении Y хромосомы можно сделать заключение о том, что родится мальчик, так как именно в этой хромосоме заложены все признаки мужского пола. Если такой хромосомы не обнаружено, на свет появится девочка.

Новости — Правительство России

1 июня 2021 14:15 Москва, НМИЦ АГП имени В.И.Кулакова

М.Мишустин:«Неонатальный скрининг на пять заболеваний у нас включен в Программу государственных гарантий бесплатного оказания гражданам медицинской помощи. Теперь мы расширим его до 36 заболеваний».

Вступительное слово Михаила Мишустина

Сообщение директора института репродуктивной генетики НМИЦ АГП имени В.И.Кулакова Дмитрия Трофимова

Сообщение министра здравоохранения Михаила Мурашко

Сообщение заведующего филиалом «Перинатальный центр» ГКБ №24  Антона Оленева

Сообщение анестезиолога-реаниматолога детской реанимационной бригады скорой медицинской помощи Сергея Черникова

Сообщение директора ФГБНУ «Медико-генетический научного центра» Сергея Куцева 

Сообщение начальника Центра детской психоневрологии, заведующей отделением психоневрологии и психосоматической патологии ФГАУ «Национальный медицинский исследовательский центр здоровья детей» Людмилы Кузенковой

Заключительное слово Михаила Мишустина

Из стенограммы:

Москва, НМИЦ АГП имени В. И.Кулакова

Вступительное слово Михаила Мишустина на совещании о совершенствовании медицинской помощи детям

М.Мишустин: Добрый день, уважаемые коллеги, дорогие друзья! 1 июня – особый день в нашей стране, мы отмечаем Международный день защиты детей. Это и ваш праздник. Ведь врачи, медсёстры, другие медицинские работники не только заботятся о здоровье и жизни детей, их матерей, но и являются их настоящими защитниками. Хочу вас от всей души с этим праздником поздравить.

Сегодня мы встречаемся со специалистами, которые работают в разных регионах нашей страны, выполняют сложнейшие операции, используя самые передовые высокотехнологичные методики, делают всё возможное для своих маленьких пациентов и их мам.

Участники совещания

  • Список участников совещания по совершенствованию медицинской помощи детям, 01 июня 2021 года

Человека, который спас чью-то жизнь, называют героем, а для вас это повседневная работа, которая требует не только отличной профессиональной подготовки, но и большого человеческого сердца и, конечно, очень много душевных сил. Спасибо за ваш труд, я желаю не останавливаться на достигнутом, уверен, впереди у вас ещё много успехов.

Сегодня мы с вами обсудим, что необходимо сделать для совершенствования медицинской помощи, в первую очередь маленьким пациентам. Сейчас специализированную помощь дети уже получают в 236 детских больницах. Строительство пяти из них было завершено в прошлом году, несмотря на распространение коронавирусной инфекции и ограничения, которые, к сожалению, присутствовали в том числе и в строительстве. В этом году ещё семь детских больниц мы планируем ввести в строй.

Поставлено свыше 19 тыс. единиц нового оборудования в детские поликлиники за два года. По всей стране работают более 1,5 тыс. родильных домов и отделений, а также 94 перинатальных центра, 56 из которых были построены на федеральные средства, остальные – региональные. Матерям и новорождённым оказывают высокотехнологичную помощь в самых сложных случаях. Выхаживают детей с очень низкой массой тела. Мы сегодня подробно говорили с врачами, которые непосредственно на передовом крае сегодня оказывают эти услуги. Врачи спасают женщин, чьи жизнь и здоровье оказались под угрозой во время беременности и родов.

В значительной степени благодаря специалистам перинатальных центров даже в год пандемии нам удалось существенно снизить младенческую смертность. И у нас, и за рубежом это один из ключевых критериев оценки эффективности медицинской помощи в целом в стране. Сейчас показатель в два раза ниже, чем 15 лет назад. Только в прошлом году удалось сохранить на 12% больше жизней младенцев, чем годом ранее, а это сотни маленьких детишек.

Важно и дальше улучшать эти показатели, своевременно отрабатывать и внедрять в широкую практику передовые медицинские технологии. В Центре имени Кулакова, который мы только что осмотрели, уделяют этому вопросу самое серьёзное внимание. Здесь ежегодно повышают квалификацию и осваивают современные методики свыше двух с половиной тысяч врачей.

Совещание по совершенствованию медицинской помощи детям

1 июня 2021

Совещание по совершенствованию медицинской помощи детям

1 июня 2021

Предыдущая новость Следующая новость

Совещание по совершенствованию медицинской помощи детям

Специалисты центра консультируют коллег по всей России. Благодаря теперь ещё и возможностям телемедицины они находятся на постоянной связи почти с сотней перинатальных центров во всех регионах (сегодня нам об этом подробно рассказывали), делятся знаниями и опытом.

Совместно с вами мы продолжим принимать меры, чтобы обеспечить лучшую медицину маленьким гражданам нашей страны. Сейчас у нас идёт четвёртый год Десятилетия детства, которое проходит по инициативе Президента России. Утверждённый Правительством план его основных мероприятий включает целый блок мер, которые направлены на укрепление здоровья детей, и главным приоритетом здесь является своевременное выявление заболеваний и их лечение на ранней стадии. Для этого, конечно, необходимо расширять (тоже сегодня об этом подробно говорили) неонатальный скрининг.

Уже 15 лет большинство малышей сразу после рождения в роддоме бесплатно обследуют на пять наследственных заболеваний. За всё время такие тесты прошли более 20 миллионов детей. Заболевания выявлены примерно у 15 тысяч. И ранняя диагностика серьёзно помогла вовремя назначить им лечение, остановить болезнь или её тяжёлые последствия.

Возможности медицины постоянно растут. Появляются новые тесты, новые методики, новые технологии. И методики скрининга после родов должны включать гораздо большее число заболеваний. Считаю необходимым в разы расширить его и у нас. Это позволит существенно снизить младенческую смертность, дополнительно спасать около тысячи детей ежегодно.

Будем обследовать малышей сразу же после рождения. Понятно, что такое нововведение потребует существенных финансовых вложений. Но речь идёт о здоровье и будущем детей, и, мне кажется, ничего важнее для нас быть не может.

Уважаемые коллеги! Хотел бы послушать ваши мнения и предложения, в том числе по расширению скрининга. Как вообще лучше выстроить эту работу, чтобы она была максимально эффективной.

Давайте приступим к обсуждению. Хочу попросить выступить Дмитрия Юрьевича Трофимова – директора Института репродуктивной генетики центра Кулакова. Пожалуйста.

Д.Трофимов (директор института репродуктивной генетики НМИЦ АГП имени В. И.Кулакова): Уважаемый Михаил Владимирович, уважаемая Татьяна Алексеевна, дорогие коллеги!

Как уже было отмечено, благодаря достижениям системы здравоохранения в последние годы младенческая детская смертность в России неуклонно снижается. Однако есть факторы, которые объективно ограничивают эту тенденцию, и один из них – это наследственные заболевания.

По данным Всемирной организации здравоохранения, около 2,5% детей рождаются с пороками и нарушениями различной степени тяжести и при этом ориентировочно каждый пятый случай, то есть один на 200 новорождённых, обусловлен генетическими нарушениями, среди которых преобладают хромосомные аномалии и моногенные заболевания.

Таким образом, действительно совершенствование мер ранней генетической диагностики и профилактики наследственных заболеваний и в первую очередь расширение неонатального генетического скрининга является одной из самых приоритетных задач.

В России неонатальный скрининг начали проводить с 1993 года, тогда это было всего два заболевания. С 2006-го и по настоящее время скрининг проводится на пять генетических нарушений, что позволяет выявлять около тысячи детей ежегодно, благодаря чему возникает основа для проведения своевременной ранней профилактики и терапии.

В то же время с развитием методов, технологий диагностики сейчас есть возможность расширения этого списка. Более того, уже реализован ряд пилотных проектов, в частности, в Москве, в Приморском крае. Получены очень обнадёживающие результаты, и этот опыт необходимо распространить на всю страну.

Если говорить о международном опыте в этой области, то в более половины стран Европы, во всех штатах США на сегодняшний день уже проводится расширенный генетический скрининг.  В частности, в Штатах в зависимости от конкретной территории новорождённые обследуются на наличие от 30 до 50 заболеваний.

Таким образом, в настоящий момент есть все необходимые предпосылки и необходимо нынешний текущий вариант скрининга расширить от пяти заболеваний до 36 в основном за счёт внедрения тандемной масс-спектрометрии. Список заболеваний приведён на представленном слайде. Я не буду подробно останавливаться.

Реализация данных мер позволит снизить младенческую смертность по крайней мере на 15%. При этом за десять лет будет сохранено более девяти тысяч детских жизней. Семьи смогут при дальнейшем планировании семьи получить необходимую квалифицированную медико-генетическую помощь. Также снизится нагрузка на стационары, отделения реанимации.

Если говорить о будущем, о дальнейших шагах, то развитие неонатального генетического скрининга в дополнение к масс-спектрометрии, безусловно, связано с геномным анализом, с геномными технологиями. И если первый геном человека, который был опубликован в 2003 году, исследовался большим консорциумом из десятков лабораторий в течение более 10 лет и на это было потрачено около 3 млрд долларов, то современные технологии, в частности высокопроизводительное секвенирование (его ещё называют NGS), значительно снизили, во-первых, стоимость. Кроме того, время исследования тоже существенно снизилось – это одна-две недели.

Интересно отметить, что если мы возьмём области генома, которые кодируют молекулы белка, то окажется, что это менее 2% от общего генома, но именно изменения в этих областях обуславливают более 95% всех клинически значимых состояний, связанных с генетикой. Почему это важно отметить? Потому что именно на анализе экзома, этой части, сейчас фокусируется внимание медгенетиков и молекулярных генетиков, работающих в области медицины, поскольку это позволяет оптимально сочетать финансовые затраты и получение максимума информации, необходимой для медицины. И если мы говорим о стоимости экзомного исследования, то на сегодняшний день это всего лишь порядка 300 долларов, то есть это цены уже вполне доступные.

Какие могут быть перспективы? На сегодняшний день в международных базах описано более 4 тыс. генов, связанных с заболеваниями различной степени тяжести. И из этих заболеваний около тысячи перспективны для неонатального скрининга методом экзомного секвенирования.

Но, безусловно, тут есть ряд вопросов, которые ещё необходимо решить, и требуется проведение пилотных проектов. В частности, нам бы очень хотелось, чтобы такой пилотный проект был реализован у нас в центре. Мы оснащены всем необходимым современным оборудованием для проведения подобных геномных исследований. Это оборудование позволяет делать до 10 тыс. экзомов в год. Есть квалифицированный персонал, обладающий необходимыми компетенциями, и необходимые вычислительные, компьютерные мощности. Если удастся этот проект реализовать (мы уже начали работу по оценке эффективности комплексного неонатального скрининга, сочетающего в себе первичный осмотр, стандартный, масс-спектрометрию и как раз высокопроизводительное секвенирование), то в течение ближайшего года – полутора лет мы могли бы сделать пилотный проект по исследованиям до 10 тысяч новорождённых.

В заключение ещё раз подчеркну, что совершенствование неонатального скрининга является одной из ключевых задач, одним из ключевых направлений. Уже сегодня необходимо расширение скрининга с 5 до 36 заболеваний на основе масс-спектрометрии прежде всего, и для дальнейшего развития необходимо развитие геномных технологий.

М.Мурашко: На сегодняшний день основные задачи, которые стоят перед здравоохранением по снижению младенческой смертности, крупные, организационные все реализованы. Сегодня, когда у нас одни из самых низких в мире показателей, чтобы нам изменить ситуацию к лучшему, продолжать работу по снижению младенческой заболеваемости и инвалидности, необходимо внедрять в том числе технологии неонатального скрининга. Я считаю, что его надо поддержать. И пилотный проект по полногеномному секвенированию – мы с Геннадием Тихоновичем (Сухих) обсудили. Он поддержан, подготовлен, с Министерством здравоохранения согласован. Этот пилотный проект по полногеномному секвенированию в этом году будет реализован в центре.

Мы обсуждаем это в том числе и в связи с подходами для прогнозирования тех или иных заболеваний у новорождённых, включая развитие злокачественных заболеваний, обменных и ряда других. Сегодня служба движется по пути персонализации. Мы каждую беременную с этого года включаем в определённое информационное сопровождение, в том числе в  систему прогнозирования развития того или иного заболевания. Использование современных методов тандемной масс-спектрометрии мы можем реализовать со следующего года, если поддержим это направление.

М.Мишустин: Спасибо.

Коллеги, всё, что вы сказали, очень важно. Расширение скрининга потребует модернизации оборудования, финансовых инвестиций в соответствующие технологии, изменения логистики, маршрутизации внутри региона, обучения людей.

Сегодня здесь присутствуют специалисты со всей страны. Я бы хотел предоставить слово вначале Антону Сергеевичу Оленеву, директору филиала «Перинатальный центр» больницы №24 города Москвы.

А.Оленев (главный внештатный специалист по акушерству и гинекологии, заведующий филиалом «Перинатальный центр» ГКБ №24 г.Москвы): Уважаемый Михаил Владимирович! Уважаемые Татьяна Алексеевна, Михаил Альбертович, коллеги!

Во-первых, хотел поблагодарить за это совещание и сказать, что на сегодняшний день есть уникальные возможности, в том числе прогнозирования. Возможно, начать осваивать те методики, которые есть, но необходимо рассмотреть их внедрение ещё с момента планирования беременности, с момента ведения и наблюдения беременности. Возможности, которые есть у пренатальной диагностики, дородовой, реализованы в рамках пилотного проекта в условиях Москвы и позволили обнаружить хромосомные аномалии ещё на этапе ведения беременности – это так называемый неинвазивный пренатальный тест. Результаты впечатляют и позволяют нам говорить о том, что эта технология возможна и необходима для более тщательного изучения и для рассмотрения более широкого внедрения не только на уровне региона, но и на уровне всей страны. 

М.Мишустин: Спасибо.

Здесь присутствует Сергей Николаевич Черников из Воронежа – врач-анестезиолог, специалист, который хотел два слова сказать. Пожалуйста, уважаемый Сергей Николаевич.

С.Черников (анестезиолог-реаниматолог детской реанимационной бригады скорой медицинской помощи, г.Воронеж): Добрый день всем!

В Воронеже строится один из крупнейших центров по онкогематологической патологии. Это корпус областной детской больницы. Конечно, небольшие коррективы коронавирусная инфекция вносит в его строительство, но мы надеемся на дальнейшую поддержку федеральных властей, и все структурные подразделения будут введены вовремя. Естественно, будет дополнительно обучаться персонал. Всё это позволит в дальнейшем оказывать интенсивную помощь детям с такой серьёзной патологией, как онкогематологические заболевания.

М.Мишустин: Коллеги, кто хотел бы ещё что-то добавить?

С.Куцев (директор ФГБНУ «Медико-генетический научный центр, главный внештатный специалист по медицинской генетике Минздрава России): Два слова, Михаил Владимирович, по поводу скрининга. Мы, врачи-генетики, очень давно ждали этого расширения и говорили о его необходимости. И, конечно, очень рады тому, что мы сможем выявлять пациентов на очень ранней, досимптоматической стадии, что обеспечит, по сути, сохранение здоровья для многих из них. Это позволит избежать инвалидизации и смерти.

Хотел сказать, что скрининг осуществляется медико-генетической службой, консультациями медико-генетическими и центрами, которые в Российской Федерации, и, конечно, очень важно, чтобы скрининг охватил всю страну. Я имею в виду общепринятый метод тандемной масс-спектрометрии, например, или скрининг на спинальную мышечную атрофию. Тогда это будет иметь действительно хороший результат, тогда это будут тысячи спасённых жизней.

Очень важны организационные меры, поскольку скрининг – это не только лабораторное исследование. Там есть преаналитический этап и, самое главное, постаналитический этап, то есть что будет дальше с выявленными пациентами. Мы как врачи-генетики всегда отслеживаем их судьбу, и здесь, конечно, нужны организационные мероприятия.

Мы сейчас создаём междисциплинарную рабочую группу, куда войдут врачи очень разных специальностей, для того чтобы мы не только выявляли, но и максимально эффективно оказывали медицинскую помощь выявленным пациентам, отслеживали, мониторировали их здоровье, для того чтобы эффект от внедрённого скрининга был очевиден. Мы абсолютно уверены в том, что этот клинический эффект будет очевиден для всех.

Л.Кузенкова (начальник Центра детской психоневрологии, заведующая отделением психоневрологии и психосоматической патологии ФГАУ «Национальный медицинский исследовательский центр здоровья детей»): Уважаемые коллеги, Михаил Владимирович! Я хотела бы отдельно остановиться на проблеме спинально-мышечной атрофии.

Очень болевая точка. Действительно, к ней приковано огромное внимание и общественности, и врачей. Очень тяжёлое заболевание, быстро прогрессирующее, инвалидизирующее, и дети, к сожалению, очень быстро погибают.

Поэтому, конечно, очень бы хотелось, чтобы в том числе в скрининг вошли и эти пациенты, тем более что в Москве проведён сейчас с Медико-генетическим научным центром им. Бочкова, на мой взгляд, прекрасный пилотный проект. Было обследовано 15 800 детей. Два ребёнка выявлено в пресимптоматической стадии.

Конечно, если мы начинаем их лечить в пресимптоматической стадии, мы получаем, по сути, здоровых людей: они могут работать, у них сохранный интеллект, они могут создавать семьи. Это совершенно другое качество жизни.

И я, конечно, была бы очень признательна, если бы это тоже вошло бы в скрининг.

В среднем такое количество детей в год по нашей стране будет примерно 200–210 человек. Таким образом, этот вопрос, мне кажется, вполне можно было бы тоже обдумать.

М.Мурашко: Да, эта диагностика поможет, поскольку сегодня мы обеспечиваем уже около тысячи детей лекарственными препаратами для этого заболевания. И два препарата ещё в том числе сейчас проходят и клиническую апробацию, и регистрацию, то есть мы расширяем.

В принципе всё это ложится в одну единую концепцию.

М.Мишустин: Уважаемые коллеги! Во-первых, хочу вас всех поблагодарить за содержательный разговор.

Мы обсудили сегодня крайне важные темы. Это в первую очередь жизнь и здоровье детей, их мам и пап. Решения, на которые мы выходим по итогам сегодняшнего совещания, должны быть оперативно оформлены.

Попрошу Министра здравоохранения буквально в ближайшее время оформить всё это в соответствующие поручения, протоколы. И хочу попросить также, чтобы Министерство финансов подготовило все необходимые предложения по финансированию мероприятий.

В первую очередь речь идёт о предложениях по расширению неонатального скрининга с учётом сегодняшнего обсуждения.

Неонатальный скрининг на пять заболеваний у нас включен в Программу государственных гарантий бесплатного оказания гражданам медицинской помощи. Теперь мы расширим его до 36 заболеваний.

Прошу Министерство здравоохранения совместно с коллегами из других заинтересованных ведомств проработать все необходимые вопросы в короткие сроки. В том числе провести анализ возможностей материально-технической базы регионов по этому вопросу и предусмотреть на эти цели необходимое финансирование.

Министерство промышленности и торговли попрошу проработать вопрос организации производства соответствующих реагентов для скрининга и представить соответствующие предложения, потому что одна из самых затратных частей – это технология.

Мы также должны детально проанализировать все идеи, которые сегодня прозвучали, и использовать их в работе.

Сегодня, когда мы с Геннадием Тихоновичем смотрели операционные, он очень скромно заговорил о роботе «Да Винчи», который ему необходим, назвав это специализированным робототехническим рабочим местом.

Я знаю, что у нас примерно 25 всего роботов. Будет 26-й. Но робот «Да Винчи» – это не только финансы. Я знаю, что он дорого стоит. Мы решим этот вопрос, соответствующее поручение дано. Мы как раз переговорили с Михаилом Альбертовичем. Мы найдём средства и приобретём это для Центра Кулакова, для детишек. Но здесь важно – как центру компетенций, потому что на «Да Винчи» работать непросто, и, без сомнения, специалисты высочайшего уровня, которые в вашем центре работают, должны получить этот автомат.

Надеюсь, что ещё больше детишек будут живы-здоровы и ещё больше мам и пап, счастливых, будут приходить сюда с ними  на праздник 1 июня.

Спасибо Вам, уважаемый Геннадий Тихонович.

Г.Сухих (директор НМИЦ АГП имени В.И.Кулакова): Спасибо огромное. Это истинный подарок. И спасибо за то, что нашли возможность побывать в нашем центре. Для нас это огромная честь. Полагаю, что мы не подведём.

Пренатальные генетические скрининговые тесты | АКОГ

Амниоцентез : Процедура, при которой амниотическая жидкость и клетки берутся из матки для исследования. В ходе процедуры используется игла для забора жидкости и клеток из мешочка, в котором находится плод.

Анеуплоидия: Наличие аномального числа хромосом. Типы включают трисомию, при которой имеется лишняя хромосома, или моносомию, при которой хромосома отсутствует. Анеуплоидия может затронуть любую хромосому, включая половые хромосомы.Синдром Дауна (трисомия 21) — распространенная анеуплоидия. Другими являются синдром Патау (трисомия 13) и синдром Эдвардса (трисомия 18).

Проверка на носительство: Тест, проводимый на человеке без признаков или симптомов, чтобы выяснить, является ли он носителем гена генетического заболевания.

Бесклеточная ДНК: ДНК из плаценты, которая свободно перемещается в крови беременной женщины. Анализ этой ДНК можно проводить в качестве неинвазивного пренатального скринингового теста.

Клетки: Наименьшие единицы структуры тела.Клетки являются строительными блоками для всех частей тела.

Отбор проб ворсин хориона (CVS) : Процедура, при которой небольшой образец клеток берется из плаценты и исследуется.

Хромосомы : Структуры, расположенные внутри каждой клетки тела. Они содержат гены, определяющие физическое строение человека.

Муковисцидоз (CF): Наследственное заболевание, вызывающее проблемы с дыханием и пищеварением.

Диагностические тесты: Тесты, которые ищут болезнь или причину болезни.

ДНК: Генетический материал, который передается от родителей к детям. ДНК упакована в структуры, называемые хромосомами.

Синдром Дауна (трисомия 21): Генетическое заболевание, вызывающее аномальные черты лица и тела, медицинские проблемы, такие как пороки сердца и умственная отсталость. Большинство случаев синдрома Дауна вызваны дополнительной хромосомой 21 (трисомия 21).

Синдром Эдвардса (трисомия 18) : генетическое заболевание, вызывающее серьезные проблемы. Это вызывает маленькую голову, пороки сердца и глухоту.

Плод : Стадия человеческого развития после 8 полных недель после оплодотворения.

Гены: сегментов ДНК, содержащих инструкции для развития физических качеств человека и управления процессами в организме. Ген является основной единицей наследственности и может передаваться от родителей к детям.

Консультант-генетик: Медицинский работник со специальной подготовкой в ​​области генетики, который может дать экспертную консультацию по поводу генетических нарушений и пренатального тестирования.

Генетические нарушения : Нарушения, вызванные изменением генов или хромосом.

Наследственные заболевания: Болезни, вызванные изменением гена, которое может передаваться от родителей к детям.

Моносомия: Состояние, при котором отсутствует хромосома.

Мутации: Изменения в генах, которые могут передаваться от родителей к детям.

Дефекты нервной трубки (ДНТ) : Врожденные дефекты, возникающие в результате нарушения развития головного, спинного мозга или их оболочек.

Скрининг воротникового пространства: Тест для выявления определенных врожденных дефектов, таких как синдром Дауна, синдром Эдвардса или пороки сердца. Скрининг использует ультразвук для измерения жидкости в задней части шеи плода.

Акушер: Врач, ухаживающий за женщинами во время беременности и родов.

Синдром Патау (Triso my 13): Генетическое заболевание, вызывающее серьезные проблемы. Он затрагивает сердце и мозг, расщелины губы и неба, а также лишние пальцы рук и ног.

Плацента : Орган, обеспечивающий плод питательными веществами и выводящий из него отходы жизнедеятельности.

Скрининг-тесты: Тесты для поиска возможных признаков заболевания у людей, у которых нет признаков или симптомов.

Половые хромосомы : Хромосомы, определяющие пол человека. У людей есть две половые хромосомы, X и Y. У женщин есть две X-хромосомы, а у мужчин есть X и Y-хромосомы.

Серповидноклеточная анемия: Наследственное заболевание, при котором эритроциты имеют форму полумесяца, что вызывает хроническую анемию и приступы боли.

Болезнь Тея–Сакса : Наследственное заболевание, вызывающее умственную отсталость, слепоту, судороги и смерть, обычно в возрасте до 5 лет.

Триместр: 3 месяца беременности. Это может быть первое, второе или третье.

Трисомия: Состояние, при котором имеется лишняя хромосома.

Ультразвуковые исследования: Исследования, в которых звуковые волны используются для исследования внутренних частей тела. Во время беременности с помощью УЗИ можно проверить состояние плода.

генетических заболеваний человека | Британика

Генетическая болезнь человека Любое заболевание и расстройство, вызванное мутациями в одном или нескольких генах.

С увеличением возможностей борьбы с инфекционными заболеваниями и болезнями, связанными с питанием, в развитых странах пришло осознание того, что генетические заболевания являются основной причиной инвалидности, смерти и человеческих трагедий. Действительно, редко встречается семья, полностью свободная от каких-либо известных генетических нарушений. Были идентифицированы многие тысячи различных генетических нарушений с определенными клиническими симптомами. Из 3-6 процентов новорожденных с признанным врожденным дефектом по крайней мере половина связана с преимущественно генетическим вкладом.Кроме того, генетические дефекты являются основной известной причиной невынашивания беременности в развитых странах, и почти половина всех самопроизвольных абортов (выкидышей) связана с хромосомными аномалиями плода. Около 30 процентов всей послеродовой младенческой смертности в развитых странах связано с генетическими заболеваниями; 30 процентов педиатрических и 10 процентов госпитализаций взрослых связаны преимущественно с генетической причиной. Наконец, по оценкам медицинских исследователей, генетические дефекты, пусть даже незначительные, присутствуют по крайней мере у 10 процентов всех взрослых.Таким образом, это не редкие события.

Британская викторина

44 вопроса из самых популярных викторин Britannica о здоровье и медицине

Как много вы знаете об анатомии человека? Как насчет медицинских условий? Мозг? Вам нужно много знать, чтобы ответить на 44 самых сложных вопроса самых популярных викторин Britannica о здоровье и медицине.

Врожденный дефект — это любая биохимическая, функциональная или структурная аномалия, возникшая до или вскоре после рождения. Следует подчеркнуть, что не все врожденные дефекты имеют одну и ту же основу, и даже возможно, что кажущиеся одинаковыми дефекты у разных людей отражают различные основные причины. Хотя генетические и биохимические основы большинства признанных дефектов все еще неясны, очевидно, что многие из этих нарушений являются результатом сочетания генетических факторов и факторов окружающей среды.

В этой статье рассматриваются основные категории генетических заболеваний, особое внимание уделяется типам генетических мутаций, которые их вызывают, рискам, связанным с воздействием определенных факторов окружающей среды, и курсу лечения генетических заболеваний посредством консультирования, диагностики и лечения. Для полного объяснения менделевской и неменделевской генетики, генетической мутации и регуляции, а также других принципов, лежащих в основе генетических заболеваний, см. статью наследственность. Генетика развития опухоли, кратко описанная в этой статье, подробно описана в статье «Рак».

Классы генетических заболеваний

Большинство генетических дефектов человека можно разделить на хромосомные, менделевские с одним геном, неменделевские с одним геном или мультифакториальные причины. Каждая из этих категорий кратко обсуждается ниже.

Примерно у 1 из 150 живых новорожденных обнаруживаются хромосомные аномалии. Тем не менее, даже такая высокая частота представляет собой лишь небольшую часть хромосомных мутаций, поскольку подавляющее большинство из них летальны и приводят к внутриутробной смерти или мертворождению.Действительно, по оценкам, 50 процентов всех выкидышей в первом триместре и 20 процентов всех выкидышей во втором триместре связаны с хромосомными аномалиями плода.

Хромосомные нарушения можно разделить на три основные категории: (1) нарушения, связанные с числовыми аномалиями аутосом, (2) нарушения, связанные со структурными нарушениями аутосом, и (3) нарушения, связанные с половыми хромосомами. Аутосомы — это 22 набора хромосом, обнаруженных во всех нормальных клетках человека. Они обозначаются численно (т.г., хромосома 1, хромосома 2) в соответствии с традиционным порядком сортировки по размеру, форме и другим свойствам. Половые хромосомы составляют 23-ю пару хромосом во всех нормальных клетках человека и бывают двух форм, называемых X и Y. У людей и многих других животных именно строение половых хромосом определяет пол индивидуума, так что XX приводит к женщине, а XY приводит к мужчине.

Численные аномалии

Численные аномалии, затрагивающие либо аутосомы, либо половые хромосомы, как правило, считаются результатом мейотического нерасхождения, т. е. неравного деления хромосом между дочерними клетками, которое может происходить во время образования материнских или отцовских гамет.Мейотическое нерасхождение приводит к образованию яйцеклеток или сперматозоидов с дополнительными или отсутствующими хромосомами. Хотя биохимическая основа числовых хромосомных аномалий остается неизвестной, возраст матери явно оказывает влияние, так что пожилые женщины подвержены значительному повышенному риску зачать и родить ребенка с хромосомными аномалиями. Риск увеличивается с возрастом почти экспоненциально, особенно после 35 лет, так что беременная женщина в возрасте 45 лет и старше имеет вероятность от 1 к 20 до 1 к 50, что у ее ребенка будет трисомия 21 (синдром Дауна), в то время как риск составляет только 1 из 400 для 35-летней женщины и менее 1 из 1000 для женщины в возрасте до 30 лет. Нет четкого влияния возраста отца на числовые хромосомные аномалии.

Хотя синдром Дауна, вероятно, является наиболее известным и наиболее часто наблюдаемым из аутосомных трисомий, обнаруживаемым примерно у 1 из 800 живорожденных, как трисомия 13, так и трисомия 18 также встречаются в популяции, хотя и в значительно меньшей степени ( 1 из 10 000 живорождений и 1 из 6 000 живорождений соответственно). Тем не менее подавляющее большинство зачатий, связанных с трисомией любой из этих трех аутосом, теряется из-за невынашивания беременности, как и все зачатия, связанные с трисомией любой из других аутосом.Точно так же моносомия по любой из аутосом летальна внутриутробно и поэтому не наблюдается в популяции. Поскольку числовые хромосомные аномалии обычно возникают в результате независимых мейотических событий, родители, у которых была одна беременность с числовой хромосомной аномалией, как правило, не подвергаются заметно повышенному риску повторения этого опыта по сравнению с общей популяцией. Тем не менее, для этих пар обычно указывается небольшой повышенный риск для объяснения необычных ситуаций, таких как хромосомные транслокации или гонадный мозаицизм, описанные ниже.

Структурные аномалии

Структурные аномалии аутосом даже более распространены в популяции, чем числовые аномалии, и включают транслокации больших фрагментов хромосом, а также более мелкие делеции, вставки или перестройки. Действительно, около 5 процентов всех случаев синдрома Дауна являются результатом не классической трисомии 21, а наличия избыточного материала хромосомы 21, прикрепленного к концу другой хромосомы в результате события транслокации.Сбалансированные структурные хромосомные аномалии могут быть совместимы с нормальным фенотипом, хотя несбалансированные хромосомные структурные аномалии могут быть такими же разрушительными, как и числовые аномалии. Кроме того, поскольку многие структурные дефекты наследуются от родителя, который является сбалансированным носителем, пары, у которых была одна беременность со структурной хромосомной аномалией, обычно подвергаются значительно повышенному риску повторения опыта по сравнению с общей популяцией. Ясно, что вероятность рецидива будет зависеть от того, встречается ли сбалансированная форма структурного дефекта у одного из родителей.

Даже небольшое удаление или добавление аутосомного материала — слишком малое, чтобы его можно было увидеть с помощью обычных методов кариотипирования — может привести к серьезным порокам развития и умственной отсталости. Одним из примеров является синдром cri du chat (по-французски «кошачий крик»), который связан с потерей небольшого сегмента короткого плеча хромосомы 5. Новорожденные с этим заболеванием имеют такой «мяуканье» кошки. Умственная отсталость обычно тяжелая.

Практики пренатальной диагностики генетических нарушений и прерывания беременности среди населения с высоким уровнем кровного родства, Саудовская Аравия

В настоящем исследовании изучалась практика перекрестного среза населения Саудовской Аравии в отношении PND и TOP для генетических нарушений, в дополнение к изучению факторов, которые способствуют к их практикам. Проведение такого исследования крайне необходимо, особенно в Саудовской Аравии, где генетические нарушения относительно распространены из-за высокой распространенности кровнородственных браков. Помимо кровнородственных браков, увеличению распространенности таких генетических заболеваний способствует высокий возраст матери и отца и склонность к многодетности, а также отсутствие мер по охране здоровья 4 . Устранение такого бремени генетических нарушений зависит, по крайней мере частично, от общедоступных знаний и практики генетического тестирования 5 .

Благоприятное отношение к практике PND в значительной степени зависит от более высокого уровня образования, более старшего возраста, предыдущей беременности больным ребенком и наличия предварительных знаний о пренатальной диагностике. Наши результаты согласуются с другими исследованиями, в которых сообщается о довольно благоприятной практике в отношении PND 7 . Однако, несмотря на положительную практику в отношении PND, участники придерживались более критической практики, когда дело доходит до TOP. Многие факторы способствуют принятию TOP, помимо образования (уровни бакалавриата и высшего образования), молодого возраста и предшествующей беременности больным ребенком.Люди, состоящие в браке и состоящие в браке с неродственниками, более склонны к ТОР. Кроме того, люди, которые ранее делали аборт и у плода были диагностированы генетические заболевания, больше поддерживали ТОП.

Хотя большинство участников считали, что TOP «приемлема», стоит отметить, что их принятие было обусловлено соблюдением исламских правил аборта. Принимая во внимание, что основной причиной отказа от абортов была религия. Религия, по-видимому, является основным фактором в отношении участников к ТОР, как ранее сообщалось в других исследованиях 7 .В исламских регионах считается, что одушевление происходит после 120 дней беременности, и в результате TOP будет запрещен, поскольку плод считается живым человеком 14 . До 120 дней беременности ТОП можно сделать, если генетическое или негенетическое состояние плода несовместимо с жизнью после рождения или будет большая инвалидность и страдания. Разрешается через 120 дней, если продолжение беременности угрожает жизни матери 14 . Совет старших ученых Королевства предоставил Министерству здравоохранения (МЗ) консультативное заключение (фетва) относительно аборта следующего содержания: «Аборт не должен производиться без медицинского решения специализированного комитета, которому можно доверять, и что В комитете должно быть как минимум 3 врача-мусульманина, или если нет врача-мусульманина, то все в порядке.Также нельзя делать аборт без согласия обоих родителей или только матери, если наносится прямой вред только ей».

Здесь мы наблюдали высокую степень принятия ТОР у людей со случаями аутизма в их семье (рис. 1), в отличие от предыдущих исследований, которые показали благоприятную практику ТОР в гипотетическом случае синдрома Дауна по сравнению с аутизмом 9,15 . Сообщается, что оба генетических заболевания вызывают стресс в семье при преодолении условий 16 , однако они по-разному воспринимают тяжесть генетических заболеваний 9 . Тяжесть генетических заболеваний оказывает большое влияние на принятие ТОП семьями с умственной отсталостью в анамнезе (рис. 1). По сравнению с предыдущим исследованием наблюдается незначительное снижение в сторону PND и TOP. Предыдущее исследование было сосредоточено на хорошо образованном регионе и только на студентах колледжей. Чтобы добавить, исследование не уточняло аборт как единственный вариант 2 . И наоборот, респонденты, состоящие в браке или их жены, когда-либо беременные больным ребенком, с большей вероятностью предпочли ТОП, в то время как они менее склонны рассматривать ПНД.Это может быть связано с предыдущим опытом психологического давления, за которым последовал диагноз больного ребенка. Произошло незначительное повышение уровня принятия PND респондентами, теми, кто обращал внимание на преимущества PND. Один человек ответил на преимущества или преимущества пренатальной диагностики генетических заболеваний: «пренатальная диагностика помогает защитить жизнь ребенка, а также всей семьи от бремени болезни и негативных аспектов общества». Кроме того, большинство ответов касались преимуществ PND. Это явно отражает позитивное мышление изучаемого населения. Однако мы не можем пренебрегать мнением меньшинства людей (0,97%) с влиянием неточной ПНД и против веры. Более того, лишь небольшой процент участников считал, что PND невыгодна из-за психологического давления или инвазивного характера процедуры.

В 2016 году (25 апреля) король и наследный принц Саудовской Аравии обнародовали «Видение Саудовской Аравии 2030», представляющее собой стратегический план по улучшению всех аспектов жизни в Королевстве 17 .Министерство здравоохранения (МЗ) является частью Национальной программы трансформации в видении, и одной из ее основных задач является повышение качества медицинских услуг с использованием профилактических и терапевтических подходов к борьбе с заболеваниями (Национальная программа трансформации 2020). В ближайшие годы в Королевстве произойдут огромные изменения, направленные на модернизацию системы здравоохранения путем реализации нескольких программ, направленных на просвещение населения путем повышения осведомленности о важных вопросах здравоохранения 18 . Настоящий отчет об опросе в совокупности изменит знания и практику общественности в отношении PND и TOP 15 .

Исследование имеет различные сильные стороны, это первое в своем роде поперечное исследование с большим количеством респондентов, добавление параметров о положительных и отрицательных эффектах PND было включено впервые наряду с репродуктивной функцией. принимать решение. Следует упомянуть сравнительный анализ принятия репродуктивных решений с дополнительными влияющими факторами, такими как различные истории болезни.Исследование имеет несколько ограничений; Не обязательно, чтобы наблюдение за изучаемой популяцией приводило к реальному решению относительно PND и TOP 19 . В исследовании упущена возможность взглянуть на практику различных видов пренатальной диагностики (инвазивной/неинвазивной). Мы считаем, что наши результаты отражают практику саудовцев, но окончательные решения всегда могут быть изменены в зависимости от семейной ситуации. В исследовании не участвовала ни одна пара. Основным ограничением исследования является то, что большая часть данных была собрана из онлайн-источников.

Очень ранняя пренатальная диагностика генетических заболеваний на основе анализа целомической жидкости: технико-экономическое обоснование | Репродукция человека

Аннотация

ПРЕДПОСЫЛКИ: Целоцентез может представлять собой идеальный метод для очень ранней пренатальной диагностики. Хотя плотность клеток в целомической жидкости (CF) очень низкая, результаты анализа клеточного компартмента были предложены для пренатальной диагностики. МЕТОДЫ И РЕЗУЛЬТАТЫ: Мы стремились оценить количество общей ДНК (т.е. клеточные и бесклеточные) в 14 образцах (0,4–0,8 мл) муковисцидоза, взятых у женщин на 8–9-й неделе беременности, которым предстоит прерывание беременности, и для оценки возможности множественного анализа отдельных генов с помощью мультиплексной ПЦР в реальном времени. Мы обнаружили, что количество общей ДНК в муковисцидозе было очень низким и варьировало в широких пределах. Генетическое тестирование с помощью мультиплексной ПЦР в реальном времени было успешно проведено в 10 из 14 образцов (71%). Однако при рассмотрении образцов, которые могли бы обеспечить надежную пренатальную диагностику (т.е. успешный ПЦР-анализ и отсутствие заметного материнского загрязнения), достоверные пренатальные диагнозы на основе МВ-ДНК были получены только в 8 из 14 (58%) образцов. ЗАКЛЮЧЕНИЕ: Разработка высоконадежных процедур, адаптированных к малоклеточному МВ, крайне необходима, прежде чем можно будет предложить целомоцентез для ранней пренатальной диагностики генетических заболеваний до 10 недель.

Фон

Жидкость из экзоцеломической полости может быть самой ранней жидкостью плодного яйца, поддающейся пренатальному генетическому тестированию, поскольку ее можно выборочно аспирировать под ультразвуковым контролем с использованием трансвагинального пути начиная с 5 недель беременности. Впервые примененный в 1993 г. (Jurkovic et al. , 1993), целомоцентез может быть предпочтительнее биопсии ворсин хориона (CVS), которая в настоящее время является самым ранним методом, доступным для инвазивной пренатальной диагностики, потому что (i) он сокращает время постановки диагноза по крайней мере на 1 месяц, (ii) это исключит риск повреждения плацентарных сосудов и связанный с ним риск аномалий развития плода, (iii) это уменьшит дискордантность, возникающую в результате псевдомозаицизма, возникающего при использовании классических препаратов хориона, и (iv) это сделает внутриутробно терапия стволовыми клетками возможна до того, как плод станет иммунологически компетентным.

Два основных вопроса, связанных с целомоцентезом, до сих пор остаются предметом дискуссий. Во-первых, потеря плода, связанная с процедурой, может составлять примерно 2%, но ее можно оценить только на основе описательных исследований женщин, перенесших целомоцентез за пару недель до прерывания беременности (TOP) (Makrydimas et al . , 2002). Кроме того, из-за ограниченного числа продолжающихся беременностей после целомоцентеза (Makrydimas et al. ., 2004a) в настоящее время невозможно сделать вывод о его потенциальном влиянии на последующее развитие плода.Эти риски, связанные с целомоцентезом, можно свести к минимуму, если использовать тонкую иглу и брать небольшой объем образца. Второй вопрос касается риска загрязнения образца материнским материалом, что может помешать проведению молекулярно-биологических анализов для генетического анализа. Насколько нам известно, до сих пор сообщалось только о результатах анализа клеточного компартмента целомической жидкости (CF). Относительно небольшое количество клеток при муковисцидозе (Jauniaux et al. ., 2003) и очевидная необходимость извлечения лишь небольшого их количества должны стимулировать анализ клеточной и внеклеточной ДНК при муковисцидозе.

Целью нашего исследования было использование ПЦР в реальном времени для оценки количества общей (клеточной и внеклеточной) ДНК, содержащейся в МВ, а затем изучение возможности одновременного анализа нескольких одноосновных мутаций в одной реакции с использованием ДНК МВ и контроль на отсутствие материнской контаминации.

Методы

Отбор проб CF и выделение нуклеиновых кислот

Опытный оператор выполнил целомоцентез 14 женщинам с неосложненной одноплодной беременностью в сроке 8–9 недель непосредственно перед хирургической ТОП по психологическим показаниям.Гестационный возраст определяли с первого дня последней менструации и подтверждали ультразвуковым измерением длины темени-крестца. Местный комитет по этике (CCPPRB Aulnay-sous-Bois, Франция) одобрил исследование, и пациенты дали свое информированное письменное согласие.

CF были получены путем трансвагинальной пункции под ультразвуковым контролем, как описано ранее (Jurkovic et al. ., 1993), с использованием иглы 20G (Cook, Limerick, Ireland). Во время процедуры постоянно визуализировали кончик иглы, стараясь не проколоть амниотическую оболочку или желточный мешок.Шприц, содержащий первые 0,2 мл каждой жидкости, выбрасывали, чтобы ограничить риск заражения материнской кровью, а следующие 0,4–0,8 мл оставляли для анализов. Венозную кровь матери всегда собирали перед целомоцентезом. В конце процедуры и перед выполнением аспирации TOP мы убедились, что все частоты сердечных сокращений плода были в норме.

Как только лаборатория получила образцы (в течение 8 часов после целомоцентеза), CF и соответствующую материнскую кровь осторожно гомогенизировали, делили на аликвоты (0.2 мл) и сразу же замораживают при –30°С до дальнейшей обработки. Затем ДНК экстрагировали с использованием набора для подготовки шаблонов для ПЦР High Pure (Roche Diagnostics, Мейлан, Франция) в соответствии с рекомендациями производителя, за исключением того, что ДНК элюировали в 50 мкл элюирующего буфера (для увеличения его концентрации), из которых 5 мкл использовали. для каждого анализа.

Количественное определение ДНК с помощью дуплексной ПЦР в реальном времени ДНК

в муковисцидозе количественно определяли с помощью дуплексной ПЦР в реальном времени (Guibert et al . , 2003), нацеленных на гены SRY (Yq11) и F8 (Xq28). Экстрагированный образец ДНК (5 мкл) амплифицировали в LightCycler ® v2.0 (Roche Diagnostics) и проводили ПЦР в конечном объеме 20 мкл с использованием набора Fast DNA Master Hybridization Probes Kit (Roche Diagnostics), содержащего 0,5 мкМ каждого праймера, 0,25 мкМ каждого зонда, 1,25 ед. урацил-ДНК-гликозилазы (UDG; Biolabs, Saint-Quentin-en-Yvelines, Франция) и 4,5 мМ хлорида магния. После первоначальной 1-минутной инкубации при 50°C, чтобы позволить UDG отщепить предполагаемые загрязняющие продукты ПЦР из предыдущих реакций, за первой стадией денатурации, 8 мин при 95°C, последовала следующая амплификация: 45 циклов денатурации (95°C). C, 10 с, скорость изменения температуры 20°C/с), отжиг (56°C, 10 с, скорость изменения 20°C/с) и удлинение (72°C, 15 с, скорость изменения 2°C/с) .Каждый из продуктов ПЦР одновременно и специфически выявляли с помощью гибридизационных зондов, соответственно меченных флуоресцентным LCRed640 (ген SRY ) или LCRed670 (ген F8 ). Характеристики и последовательности праймеров и зондов (Proligo, Париж, Франция) приведены в Таблице 1. Каждый образец выделенной ДНК тестировали в двух экземплярах, а элюирующий буфер для выделения ДНК служил в качестве отрицательного контроля.

Таблица I.

Характеристики и последовательности праймеров и зондов, используемых в дуплексном ПЦР в реальном времени для количественного определения ДНК

90 296 90 303 SRY GCAACGTCCAGGATAGAGTGA GCTGATCTCTGAGTTTCGCATT F8 TGGGTGCAGTGGAACTGTCA TCCTCCAAGCAGACTTACATCC
Целевой ген . ПЦР-продукт . Последовательности праймеров и зондов (5′ > 3′) .
113 п.н.
CCATGAACGCATTCATCGTGTGGTCTC (3’FITC)
CGATCAGAGGCGCAAGATGGCTCT (5 ‘LCRed640, 3’Ph)
133 п.н.
GGACATGCCTTTACCTTGCGTCC (3’FITC)
CAGGCAGCTCACCGAGATCACTTT (5’LCRed670, 3’Ph)
SRY GCAACGTCCAGGATAGAGTGA GCTGATCTCTGAGTTTCGCATT F8 TGGGTGCAGTGGAACTGTCA TCCTCCAAGCAGACTTACATCC
Целевой ген . ПЦР-продукт . Последовательности праймеров и зондов (5′ > 3′) .
113 п.н.
CCATGAACGCATTCATCGTGTGGTCTC (3’FITC)
CGATCAGAGGCGCAAGATGGCTCT (5 ‘LCRed640, 3’Ph)
133 п.н.
GGACATGCCTTTACCTTGCGTCC (3’FITC)
CAGGCAGCTCACCGAGATCACTTT (5’LCRed670, 3’Ph)
Таблица I.

Характеристики и последовательности праймеров и зондов, используемых в дуплексном ПЦР в реальном времени для количественного определения ДНК

90 296 90 303 SRY GCAACGTCCAGGATAGAGTGA GCTGATCTCTGAGTTTCGCATT F8 TGGGTGCAGTGGAACTGTCA TCCTCCAAGCAGACTTACATCC
Целевой ген . ПЦР-продукт . Последовательности праймеров и зондов (5′ > 3′) .
113 п.н.
CCATGAACGCATTCATCGTGTGGTCTC (3’FITC)
CGATCAGAGGCGCAAGATGGCTCT (5 ‘LCRed640, 3’Ph)
133 п.н.
GGACATGCCTTTACCTTGCGTCC (3’FITC)
CAGGCAGCTCACCGAGATCACTTT (5’LCRed670, 3’Ph)
SRY GCAACGTCCAGGATAGAGTGA GCTGATCTCTGAGTTTCGCATT F8 TGGGTGCAGTGGAACTGTCA TCCTCCAAGCAGACTTACATCC
Целевой ген . ПЦР-продукт . Последовательности праймеров и зондов (5′ > 3′) .
113 п. н.
CCATGAACGCATTCATCGTGTGGTCTC (3’FITC)
CGATCAGAGGCGCAAGATGGCTCT (5 ‘LCRed640, 3’Ph)
133 п.н.
GGACATGCCTTTACCTTGCGTCC (3’FITC)
CAGGCAGCTCACCGAGATCACTTT (5’LCRed670, 3’Ph) 

Используя внешнюю стандартную кривую, построенную с помощью серийных разведений количественного образца ДНК, можно определить количество специфической фетальной ДНК (для плодов мужского пола) и/или тотальной ДНК. .

Обнаружение мутаций с одним основанием с помощью триплексной ПЦР в реальном времени

В качестве модели для исследований мутаций с одним основанием, протромботические мутации, подозреваемые в причастности к рецидивирующим потерям плода (т. е. мутации протромбина G20210A, фактора V G1691A и метилентетрагидрофолатредуктазы C677T), были обнаружены в однопробирочной мультиплексной ПЦР в реальном времени, которая проводилась быстро. , надежна и чувствительна и, поскольку это закрытая система, предотвращает загрязнение продуктами ПЦР.

Материнскую кровь и ДНК МВ тестировали одновременно на эти мутации следующим образом. Образец ДНК объемом 5 мкл амплифицировали в LightCycler ® v2.0 (Roche Diagnostics) в конечном объеме 20 мкл с использованием набора LC Multiplex DNA Master Hybridization Probes Kit (Roche Diagnostics), содержащего 0,5 мкМ каждого праймера, 0,25 мкм каждого зонда и 1,25 единиц UDG. Условия цикла: инкубация 1 мин при 50°С и стадия денатурации 1 цикл, 95°С 8 мин, амплификация ДНК-мишени 45 циклов при 95°С 10 с, 60°С 10 с. и 72°C в течение 15 с, каждый со скоростью линейного изменения 20°C/с, анализ кривых плавления для одного цикла при 95°C и 45°C в течение 2 мин каждый, а затем линейное изменение до 75°C при 0,1°C/с. s с непрерывным получением флуоресценции.Характеристики и последовательности праймеров и зондов (Proligo) представлены в таблице II. Каждый из продуктов ПЦР одновременно и специфически выявляли с помощью гибридизационных зондов, соответственно меченных флуоресцентными LCRed610 ( гена MTHFR ), LCRed640 ( F5 гена ) или LCRed670 ( F2 гена ). Экстракт каждого образца тестировали в двух повторностях. Каждый цикл включал контроль гетерозиготной ДНК, а элюирующий буфер для выделения ДНК служил отрицательным контролем.

Таблица II.

Характеристики и последовательности праймеров и зондов, используемых в тройной ПЦР в реальном времени для анализа мутаций с одним основанием

МТГФР GACTGTCATCCCTATTGGCAGG GGACGATGGGGCAAGTGAT F5 ATGCCCAGTGCTTAACAAGACC CCCATTATTTAGCCAGGAGACCT F2 TCTGGGCTCCTGGAACCAAT GTGCTCGGACTACCAGCGTG 9 0305 attgagcctcgccagagt (3’fitc)
Целевой ген . ПЦР-продукт . Последовательности праймеров и зондов (5’>3′) .
195 п.н.
ACGCAGCTTTTCTTTGAGGCTGAC (5’LCRed610, 3’Ph)
GGGAGCCGATTTCATCAT (3’FITC)
207 п. н.
GGACAGGCGAGGAATACAG (3’FITC)
TATTTTGTCCTTGAAGTAACCTTTCAGAAATT (5’LCRed640, 3’Ph)
204 п.н.
ECCTTTTTTTTTGGAACCATAGTTTTAGAAACACA (5’Lcreed670, 3’ph)
МТГФР GACTGTCATCCCTATTGGCAGG GGACGATGGGGCAAGTGAT F5 ATGCCCAGTGCTTAACAAGACC CCCATTATTTAGCCAGGAGACCT F2 TCTGGGCTCCTGGAACCAAT GTGCTCGGACTACCAGCGTG 9 Таблица

Характеристики и последовательности праймеров и зондов, используемых в тройной ПЦР в реальном времени для анализа мутаций с одним основанием

Целевой ген . ПЦР-продукт . Последовательности праймеров и зондов (5’>3′) .
195 п.н.
ACGCAGCTTTTCTTTGAGGCTGAC (5’LCRed610, 3’Ph)
GGGAGCCGATTTCATCAT (3’FITC)
207 п. н.
GGACAGGCGAGGAATACAG (3’FITC)
TATTTTGTCCTTGAAGTAACCTTTCAGAAATT (5’LCRed640, 3’Ph)
204 п.н.
МТГФР GACTGTCATCCCTATTGGCAGG GGACGATGGGGCAAGTGAT F5 ATGCCCAGTGCTTAACAAGACC CCCATTATTTAGCCAGGAGACCT F2 TCTGGGCTCCTGGAACCAAT GTGCTCGGACTACCAGCGTG 9 0305 attgagcctcgccagagt (3’fitc)
Целевой ген . ПЦР-продукт . Последовательности праймеров и зондов (5’>3′) .
195 п.н.
ACGCAGCTTTTCTTTGAGGCTGAC (5’LCRed610, 3’Ph)
GGGAGCCGATTTCATCAT (3’FITC)
207 п. н.
GGACAGGCGAGGAATACAG (3’FITC)
TATTTTGTCCTTGAAGTAACCTTTCAGAAATT (5’LCRed640, 3’Ph)
204 п.н.
ECCTTTTTTTTTGGAACCATAGTTTTAGAAACACA (5’Lcreed670, 3’ph)
МТГФР GACTGTCATCCCTATTGGCAGG GGACGATGGGGCAAGTGAT F5 ATGCCCAGTGCTTAACAAGACC CCCATTATTTAGCCAGGAGACCT F2 TCTGGGCTCCTGGAACCAAT GTGCTCGGACTACCAGCGTG 9 0305 attgagctcgcccagagt (3’fitcgcctcggcagagt

Контаминацию CF материнской тканью систематически контролировали путем изучения 10 маркеров полиморфных коротких тандемных повторов (STR), расположенных на хромосомах X (ген HPRT ), 13 (D13S346, D13S258, D13S794), 18 (D18S51, D18S535, D18S386) или 21 (Д21С11, Д21С1442, Д21С1411).Анализ также включал обнаружение генов SRY в одной мультиплексной ПЦР в соответствии с ранее описанным протоколом (Brisset et al. ., 2003) с небольшими модификациями.

ПЦР проводили в конечном объеме 20 мкл. Смесь для амплификации состояла из × 1 ПЦР-буфера, 100 мкМ каждого dNTP, 1,25 мМ MgCl 2 , 1,25 единиц ДНК-полимеразы FastStart Taq (Roche Diagnostics) и наборов праймеров (Proligo), один из которых был флуоресцентно мечен. После начальной стадии денатурации, 8 мин при 95°С, амплификацию проводили следующим образом: 35 циклов денатурации (95°С, 30 с), отжига (60°С, 30 с) и удлинения (72°С, 60 с). ) в термоциклере 9700 (Applied Biosystems, Courtaboeuf, Франция).Затем продукты ПЦР анализировали на анализаторе последовательности ABI310 с использованием программного обеспечения для анализа Genescan (Applied Biosystems). Сравнивали профили электрофореграмм амплифицированной материнской ДНК и ДНК МВ.

Результаты

Соответствующие данные для всех 14 парных образцов ДНК матери и плода приведены в таблице III. Общая концентрация ДНК, амплифицированной с помощью ПЦР в реальном времени, варьировала от неопределяемого до 777,5 нг/мл (медиана: 17,9 нг/мл). В образце 9 не удалось обнаружить ДНК, несмотря на использование чувствительной ПЦР-амплификации в реальном времени.Этот вывод был подтвержден во втором независимом анализе, начиная с исходного материала, что исключило технический сбой на этапе выделения ДНК. Для образцов 7, 8 и 13, концентрация ДНК которых была ниже или около 1 нг/мл, стандартный протокол, используемый в настоящее время в нашей лаборатории для анализа крови или амниотической жидкости, не дал дальнейших результатов. В этих случаях объем пробы составлял 0,5, 0,4 и 0,6 мл соответственно. Наконец, анализ ДНК удалось провести в 10 из 14 (71%) случаев МВ.Интерпретация была ясной и однозначной во всех случаях. Загрязнения переходящим продуктом ПЦР не наблюдалось.

Целевой ген . ПЦР-продукт . Последовательности праймеров и зондов (5’>3′) .
195 п.н.
ACGCAGCTTTTCTTTGAGGCTGAC (5’LCRed610, 3’Ph)
GGGAGCCGATTTCATCAT (3’FITC)
207 п. н.
GGACAGGCGAGGAATACAG (3’FITC)
TATTTTGTCCTTGAAGTAACCTTTCAGAAATT (5’LCRed640, 3’Ph)
204 п.н.
03 9 0 9 0 9 0 9 + 3 9 + 2 0
Образец . Недели беременности . Внешний вид . Концентрация ДНК (нг/мл) . SRY обнаружение . Обнаружение мутаций . Материнское заражение (STR-анализ) .
. . . . .
.
.
. . . . . Мать . Эмбрион . .
1 9 Clear 3 · 9 +
+
C677T гетерозиготные None
2 9 Clear 98 · 4 C677T гетерозиготные C677T гетерозиготные NOTE
3
9 9 9775 8 7775 + + None
None
4 8 Очистить 161. 7 G1691A гетерозиготные GeterozyGous G1691A Hetreazygous S слабого 5
5 8 9 Clear 17.9 + None + None
6 8 + 4 Clear 139.7 None None Высокий (материнский профиль)
7 9 Очистить 0.7 C677T Heterozygous Неудачно 603030 9
8
Clear 0.7 C677T HeterozyGous Неудачный 9
9
9
9
9
9
9
9
9
Clear Неопределенные None не удалось Shife
10 8 Очистить 102. 6 + + None NOTE NOTE 9
11 8 Clear 60305 None None высокий (материнский профиль)
12 8 CLEAR 2.3
NOTE NOTE NOTE
13 30301 8 9 1,1 C677T HomozyGous Shife
14  Прозрачный  29.0 + Нет Нет Нет
03 9 0 9 0 9 0 9 + 3 9 + 2 0
Образец . Недели беременности . Внешний вид . Концентрация ДНК (нг/мл) . SRY обнаружение . Обнаружение мутаций . Материнское заражение (STR-анализ) .
. . . . .
.
.
. . . . . Мать . Эмбрион . .
1 9 Clear 3 · 9 +
+
C677T гетерозиготные None
2 9 Clear 98 · 4 C677T гетерозиготные C677T гетерозиготные NOTE
3
9 9 9775 8 7775 + + None
None
4 8 Очистить 161. 7 G1691A гетерозиготные GeterozyGous G1691A Hetreazygous S слабого 5
5 8 9 Clear 17.9 + None + None
6 8 + 4 Clear 139.7 None None Высокий (материнский профиль)
7 9 Очистить 0.7 C677T Heterozygous Неудачно 603030 9
8
Clear 0.7 C677T HeterozyGous Неудачный 9
9
9
9
9
9
9
9
9
Clear Неопределенные None не удалось Shife
10 8 Очистить 102. 6 + + None NOTE NOTE 9
11 8 Clear 60305 None None высокий (материнский профиль)
12 8 CLEAR 2.3
NOTE NOTE NOTE
13 30301 8 9 1,1 C677T HomozyGous Shife
14  Прозрачный  29.0 + Нет Нет Нет
03 9 0 9 0 9 0 9 + 3 9 + 2 0
Образец . Недели беременности . Внешний вид . Концентрация ДНК (нг/мл) . SRY обнаружение . Обнаружение мутаций . Материнское заражение (STR-анализ) .
. . . . .
.
.
. . . . . Мать . Эмбрион . .
1 9 Clear 3 · 9 +
+
C677T гетерозиготные None
2 9 Clear 98 · 4 C677T гетерозиготные C677T гетерозиготные NOTE
3
9 9 9775 8 7775 + + None
None
4 8 Очистить 161. 7 G1691A гетерозиготные GeterozyGous G1691A Hetreazygous S слабого 5
5 8 9 Clear 17.9 + None + None
6 8 + 4 Clear 139.7 None None Высокий (материнский профиль)
7 9 Очистить 0.7 C677T Heterozygous Неудачно 603030 9
8
Clear 0.7 C677T HeterozyGous Неудачный 9
9
9
9
9
9
9
9
9
Clear Неопределенные None не удалось Shife
10 8 Очистить 102. 6 + + None NOTE NOTE 9
11 8 Clear 60305 None None высокий (материнский профиль)
12 8 CLEAR 2.3
NOTE NOTE NOTE
13 30301 8 9 1,1 C677T HomozyGous Shife
14  Прозрачный  29.0 + Нет Нет Нет
03 9 0 9 0 9 0 9 + 3 9 + 2 0
Образец . Недели беременности . Внешний вид . Концентрация ДНК (нг/мл) . SRY обнаружение . Обнаружение мутаций . Материнское заражение (STR-анализ) .
. . . . .
.
.
. . . . . Мать . Эмбрион . .
1 9 Clear 3 · 9 +
+
C677T гетерозиготные None
2 9 Clear 98 · 4 C677T гетерозиготные C677T гетерозиготные NOTE
3
9 9 9775 8 7775 + + None
None
4 8 Очистить 161. 7 G1691A гетерозиготные GeterozyGous G1691A Hetreazygous S слабого 5
5 8 9 Clear 17.9 + None + None
6 8 + 4 Clear 139.7 None None Высокий (материнский профиль)
7 9 Очистить 0.7 C677T Heterozygous Неудачно 603030 9
8
Clear 0.7 C677T HeterozyGous Неудачный 9
9
9
9
9
9
9
9
9
Clear Неопределенные None не удалось Shife
10 8 Очистить 102. 6 + + None NOTE NOTE 9
11 8 Clear 60305 None None высокий (материнский профиль)
12 8 CLEAR 2.3
NOTE NOTE NOTE
13 30301 8 9 1,1 C677T HomozyGous Shife
14  Прозрачный  29.0 + Нет Нет Нет

Среди 10 образцов, которые можно было проанализировать, очень слабое загрязнение материнской ДНК наблюдалось в образце 4, но это не повлияло на последующую мутацию. Удивительно, но STR-анализ образцов 6 и 11 дал профили, подобные профилям, полученным с соответствующей материнской кровью; примечательно, что эти образцы были прозрачными, но содержание ДНК в них сильно различалось: 139,7 и 6,6 нг/мл соответственно. Соответственно, определение пола плода и анализ мутаций были осуществимы для всех образцов.

Обсуждение

Согласно нашим результатам, мультиплексная ПЦР в реальном времени ДНК муковисцидоза позволила успешно диагностировать генетические заболевания пренатально для 10 из 14 (71%) образцов. Однако при рассмотрении образцов, которые могли обеспечить надежную пренатальную диагностику (т.е. успешный ПЦР-анализ и отсутствие заметного материнского загрязнения, мешающего интерпретации), и применения протоколов, используемых в настоящее время в нашей лаборатории, но не разработанных специально для муковисцидоза, надежная пренатальная диагностика на основе ДНК-муковисцидоза была признана неэффективной. получен только для 8 из 14 (58%) образцов.

Эти результаты можно считать обескураживающими, если их сравнить с результатами, полученными ранее (Findlay et al. ., 1996; Jauniaux et al. ., 2003). Но при этом не учитывалось бы, что данное исследование, в отличие от других, было разработано как проспективное клиническое исследование, а это означает, что образцы CF (<1 мл) сравнивались с применяемыми в настоящее время реальными условиями генетического тестирования плода с помощью инвазивных процедур, т. е. достаточное количество эмбрионального материала для успешного анализа и образец, свободный от материнского загрязнения.

Можно предложить несколько объяснений, объясняющих заметную разницу между нашей степенью успеха и примерно 90%, о которых сообщили несколько групп (Findlay et al ., 1996; Makrydimas et al ., 2004b; Jauniaux et al . , 2003). Большинство этих групп использовали объемы в 5–10 раз больше и собирали большую часть CF, что могло повлиять на плотность клеток. Хотя количество собранного муковисцидоза не имеет значения в условиях фундаментальных исследований, количество изъятого материала имеет решающее значение в контексте пренатального тестирования на генетические нарушения.Действительно, этот последний объем CF должен быть как можно меньше, чтобы ограничить риск выкидыша.

Кроме того, результаты можно анализировать и рассматривать по-разному в зависимости от того, учитывается ли общий успех ПЦР-анализа для изучения данного гена плода, количество полученных загрязненных образцов и, наконец, количество образцов, для которых можно было бы провести несколько анализов генов. получить одновременно.

Этот момент ясно иллюстрируется выводами, о которых сообщил Findlay et al .(1996), которое является одним из самых обширных исследований, опубликованных на сегодняшний день. Авторы заявили о надежном определении пола плода в 96% своих образцов. Однако этот процент можно интерпретировать по-разному. Из 23 протестированных образцов 20 были сравнены с плацентарными образцами и сохранены авторами. Совпадающие результаты были получены для 18 из 20 образцов (90%). Два образца были испорчены заметным материнским загрязнением, что мешало интерпретации данных. ПЦР-тест на муковисцидоз по-прежнему не столь надежен, так как только 19 из 23 образцов (83%) поддавались интерпретации, среди которых один образец дал противоречивые результаты с плацентой, а другой был контаминирован материнским материалом.Таким образом, если выразить окончательный результат в терминах надежных пренатальных диагнозов, то показатель успеха составит лишь 17 из 23 (74%). Наконец, 11% ложноположительных результатов (загрязнение продуктами ПЦР), о которых сообщили Findlay et al . кажется неприемлемо высоким для клинических условий. Кроме того, Jauniaux и др. . (2003) также сообщили об отличном показателе успеха при определении пола плода, но с шестью образцами (35%) с выраженным материнским загрязнением.

По нашему мнению, эти данные оправдывают разработку высоконадежных и безопасных процедур (т.т. е., анализы на основе ПЦР в реальном времени), адаптированные для анализа малоклеточного CF, подобные тем, которые мы описали в настоящем документе. По этим причинам генетическое тестирование, основанное на ПЦР в реальном времени, особенно хорошо подходит для наших нужд. Но они нуждаются в дальнейшем совершенствовании и доработке. Результаты диагностики, полученные с преимплантационными эмбрионами, показали, что методы ПЦР могут быть адаптированы к очень небольшим количествам ДНК.

Вполне разумно думать, что чувствительность методов, которые мы применяли в этом исследовании, можно улучшить, например, при подготовке образцов для увеличения выхода выделения нуклеиновых кислот (клеточный осадок, концентрация). Кроме того, амплификация гена с помощью простой ПЦР, а не мультиплексной ПЦР, описанной здесь, и увеличение количества циклов должны обеспечивать более высокую чувствительность. Однако, что касается отбора эмбрионов, целомоцентез должен обязательно удовлетворять двум основным критериям: достаточное количество анализируемого материала и минимально возможная степень инфицирования матери.

Наши результаты впервые демонстрируют, что содержание CF-ДНК не только сильно различается между образцами, но и чаще всего оно очень низкое.Они косвенно подтверждают, что содержание клеток муковисцидоза, если считать их основным источником ДНК, невелико, что серьезно ограничивает возможность достижения точного и надежного хромосомного анализа с использованием обычных цитогенетических методов. Насколько нам известно, ни одно исследование еще не дало четкой оценки плотности клеток при муковисцидозе. Поэтому мы не можем сделать вывод о том, связана ли изменчивость полученных количеств ДНК с плотностью клеток от одного образца к другому или просто отражает изменчивость содержания внеклеточной ДНК.

Предлагая возможность пренатальной диагностики генетических заболеваний не менее чем за 4 недели до этого, мы считаем, что целомоцентез является очень привлекательным достижением. С клинической точки зрения это представляет собой реальное преимущество, поскольку позволяет женщинам пройти медикаментозную ТОП на 7-10 неделе беременности, что менее травматично, чем хирургическая ТОП во втором триместре (Findlay et al ). Более того, целомоцентез может быть действенной альтернативой ранней пренатальной диагностике для пациентов-евреев, поскольку он будет соответствовать ортодоксальному еврейскому закону, разрешающему TOP до 40 дней после зачатия, и для которых ранняя CVS, связанная с риском дефектов редукции конечностей, остается единственным вариант (Firth и др. ., 1991; Brambatti и др. ., 1992; Wapner и др. , 2002).

Наши результаты и результаты, о которых сообщалось на сегодняшний день, еще не позволяют нам предлагать эту раннюю пренатальную диагностическую процедуру нашим пациентам. Тем не менее, мы по-прежнему считаем, что целомоцентез остается привлекательным методом для ранней пренатальной диагностики генетических нарушений. Мы намерены продолжить наши усилия по разработке надежных процедур, адаптированных к малоклеточному МВ, чтобы улучшить наше понимание механизмов, ведущих к присутствию генетического материала в целомической полости.

Благодарности

Это исследование получило финансовую поддержку от Assistance Publique-Hôpitaux de Paris в Центре клинических исследований университетской больницы Сент-Антуан.

Каталожные номера ,  ,  .

Генетическая диагностика с помощью биопсии ворсин хориона до 8 недель гестации: эффективность, надежность и риски при 317 завершенных беременностях

12

 (стр. 

784

789

),  ,  ,  ,  ,  ,  ,  .

Дискордантный пренатальный диагноз трисомии 21 вследствие мозаичных перестроек хромосомы 21

23

 (стр.  

461

469

),  ,  ,  ,  ,  .

Экспресс-генетическая диагностика на 7–9 неделе беременности: диагностика пола, дефектов отдельных генов и ДНК-отпечатков пальцев из целомических образцов

11

 (стр. 

2548

2553

),  ,  ,  ,  ,  .

Тяжелые аномалии конечностей после биопсии ворсин хориона на 56-66 день беременности

,

Ланцет

,

1991

, том.

337

 (стр. 

726

763

),  ,  ,  ,  ,  .

Кинетика появления гена SRY в материнской сыворотке: обнаружение с помощью ПЦР в реальном времени на ранних сроках беременности

18

 (стр. 

1733

1736

),  ,  .

Очень ранняя пренатальная диагностика целомических клеток с использованием количественной флуоресцентной полимеразной цепной реакции

6

 (стр. 

494

498

),  ,  ,  ,  ,  .

Целоцентез: новый метод ранней пренатальной диагностики

,

Ланцет

,

1993

, том.

341

 (стр. 

1623

1624

),  ,  ,  .

Краткосрочная безопасность целостного пункции для матери и плода

19

 (стр. 

243

245

),  ,  ,  ,  .

Ранняя пренатальная диагностика путем целоцентеза

УЗИ Акушер-гинеколог

2004a

, том.

23

 (стр. 

382

385

),  ,  ,  ,  .

Пренатальное тестирование на отцовство с использованием ДНК, выделенной из целомических клеток

,

Fetal Diag Ther

,

2004b

, vol.

19

 (стр. 

75

77

),  ,  ,  ,  ,  ,  .

Процедурные риски по сравнению с теологией: биопсия ворсин хориона у ортодоксальных евреев при сроке беременности менее 8 недель

186

 (стр. 

1133

1136

)

© Автор, 2006 г. Опубликовано Oxford University Press от имени Европейского общества репродукции человека и эмбриологии. Все права защищены. Чтобы получить разрешение, отправьте электронное письмо по адресу: [email protected]

.

Генетические нарушения плода

Генетические нарушения возникают, когда проблемы в хромосомах или генах ребенка вызывают физические отклонения или болезни.

В нашем теле миллионы клеток. В каждой клетке имеется 46 хромосом, расположенных в 23 совпадающих парах. Половина хромосом передается человеку от матери, а половина — от отца. Эти хромосомы несут нашу ДНК или гены, которые определяют, как мы выглядим, как наше тело развивается и функционирует. Эти инструкции варьируются от цвета наших глаз до нашего риска заболевания.

Если в эти инструкции вносятся вредные изменения, это может изменить способ развития ребенка.Младенцы с генетическими нарушениями могут быть подвержены риску замедления умственного и физического развития, физических отклонений и пожизненных болезней.

Некоторые генетические нарушения являются наследственными, то есть генетические изменения передаются от родителей. Другие генетические изменения могут произойти впервые у ребенка. Родители могут нести изменения в гене или хромосоме, не осознавая этого, так как это может не вызвать у них никаких проблем со здоровьем.


Факторы риска генетических заболеваний

Факторы, повышающие риск рождения ребенка с генетическим заболеванием, включают:

  • Генетическое заболевание в семейном анамнезе
  • Предыдущий ребенок с генетическим заболеванием
  • Один из родителей имеет хромосомную аномалию
  • Пожилой материнский возраст (35 лет и старше)
  • Пожилой отцовский возраст (40 лет и старше)
  • Множественные выкидыши или мертворождение в анамнезе

Важно знать, что некоторые врожденные дефекты, задержки развития и/или заболевания могут быть вызваны пренатальным воздействием наркотиков, алкоголя или других факторов окружающей среды.


Типы расстройств

Во время беременности можно наблюдать несколько видов нарушений:

  • Нарушения одного гена возникают, когда изменение одного гена вызывает заболевание. Примеры включают муковисцидоз, серповидноклеточную анемию, болезнь Тея-Сакса, гемофилию и синдром Марфана.
  • Хромосомные аномалии возникают при отсутствии или наличии лишних хромосом или фрагментов хромосом. Синдром Дауна, наиболее распространенная хромосомная аномалия, вызывается дополнительной хромосомой номер 21.Хромосомные аномалии могут быть унаследованы от родителей или возникать случайно.
  • Многофакторные или комплексные расстройства вызваны сочетанием генетической предрасположенности и факторов окружающей среды, что затрудняет прогнозирование того, кто может подвергаться риску. Примеры включают пороки сердца, расщелину губы или неба и расщелину позвоночника.
  • Тератогенные расстройства возникают, когда ребенок во время беременности подвергается воздействию веществ, вызывающих аномалии, также известных как «тератогены».«Младенцы очень чувствительны в первом триместре, когда развиваются все органы. К тератогенам относятся алкоголь, наркотики, свинец, высокие уровни радиационного облучения и некоторые лекарства, инфекции и токсичные вещества.

Тестирование на генетические заболевания

Существует два типа тестирования на генетические нарушения:

  1. Скрининговые тесты – эти тесты проверяют риск наличия у вашего ребенка определенных генетических нарушений
  2. Диагностические тесты – эти тесты могут определить, действительно ли у ребенка присутствуют определенные генетические нарушения

Скрининг и диагностические тесты необязательны.Они доступны для всех женщин, даже для тех, у кого нет известных факторов риска.


Скрининг-тесты

Скрининг-тесты для проверки вероятности наличия у вашего ребенка определенных генетических нарушений включают:

  • Скрининг на носительство — это анализ крови, который пытается определить, является ли кто-либо из родителей генетическим изменением наследственных заболеваний, которые могут быть переданы ребенку. Это также может быть выполнено на образце слюны. Лучше всего делать этот скрининг перед беременностью, но его можно делать и во время беременности.Хотя с помощью этого скрининга можно одновременно проверить множество состояний, в настоящее время невозможно выявить все расстройства, которые могут быть унаследованы.
  • Пренатальные генетические скрининги представляют собой серию скринингов первого и второго триместра, в которых используются образцы крови матери, а также ультразвуковые исследования для проверки риска развития у ребенка определенных распространенных генетических заболеваний. Примеры включают синдром Дауна и некоторые врожденные дефекты, такие как расщелина позвоночника.
  • Неинвазивное пренатальное тестирование (NIPT) или скрининг бесклеточной ДНК — это анализ крови, который проверяет ДНК из плаценты, обнаруженной в крови матери.Это скрининг наиболее распространенных хромосомных аномалий, таких как синдром Дауна и трисомия 18, и чаще всего используется при беременности с высоким риском.

Диагностические тесты

Диагностические тесты проводятся во время беременности для выявления определенных генетических нарушений у ребенка, таких как муковисцидоз или синдром Дауна. Некоторые диагностические тесты также могут выявить дефекты нервной трубки, например, расщепление позвоночника. Диагностические тесты, как правило, являются безопасными процедурами, если их проводит опытный врач.Тем не менее, все процедуры сопряжены с небольшим риском осложнений, которые могут включать повышенный риск потери беременности.

Обычные диагностические тесты включают:

  • Образец ворсин хориона анализ образца ткани, взятого из плаценты в первом триместре
  • Амниоцентез: Исследование образца амниотической жидкости, взятой из матки во втором триместре

Доступны дополнительные передовые диагностические тесты и технологии:

  • Забор крови плода или чрескожный забор пуповинной крови (PUBS) использует образец крови из пуповины ребенка для проверки на генетические нарушения.Обычно это делается, когда амниоцентез или биопсия ворсин хориона невозможны.
  • Пренатальный хромосомный анализ (кариотип) — это распространенный генетический тест, проводимый на клетках, полученных в результате амниоцентеза или CVS, который может обнаружить большие изменения в хромосомах, такие как лишняя или отсутствующая хромосома или изменение в том, как хромосомы собраны вместе.
  • Пренатальный хромосомный микроматричный анализ (CMA) — это более подробный тест, проводимый на клетках, полученных в результате амниоцентеза или CVS, и пытается определить, отсутствуют ли какие-либо фрагменты хромосом или лишние.Эти дополнительные или отсутствующие фрагменты могут быть слишком малы, чтобы их можно было увидеть только на кариотипе.
  • Секвенирование генома плода или всего экзома (WES) — это диагностический тест для беременных со сложными состояниями плода, который проверяет почти все гены ребенка.

Генетическое консультирование

Если вы беременны или планируете беременность, вас могут направить к генетическому консультанту по номеру:

  • Оцените свой личный риск рождения ребенка с генетическим заболеванием
  • Просмотрите варианты тестирования
  • Координация генетических скринингов и диагностических тестов и интерпретация результатов
  • Обеспечить эмоциональную поддержку и образовательные ресурсы для вас и вашей семьи
  • Помочь вам принять обоснованное решение о вашей беременности и лечении вашего ребенка, а также подготовиться к соответствующему медицинскому обслуживанию

Лечение генетических нарушений плода

Лечение зависит от генетического заболевания и индивидуальной беременности.Как правило, если во время беременности у вашего ребенка диагностируют генетическое заболевание, ваше лечение будет включать:

  • Специализированная помощь врача-гинеколога
  • Индивидуальный уход в зависимости от генетического заболевания, вашей беременности и предпочтений вашей семьи
  • Варианты лечения варьируются от медикаментозной терапии во время беременности, например внутриутробного вмешательства, до хирургического вмешательства сразу после рождения
  • Многопрофильная совместная медицинская бригада, включающая консультантов-генетиков, специалистов по визуализации, специалистов по фетальным заболеваниям, фетальных и неонатальных хирургов по мере необходимости, а также неонатологов и педиатров, имеющих опыт лечения детей с генетическими нарушениями
  • Услуги поддержки для вас и вашей семьи

Преимущества специализированного ухода

Детский павильон Техаса для женщин предлагает специализированную помощь беременным женщинам, чьи дети находятся в группе риска или у которых диагностированы генетические нарушения, обеспечивая наилучший уход и результаты.

Преимущества для наших пациентов:

  • Специалисты по охране материнства и плода , имеющие опыт ведения этих беременностей и особые потребности матери и ребенка
  • Расширенная визуализация для раннего выявления и лечения аномалий развития плода
  • Экспертное генетическое консультирование и тестирование с использованием новейших технологий в нашей клинике пренатальной генетики, одной из крупнейших в стране в своем роде
  • Доступ к Техасскому детскому фетальному центру™ , национальному лидеру в области диагностики и лечения аномалий развития плода
  • Полный спектр фетальной терапии с подтвержденными исходами для плода
  • Немедленный доступ в Техасскую детскую больницу после рождения , включая Детский центр для новорожденных Техаса, где находится отделение интенсивной терапии новорожденных (NICU) уровня IV
  • Поддержка эмоциональных проблем при беременности с генетическим заболеванием или врожденным дефектом через The Women’s Place — Центр репродуктивной психиатрии, уникальную программу, посвященную заботе и лечению репродуктивного психического здоровья женщин
  • Доступ к квалифицированной специализированной помощи , передовым исследованиям и новым методам лечения детей с известными или подозреваемыми генетическими нарушениями в Клинике детской генетики Техасской детской больницы
  • Эксперт, сострадательная педиатрическая помощь для детей с генетическими нарушениями в Центре педиатрии развития Мейера при Детской больнице Техаса

Обнаружение генетических аномалий — HealthyChildren.org

Некоторые тесты позволяют выявить генетические аномалии еще до рождения. Узнав об этих проблемах до рождения, вы сможете заранее спланировать лечение своего ребенка, а в некоторых случаях даже вылечить заболевание, пока ребенок еще находится в утробе матери.


Амниоцентез

  • При амниоцентезе врач вводит тонкую иглу через брюшную стенку беременной в матку. Небольшой образец амниотической жидкости берется из мешка, окружающего плод.Когда жидкость анализируется в лаборатории, она может выявить серьезные генетические и хромосомные нарушения, такие как Синдром Дауна. Для генетических исследований амниоцентез обычно проводят во втором триместре (между пятнадцатой и двадцатой неделями беременности), хотя его можно сделать и позже (обычно после тридцать шестой недели), чтобы проверить, достаточно ли развиты легкие ребенка для родов. Результаты большинства тестов амниоцентеза доступны примерно через две недели.

Взятие проб ворсин хориона (CVS)

  • При взятии проб ворсин хориона (CVS) через брюшную полость вводится длинная тонкая игла для взятия небольшого образца клеток (называемых ворсинками хориона) из плаценты.Или катетер (тонкая пластиковая трубка) вводится во влагалище, а затем вводится через шейку матки, чтобы взять клетки из плаценты. Затем этот образец анализируют в лаборатории. CVS обычно выполняется раньше во время беременности, чем амниоцентез, чаще всего между десятой и двенадцатой неделями беременности. Результаты теста доступны в течение одной-двух недель.

Как амниоцентез, так и CVS считаются точными и безопасными процедурами пренатальной диагностики, хотя они представляют небольшой риск выкидыша и других осложнений.Вы должны обсудить преимущества и риски со своим врачом и, в некоторых случаях, с врачом. консультант по генетике.

Неинвазивное пренатальное тестирование (НИПТ) 

  • Во время беременности часть генетической информации (ДНК) ребенка попадает в кровоток матери. Неинвазивное пренатальное тестирование (NIPT) анализирует эту ДНК, чтобы проверить, есть ли у ребенка более высокая вероятность наличия определенных хромосомных нарушений. Образец крови берется у матери (не у ребенка) обычно после десятой недели беременности.Поскольку НИПТ включает забор крови только у матери, беременность не подвергается риску выкидыша или других осложнений. Результаты теста доступны в течение одной-двух недель. НИПТ — это скрининговый тест, который означает, что для подтверждения результатов может быть предложен амниоцентез или CVS.

Дополнительная информация:


Информация, содержащаяся на этом веб-сайте, не должна использоваться в качестве замены медицинской помощи и рекомендаций вашего педиатра.Могут быть варианты лечения, которые ваш педиатр может порекомендовать в зависимости от индивидуальных фактов и обстоятельств.

Пренатальное тестирование на синдром Дауна | Обучение пациентов

Скрининг-тесты

Последовательный интегрированный скрининг — Последовательный интегрированный скрининг предлагается всем беременным женщинам в штате Калифорния. Этот неинвазивный скрининг проводится в два этапа.

На первом этапе, который проводится между 10 и 14 неделями беременности, у матери берут образец крови и проводят ультразвуковое исследование воротникового пространства для измерения количества жидкости в задней части шеи ребенка.Если анализ крови запланирован до УЗИ, мы можем предоставить результаты в конце приема УЗИ. Результаты анализа крови, измерение воротникового пространства и возраст матери используются для оценки риска синдрома Дауна и трисомии 18.

Вторым этапом является анализ крови матери между 15 и 20 неделями беременности. Когда результаты этого анализа крови объединяются с результатами анализа крови в первом триместре и УЗИ воротникового пространства, частота выявления синдрома Дауна увеличивается.Этот тест также обеспечивает личную оценку риска рождения плода с трисомией 18, синдромом Смита-Лемли-Опица, открытым дефектом нервной трубки или дефектом брюшной стенки.

Диагностические тесты

Амниоцентез, биопсия ворсин хориона (CVS) и УЗИ являются тремя основными процедурами диагностического тестирования.

Амниоцентез — Амниоцентез чаще всего используется для выявления хромосомных проблем, таких как синдром Дауна. Когда известно, что плод подвержен риску, он может обнаружить другие генетические заболевания, такие как кистозный фиброз, болезнь Тея-Сакса и серповидно-клеточную анемию.

Процедура амниоцентеза для генетического тестирования обычно проводится между 15 и 20 неделями беременности. Под ультразвуковым контролем через брюшную полость вводят иглу для удаления небольшого количества амниотической жидкости. Затем клетки из жидкости культивируют и проводят анализ кариотипа — анализ хромосомного состава клеток. Получение результатов теста занимает около двух недель.

Амниоцентез выявляет большинство хромосомных нарушений, таких как синдром Дауна, с высокой степенью точности.Тестирование на другие генетические заболевания, такие как болезнь Тея-Сакса, обычно не проводится, но может быть обнаружено с помощью специализированного тестирования, если известно, что ваш плод находится в группе риска. Также может быть выполнено тестирование на дефекты нервной трубки, такие как расщепление позвоночника.

Существует небольшой риск выкидыша в результате амниоцентеза — примерно 1 из 100 или меньше. Частота выкидышей после процедур, проводимых в медицинском центре UCSF, составляет менее 1 на 350.

Взятие проб ворсин хориона (CVS) — Как и амниоцентез, взятие проб ворсин хориона чаще всего используется для выявления хромосомных проблем, таких как синдром Дауна.Он может обнаруживать другие генетические заболевания, такие как кистозный фиброз, болезнь Тея-Сакса и серповидно-клеточную анемию у плодов из группы риска. Основное преимущество CVS перед амниоцентезом заключается в том, что он проводится намного раньше во время беременности, в 10–12 недель, а не в 15–20 недель.

CVS включает удаление крошечного кусочка ткани из плаценты. Под ультразвуковым контролем ткань берется либо иглой, вводимой через брюшную полость, либо катетером, вводимым через шейку матки. Затем ткань культивируют и проводят анализ кариотипа хромосомного состава клеток.Получение результатов занимает около двух недель.

Преимущество CVS перед амниоцентезом заключается в том, что тест проводится намного раньше во время беременности, поэтому результаты обычно доступны к концу третьего месяца. Недостатком является то, что дефекты спинного мозга не могут быть обнаружены. Расширенный анализ крови на альфа-фетопротеин (АФП) или ультразвуковое исследование могут быть выполнены на более поздних сроках беременности для выявления дефектов спинного мозга.

Существует небольшой риск выкидыша в результате ССС — 1 из 100 или меньше.Частота выкидышей после процедур, проводимых в медицинском центре UCSF, составляет менее 1 на 350.

УЗИ — Основная цель УЗИ — определить состояние беременности — срок родов, размер плода и наличие у матери многоплодной беременности. УЗИ также может предоставить некоторую информацию о возможных врожденных дефектах плода.

Добавить комментарий

Ваш адрес email не будет опубликован.