Препараты для нормализации микрофлоры кишечника: Препараты для восстановления микрофлоры кишечника

Содержание

все вопросы… к микрофлоре кишечника?

Наш кишечник — «дом» для миллиардов микроорганизмов. Есть среди них полезные и вредные, взаимодействующие друг с другом и независимые. Их состав непостоянен, но главное — все они выполняют определенные функции и именно от них зависит наша способность противостоять вирусам и инфекциям. Иными словами, микрофлора кишечника определяет крепость иммунитета. Возникает вполне логичный вопрос о том, как заселить наши кишечники полезными бактериями и получить крепкое здоровье? Давайте разбираться.

Иммунитет и кишечник: взаимосвязь очевидна!

Если бы нас спросили: «Где находится иммунитет?», мы бы без раздумий ответили, что он в кишечнике. Именно здесь сосредоточены 80% иммунных клеток, которые стоят на страже нашего здоровья. Это задумано природой не случайно. Несмотря на то, что кишечник — внутренний орган, он постоянно контактирует с внешней средой. Все, что мы даем организму в качестве еды, поступает в него. Завтрак, обед, ужин, перекус — факторы риска для нашего кишечника, ведь в любой момент с продуктами в него могут опасть вредоносные микроорганизмы. Нужен какой-то «фильтр», который создаст мощную защиту для организма.

Этот «фильтр» формируется при нормальной микрофлоре. Когда в нашем пищеварительном тракте находятся исключительно нужные микроорганизмы в достаточном количестве, мы стойко противостоим всем внешним угрозам, прекрасно себя чувствуем, хорошо выглядим. Хорошая микрофлора кишечника способствует регуляции иммунных ответов на вторжение «агрессоров». Кроме того, здоровый ЖКТ – главное условие для правильного усвоения пищи и полезных компонентов, которые поступают в наш организм. Это очень важно, ведь недостаточно дать организму витамины и минералы. Нужно, чтобы они усвоились, а не прошли транзитом. Их всасывание происходит в кишечнике.

В свою очередь задача иммунитета – определить, кто для организма «свой», а кто «чужой». К первому он проявит толерантность, а навстречу второму пойдет в атаку. Если ЖКТ «говорит», что вещество полезно, организм принимает его. Этот механизм получил название иммунная толерантность. Это важнейшая функция иммунитета.

Какие бактерии живут в кишечнике

В нашем кишечнике проживает множество микроорганизмов, которые помогают вырабатывать устойчивость к возбудителям инфекций. Их общая масса у ребенка оставляет около полутора килограммов, у взрослого человека — до 4 кг. Их более 500 видов, численность — примерно 10% всех клеток организма.

Какие функции они выполняют?

  • Препятствуют размножению патогенной микрофлоры.

  • Отвечают за синтез аминокислот, витаминов группы B, C, K.

  • Продуцируют ферменты, необходимые для переваривания пищи.

  • Повышают усвояемость витамина D.

  • Способствуют укреплению иммунитета, так как стимулируют образование лимфоцитов.

  • Поддерживают выработку иммуноглобулинов.

  • Обеспечивают иммунный ответ при обнаружении чужеродных объектов.

Как нормализовать микрофлору кишечника

Хотите помочь своему кишечнику – дайте ему пробиотики и пребиотики. Что это за вещества и в чем между ними разница? Мы уже выяснили, что для иммунитета нужен здоровый кишечник. Если в организме нарушается баланс между дружественными и патогенными бактериями, растет число иммунных клеток, которые способствуют развитию воспаления. Главная опасность заключается в том, что часто этот процесс перерастает в хронический. Причем воспаления возможны не только в кишечнике, но и в других органах. Это чревато развитием различных заболеваний, ускоренными возрастными изменениями, ослаблением иммунитета.

Исправить ситуацию и устранить дисбаланс микрофлоры можно при помощи пробиотиков, пребиотиков и их сочетания.

Пробиотики

Пожалуй, многие слышали о пользе пробиотиков, но далеко не все знают, что это и как именно обеспечивается их благотворное влияние на микрофлору кишечника. Пробиотики — препараты с живыми бактериями, представителями нормальной микрофлоры.

В составе препаратов есть бифидобактерии, штаммы лактобацилл, стрептококков, лактококков, энтерококков, пропионибактерий и даже кишечной палочки. У каждого компонента свои уникальные биологические свойства.

Пробиотики принимают с такими целями:

  • минимизация риска инфицирования дыхательной системы;

  • предупреждение/лечение заболеваний желудочно-кишечного тракта;

  • эрадикация бактерии Helicobacter Pylori, которая провоцирует язвенную болезнь и даже рак желудка;

  • ослабление проявлений аллергических реакций;

  • борьба с лишним весом;

  • помощь при диабете;

  • снижение риска развития сердечно-сосудистых заболеваний;

  • терапия патологии мочеполовой системы.

Это неполный список случаев, когда полезен прием пробиотиков.

Пребиотики

Пребиотики — препараты, в которых не содержатся сами бактерии, но содержатся биологически активные компоненты, которые создают благоприятную среду для жизнедеятельности полезных микроорганизмов.

Они стимулируют рост нормальной микрофлоры кишечника, способствуют укреплению иммунитета. У них есть и другие полезные свойства, которые используются при выборе конкретных препаратов, исходя из текущего состояния организма.

Например, к пребиотикам относят пищевые волокна. Пример такого полезного компонента — кукурузный декстрин. Это основной ингредиент биологически активной добавки «Турбослим Активные волокна». Препарат способствует замедленному всасыванию глюкозы, за счет чего она не скапливается в жировых депо, а направляется по назначению.

Этот комплекс разработан для:

  • поддержания нормального уровня холестерина;

  • улучшения состояния кожи;

  • стимулирования выделительной системы, чтобы организму было легче избавляться от токсинов и продуктов метаболизма.

К пребиотикам относится множество компонентов, которые известны нам своими полезными свойствами, в том числе не связанными с воздействием на состояние кишечника. Это соевые и молочные пептиды, витамины А, С, Е, антиоксиданты, глутатион, коэнзим Q10, каротиноиды, ненасыщенные жирные кислоты, лизоцим, растительные экстракты (например, экстракт морских водорослей, тыквы, риса, моркови, чеснока). Список пребиотиков можно продлевать еще достаточно долго. И это далеко не полный перечень.

Синбиотики

Это еще одна группа препаратов, полезных для иммунитета и кишечника. Они менее известны, чем пробиотики и пребиотики, хотя на самом деле, не несут в себе ничего нового. По сути, это смесь одних и вторых. Препараты такого типа выпускает компания «Эвалар». Например, биологически активная добавка

«Мультифлора» — классический пример синбиотика нового поколения. В составе БАД — 7 видов бифидо- и лактобактерий, а также пребиотик инулин.

Препарат способствует:

  • укреплению иммунитета;

  • восстановлению микрофлоры кишечника – как в целях профилактики, так и для восстановления баланса после приема антибиотиков;

  • улучшению пищеварения;

  • ускоренному выведению токсинов;

  • сохранению красоты и молодости кожи.

Препарат представляет собой таблетки с двуслойной оболочкой. При поступлении в кишечник сохраняется его неизменный вид, что дает максимум пользы для здоровья. Этот продукт не требует особых температурных условий. Его можно хранить без холодильника, брать с собой в поездки, где существенно возрастает риск проблем с кишечником из-за стрессов, акклиматизации, нарушения режима питания.

У компании «Эвалар» есть еще одна хорошая добавка для организма — «Бифилар». Ее разработкой производитель занимался совместно с UAS Laboratories. Это американская компания, признанная во всем мире лидером в производстве высококачественных пробиотиков. Уникальность этого препарата заключается в комбинации фруктоолигосахаридов, бифидо- и лактобактерий. Такое сочетание дает высокую эффективность. В кишечнике «Бифилар» стимулирует рост полезных бактерий и способствует нормализации микрофлоры. Принцип действия препарата основан на использовании полезными бактериями фруктоолигосахаридов как питательной среды для жизнедеятельности.

Где купить?


А также спрашивайте в аптеках!

Правильное питание для здоровья ЖКТ

Основную поддержку нашему организму дает питание. Для здоровья кишечника стоит включить в свой рацион еду, богатую пищевыми волокнами. Клетчатка активирует моторную функцию кишечника и играет роль «фильтра», очищая ЖКТ.

Другие полезные советы по питанию:

  • сбалансируйте рацион по минерально-витаминному составу;

  • откажитесь от продуктов, употребление которых скорее вредно, чем полезно — копчености, сладкая газированная вода, чипсы, картошка фри, полуфабрикаты;

  • избегайте продуктов, которые содержат искусственные красители, консерванты;

  • замените жарку тушением, варкой на пару или запеканием;

  • сведите к минимуму употребление алкогольных напитков.

Помните, что не все проблемы с кишечником можно решить самостоятельно. Не забывайте консультироваться со специалистами и решать проблемы на ранней стадии их проявления.

Защищайте себя от стрессов и негативных эмоций. Они — серьезная угроза для иммунитета и здоровья кишечника. Занимайтесь спотом и мыслите позитивно, от этого минимум на 30% зависит здоровье вашей пищеварительной системы и организма в целом.

БАД. НЕ ЯВЛЯЕТСЯ ЛЕКАРСТВЕННЫМ СРЕДСТВОМ.


Производство пробиотической продукции | Инновационная компания

Способствуют восстановлению микрофлоры кишечника «ЖИВАЯ ЗАЩИТА ЖИВЫМИ БАКТЕРИЯМИ»                                                                                               

            Пробиотики – это живые микроорганизмы, которые при попадании в желудочно-кишечный тракт человека в достаточном количестве, сохраняют свою активность, жизнеспособность и оказывают положительное влияние на здоровье человека.

ООО «Инновационная компания  «Экобиос» в Медико-экологическом центре представляет препараты,  полученные с помощью уникальной технологии производства жидких концентратов живых бифидо- и лактобактерий. На сегодняшний день разработана  следующая  оздоровительная  продукция:

  • — «Соя-лактум» — комплексный биопродукт – жидкий препарат лактобактерий на основе гидролизатно-соевой среды;
  • — «Соя-бифидум» — комплексный биопродукт – жидкий препарат бифидобактерий на основе гидролизатно-соевой среды;
  • — «Эуфлорин®-L» — комплексный биопродукт – жидкий препарат лактобактерий на основе гидролизатно-молочной среды;
  • — «Эуфлорин-B»® — комплексный биопродукт – жидкий препарат бифидобактерий на основе гидролизатно-молочной среды;
  • — «Пробиотик на основе гидролизатно-соевой среды (ГСС)» — жидкий концентрат бифидобактерий;
  • — Закваска «Йогуртовая»  — функциональные компоненты,  необходимые для производства продуктов переработки молока: закваска    с маркировкой «Инновационная компания «Экобиос»  — жидкий препарат лактобактерий на основе гидролизатно-соевой среды;
  • — Квас «Пользишка» — Напиток обладает приятным освежающим вкусом, улучшает обмен веществ. Он утоляет жажду, бодрит и нормализует обменные процессы в организме. Обладает высокой энергетической ценностью, способствует пищеварению благодаря содержащимся в нем бифидобактериям, которые облегчают переваривание пищи, её всасывание и повышают аппетит. В «ПОЛЬЗИШКЕ»® содержатся витамины B1 и E, кальций, магний, фосфор, что объясняет его полезные свойства, а также — ценные ферменты и незаменимые аминокислоты, которые играют огромную роль в организме по разложению и выведению мертвых, больных и патологических клеток.  Пейте «Пользишку» на здоровье!

          ООО «Инновационная компания «Экобиос» — единственный в Оренбургской области производитель физиологичных для организма,  биологически активных   препаратов, основанных на использовании штаммов Bifidobacterium и Lactobacillus.  Технологии производства и наименования  пробиотиков защищены патентами на изобретение и товарными знаками России.

Уникальность пробиотиков, изготовленных ООО «Инновационная компания «Экобиос»:

  • в состав входят живые бактерии и продукты их жизнедеятельности: витамины, незаменимые аминокислоты и иммуномодулирующие вещества;
  • жидкие пробиотические препараты – это источник микроорганизмов для нормализации микрофлоры кишечника;
  • в их состав входят 5 миллиардов живых бифидо- и лактобактерий, и продукты их жизнедеятельности;
  • препараты разрешены для приема детям, начиная с раннего возраста, и взрослым;
  • не имеют противопоказаний, нетоксичны, не вызывают привыкания;
  • при изготовлении препаратов не используются генно-модифицированные компоненты и пищевые добавки.

       Более высокий эффект достигается в сочетании препаратов  лактобактерий и бифидобактерий.

 

Оздоровительная продукция соответствует   Техническим регламентам Таможенного союза   ТР ТС 021/2011; ТР ТС 022/2011; ТР ТС  029/2012, ТР ТС  033/2013. и производится  в соответствии  с документами:

  • СГР № RU.77.99.88.003.E.003978.10.18  от  12.09.2018 на основании  Экспертного Заключения ФГБУН  «ФИЦ питания и биотехнологии» № 529/Э-475/б-18  от 19.07.2018 г.;
  • СГР № RU.77.99.88.003.E.004460.10.18  от  10.10.2018 на основании  Экспертного Заключения ФГБУН  «ФИЦ питания и биотехнологии» № 529/Э-631/б-18  от 27.09.2018 г.;
  • СГР № RU.77.99.88.003.E.001036.03.19  от  22.03.2019 на основании  Экспертного Заключения ФБУЗ ФЦГ и Э  Роспотребнадзора № 10 ФЦ/612 от 14.03.2019 г.;
  • СГР № RU.77.99.88.003.E.001255.04.19  от  04.04.2019 на основании  Экспертного Заключения ФБУЗ ФЦГ и Э  Роспотребнадзора № 10 ФЦ/672 от 21.03.2019 г.;
  • Декларации о соответствии ЕАЭС № RU Д-RU/АГ81.В.20053 до 02.05.2023 г. на  основании Протокола  № 04706-314-1-18/БМ от 28.04.2018 г. Испытательной лаборатории ООО «Инновационные решения» ;
  • Декларация  о соответствии ЕАЭС № RU  Д-RU.АД53.В.02518 до 02.05.2023 г. на основании Протокола испытаний  № 4145 от 19.11.2018 г. Испытательного лабораторного центра Федерального бюджетного учреждения здравоохранения «Федерального центра гигиены и эпидемиологии» Роспотребнадзора.   

 Технические условия  (ТУ) 10.89.19-012-14498222-2018;

 Технические условия  (ТУ) 10.89.19-003-95665535-2019;

 Технические условия  (ТУ) 10.89.19-003-11908694-2018;   

 Технические условия (ТУ)  10.89.19-004-11908694-2018.

       Препараты используются:                                                                                                       

—      для нормализации микрофлоры кишечника    при  синдроме дисбактериоза     в  гастроэнтерологии,  колонопроктологии,  педиатрии,  оториноларингология,   дерматологии,   акушерстве  и гинекологии, урологии, аллергических и иммунодефицитных состояниях;

—        для уменьшения дисбиотического, токсического действия антибиотиков, цитостатиков, противотуберкулёзных препаратов, анальгетиков, стероидных гормонов и антидепрессантов;

—        для восстановления микрофлоры кишечника   онкологических больных, получающих химио- и лучевую терапию;

 —       при влиянии загрязнений окружающей среды , включая экозависимые заболевания;

—        при  эмоциональном и физическом стрессе.                                      

 Бифидо- и лактобактерии синтезируют достаточное количество важных для организма человека витаминов: витамины группы В, РР,  витамин Н, иммуностимулирующие вещества, незаменимые аминокислоты. 

Если Вам или Вашему ребёнку необходимо пройти курс лечения антибиотиками,   биопрепараты, выпускаемые  МЭЦ ООО «Инновационная компания «Экобиос»  помогут перенести это лечение без тяжёлых последствий для желудочно-кишечного тракта. 

Получить консультации и приобрести препараты можно по адресу:  г. Оренбург, ул. Карагандинская , 48А,   Торговый отдел «Будьте здоровы», тел. (3532) 70-31-84 и ул. Новая, 4/1 ,  2-ой этаж,  тел. (3532) 52-84-80.

Вы можете купить пробиотики «Экобиос» с доставкой на сайте www.экобиос.рф 

Новинки и хиты от «Энзифарм®» : комплексное здоровье ЖКТ и гепатобилиарной системы. — Гармония внутри

«Нерегулярный стул». «Диспепсия». «Боль в правом подреберье». «Тяжесть в животе». «Вздутие» и — о, боже! — «газы».

При здоровой микрофлоре — здоровый организм!

Неоднократно доказано, что неблагополучие пищеварительной системы (дисбиоз) может сказываться не только на «близлежащих» печени или почках, но и на сердце, легких и даже полости рта!

Дефицит лакто и бифидобактерий — распространенное явление, которое серьезно влияет на здоровье человека — может стать если не причиной, то кофактором инфекционных, аллергических, аутоиммунных или сердечнососудистых патологий. Поэтому сейчас ни у кого не вызывает сомнений целесообразность терапевтического подхода, применяемого при нарушениях работы ЖКТ, который направлен на нормализацию микрофлоры кишечника. Три новых опции для нормализации микрофлоры.

Для решения этой задачи в портфеле препаратов «Энзифарм®» появились три инновационных продукта, которые относятся к новому поколению синбиотиков (пребиотик+пробиотик) — комплексные диетические препараты БИФИДОБАКТЕРИН ЭНЗИФАРМ®, ЛАКТОБАКТЕРИН ЭНЗИФАРМ® И БІОСЕВЕН ЛАКТО®.

 

Синбиотики — новый класс препаратов, норма лизующих микрофлору, в состав которых включают пробиотики обязательно в комплексе с пребиотиками. Пробиотики — штаммы дружественных бактерий, вытеснябющие патогены из организма.

Пребиотики — органические углеводные компоненты, состоящие из молекул фруктозы и галактозы и стимулирующие рост дружественных микроорганизмов. Расщепляясь в кишечнике, пребиотик служит питательной средой для лакто и бифидобактерий.

 

 

БИФИДОБАКТЕРИН ЭНЗИФАРМ®

ЛАКТОБАКТЕРИН ЭНЗИФАРМ®

БІОСЕВЕН ЛАКТО®

Состав

лиофилизат живых клеток Bifidobacterium bifidum (пробиотик), играющих важную роль в обеспечении функции ЖКТ.

пребиотик лактулоза (10%) .

лиофилизат устойчивых штаммов лактобактерий

1. Lactobacillus plantarum 8P-A3,

2. Lactobacillus fermentum 90T-C4,

пребиотик инулин (10%)

лиофилизат семи устойчивых штаммов полезных бактерий:

1. Lactobacillus acidophilus LA 009/14,

2. Lactobacillus plantarum шт. 8P-A3,

3. Lactobacillus delbrueckii subsp. Bulgaricus 9702,

4. Lactobacillus fermentum 90-TC,

5. Lactobacillus rhamnosus LR 006/14,

6. Streptococcus thermophilus ST 010/19,

7. Bifidobacterium bifidum;

пребиотики инулин и лактулоза (по 10%).

Преимущества

Доступный в цене. Таргетное действие.

Доступный в цене. Таргетное действие.

Более высокая стоимость – более быстрый, мощный и комплексный эффект.

Особенности

Синбиотик первого поколения – препарат, содержащий один штамм бактерий.

 

Синбиотик– содержащий несколько штаммов дружественных бактерий.

 

Комбинированный препарат-синбиотик четвертого поколения, содержащий уникальные семь штаммов микроорганизмов-пробиотиков.


Пребиотики усиливают эффективность пробиотиков, пролонгируют их эффект. Именно поэтому синбиотики считаются более эффективными средства ми, чем традиционные пребиотические препараты.

Синбиотики от «Энзифарм®» гарантированно помогут откорректировать нарушения функции ЖКТ и гепатобилиарной системы, вне зависимости от того, насколько пострадала микрофлора пациента, или от причин дисбиоза.

Синбиотики могут быть рекомендоваными врачем в рационах диетического питания как источник дополнительного источника пробиотических бактерий и пребиотиков для нормализации качественного и количественного состава полезной микрофлоры кишечника при нарушении его баланса.

Синбиотики от Энзифарм®: тонкая настройка пищеварения.

Они имеют широкий спектр применения :

• при нарушении баланса микрофлоры кишечника (дисбактериозе) вследствие кишечных инфекций,

• при токсикоинфекциях, а также при диарее или запорах,

• для устранения проявлений диспепсии (вздутие живота, урчание, болевой синдром)

• при респираторных инфекциях,

• при кожных и аллергических заболеваниях;

• как общеукрепляющее средство, особенно в восстановительный период после перенесенных заболеваний, а также в качестве предоперационной подготовки и в послеоперационный период

• на этапе формирования оптимального рациона (диеты, в том числе при программах по снижению веса).

Синбиотики Энзифарм® можно (и нужно) сочетать с антибиотикотерапией — эта диетическая добавка снижает токсичное влияние антибактериальных препаратов на микрофлору ЖКТ, почки и печень.

пробиотик нового поколения для восстановления микрофлоры кишечника

Впервые о своих наблюдениях относительно бактерий и других микроорганизмов, обнаруженных в человеческих фекалиях, сообщил голландский исследователь Антони ван Аевенгук, который и выдвинул гипотезу о совместном существовании различных видов бактерий в желудочно-кишечном тракте. В 1850 году Луи Пастер развил концепцию о функциональной роли бактерий в ферментативном процессе.

В 1888 году Мечников, работая в Институте Пастера, обосновал теорию о том, что в кишечнике человека обитает комплекс микроорганизмов, которые оказывают на организм «аутоинтоксикационный эффект». Он полагал, что введение в желудочно-кишечный тракт «здравословных» бактерий способно стабилизировать действие кишечной микрофлоры и противодействовать интоксикации.

В 1917 году, еще до открытия сэром Александром Флемингом пенициллина, германский профессор Альфред Ниссле изолировал непатогенный штамм кишечной палочки из фекалий солдата Первой мировой войны, который не вызывал развития энтероколита во время тяжелой эпидемии шигеллеза. Бифидобактерия была впервые изолирована Анри Тиссье (Пастеровский институт) от новорожденного, получавшего грудное кормление, и названа им Bacillus bifidus communis. Тиссье утверждал, что бифидобактерии могут заменить протеолитические бактерии, вызывающие диарею, и рекомендовал введение бифидобактерий новорожденным, страдающим от этого синдрома.

Первое промышленное производство кисломолочного продукта питания — йогурта, — в основе создания которого были научные достижения Мечникова, было начато в 1919 году испанцем Исааком Карассо, который приобрел йогуртовую закваску в Пастеровском институте, где ранее и работал великий микробиолог. А уже его сын Даниэль (от его имени произошло название компании «Данон») добился признания йогурта во всей Европе.

В. Коллат в 1954 году впервые использовал термин «пробиотик», понимая под ним все важные для жизни организмы, в отличие от опасных «антибиотиков».

В 1965 г. Лилли и Стиллуэллом впервые был введен термин «пробиотики». В противоположность антибиотикам пробиотики были описаны как микробные факторы, стимулирующие рост других микроорганизмов.

В 1992 г. Havenaar R. и соавт. назвали пробиотиками жизнеспособные культуры микроорганизмов, которые применяются у животных и людей и оказывают полезное действие на их организм, улучшая свойства местной кишечной микрофлоры.

Стартовало производство синбиотика МАКСИЛАК® на заводе, оборудованном по стандартам GMP и ISO 9001.

Продукт МАКСИЛАК® зарегистрирован на территории Российской Федерации.

По итогам 2013 года МАКСИЛАК® вошел в ТОП-10 ведущих торговых наименований среди всех БАД по объему аптечных продаж, а так же занял I место среди категории БАД пробиотики и пребиотики (по данным AIPM — Remedium Market Bulletin, источник информации IMS Health).

Сентябрь
На Российском рынке появилась детская форма синбиотика МАКСИЛАК® — МАКСИЛАК® Бэби в саше, рекомендуется детям с рождения.

Декабрь
Бренд МАКСИЛАК® удостоился Ежегодной премии народного доверия «Марка № 1» в категории «Препарат для пищеварения».

По итогам марта 2016 года МАКСИЛАК® занял 2 позицию в ТОП-20 торговых наименований среди всех БАД по объему аптечных продаж (источник: «Ежемесячный розничный аудит фармацевтического рынка РФ» DSM Group).

МАКСИЛАК® — победитель в категории «Препарат для нормализации микрофлоры», по результатам общенационального голосования МАРКА № 1 в России.

МАКСИЛАК® Бэби стал победителем Фармацевтической премии Smartpharma® Awards 2020 Smartpharma® Awards 2020 — фармацевтическая премия, в которой победителей выбирают только специалисты, ежедневно рекомендующие препараты посетителям аптек: первостольники, провизоры, фармацевты, заведующие аптеками.

Апрель
Бренд МАКСИЛАК® расширяет свой портфель. На Российском рынке появилась форма Капли МАКСИЛАК® Бэби, содержащий в своём составе штамм Lactobacillus reuteri — один из наиболее изученных штаммов для детей с рождения со статусом безопасности пробиотиков QPS. Рекомендуется детям с рождения.
Июль
В линейке Максилак® появилась еще одна новинка – синбиотик Максилак Экпресс. Это инновационный продукт, выпускаемый в уникальной форме гранул, не требующих запивания водой, с приятным ягодным вкусом и удобным приёмом 1 раза в день. Он идеально подойдет для молодых активных людей, заботящихся о своем здоровье.

Профилирование живых бактерий для подготовки трансплантации фекальной микробиоты

Реферат

Трансплантация фекальной микробиоты — убедительное средство лечения рецидивирующих инфекций Clostridium difficile , с потенциальным применением против других заболеваний, связанных с изменениями микробиоты кишечника. Но изменчивость фекальных бактериальных сообществ, которые считаются терапевтическим средством, может усложнять или подрывать эффективность лечения. Чтобы понять влияние методов подготовки трансплантата на сообщества живых фекальных микробов, мы применили метод секвенирования ДНК (PMA-seq), который использует моноазид пропидия (PMA) для различения живых и мертвых фекальных микробов, и мы создали конвейер анализа для выявления отдельные бактерии, численность которых меняется между образцами.Мы обнаружили, что воздействие кислорода ухудшает фекальные бактериальные сообщества, тогда как циклы замораживания-оттаивания и время задержки между дефекацией донора и подготовкой трансплантата имели гораздо меньшие последствия. Примечательно, что численность Faecalibacterium prausnitzii — противовоспалительной комменсальной бактерии, отсутствие которой связано с воспалительным заболеванием кишечника, — уменьшалась под воздействием кислорода. Наши результаты показывают, что некоторые современные методы подготовки материала трансплантата микробиоты отрицательно влияют на микробный состав живых фекалий, и выделяют PMA-seq как ценный инструмент для информирования о передовых методах и оценки пригодности клинического фекального материала.

Образец цитирования: Чу Н.Д., Смит М.Б., Перротта А.Р., Кассам З., Альм Э.Дж. (2017) Профилирование живых бактерий для подготовки трансплантации фекальной микробиоты. PLoS ONE 12 (1): e0170922. https://doi.org/10.1371/journal.pone.0170922

Редактор: Erwin G. Zoetendal, Wageningen Universiteit, НИДЕРЛАНДЫ

Поступила: 23 сентября 2016 г .; Принят к печати: 12 января 2017 г .; Опубликован: 26 января 2017 г.

Авторские права: © 2017 Chu et al.Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Доступность данных: Доступ к данным можно получить в базе данных SRA Национального центра биотехнологической информации США в разделе BioSample SAMN04962333. Кроме того, в качестве дополнительных данных включены таблицы OTU и образцы метаданных, использованные в этом исследовании.

Финансирование: Этот проект частично поддержан грантом Центра микробиомной информатики и терапии Массачусетского технологического института.Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Я прочитал политику журнала, и у авторов этой рукописи есть следующие конкурирующие интересы: MBS, ZK являются сотрудниками OpenBiome и консультантами, научными консультантами и акционерами Finch Therapeutics. EJA — консультант и научный руководитель OpenBiome и Finch Therapeutics. Это не влияет на нашу приверженность политике PLOS ONE в отношении обмена данными и материалами.

Введение

Трансплантация фекальной микробиоты — передача фекальных микробов от донора к пациенту — стала чрезвычайно эффективным средством лечения рецидивирующих инфекций Clostridium difficile (коэффициент излечения ~ 90%), распространенной больничной инфекции, которая убивает почти 30 000 пациентов ежегодно [1,2]. Пересадка кала также перспективна для лечения других желудочно-кишечных заболеваний, таких как воспалительное заболевание кишечника и синдром раздраженного кишечника, и даже системных заболеваний, связанных с микробиотой кишечника, таких как ожирение [3].Однако на сегодняшний день эффективность фекальных трансплантатов доказана только при рецидивирующем C . difficile инфекций, и клинические испытания с использованием трансплантатов фекальной микробиоты для лечения воспалительного заболевания кишечника [4–9], синдрома раздраженного кишечника [10,11] и инсулинорезистентности [12] дали неоднозначные результаты.

Одной из самых серьезных проблем при трансплантации фекальной микробиоты является вариабельность терапевтического материала, которая возникает как из-за биологических вариаций, так и из-за вариаций, вносимых обработкой образцов.В отличие от фармацевтических препаратов, человеческий стул — его микробный и химический состав — сильно различается между людьми и между образцами, взятыми у одного и того же человека [13,14]. Однако многие заболевания связаны с определенными микробами и химическими веществами [13], что позволяет предположить, что состав фекального трансплантата может влиять на клиническую эффективность и побочные эффекты. Считается, что живые микробы являются терапевтическим агентом при трансплантации фекальной микробиоты [15], поскольку эти микробы колонизируют пациента-реципиента, потенциально приводя к длительным изменениям в кишечном бактериальном сообществе пациента [16].В результате подготовка, транспортировка и введение трансплантата, которые могут убить определенные бактерии, могут повлиять на клиническую эффективность, и передовой опыт активно обсуждается [3, 17–20]. Например, хотя современные стандартные методы включают аэробную подготовку, известно, что воздействие кислорода изменяет жизнеспособность фекальных бактерий, учитывая, что большинство видов являются облигатными анаэробами [17].

В случае рецидива C . difficile , такое предполагаемое аэробное разложение, по-видимому, мало влияет на клиническую эффективность [2].Однако по другим показаниям, когда терапевтический компонент плохо изучен, различия в живых бактериях могут значительно повлиять на клиническую эффективность. Например, испытания трансплантатов фекальной микробиоты при язвенном колите показали четырехкратные различия в эффективности у разных доноров, что позволяет предположить, что определенные бактериальные сообщества играют решающую роль [9].

Мы стремились охарактеризовать влияние типичных методов подготовки трансплантата на живые фекальные микробные сообщества. Мы обнаружили, что циклы замораживания-оттаивания и время задержки не сильно повлияли на состав сообщества живых бактерий, но воздействие кислорода во время смешивания образцов действительно оказало значительное влияние на жизнеспособность различных бактерий.Кроме того, наши результаты подтверждают, что PMA-seq является полезным инструментом для сравнения образцов фекальной микробиоты.

Main

Чтобы понять, как обращение с трансплантатом может изменить фекальные микробные сообщества, что может повлиять на терапевтическую эффективность, мы исследовали три потенциальных источника деградации: воздействие кислорода во время гомогенизации, циклы замораживания-оттаивания во время хранения и транспортировки трансплантата и время задержки между дефекацией и подготовка к пересадке. Для каждого эксперимента мы подготовили два отдельных образца стула от одного и того же донора и разделили каждый образец на подвыборки для анализа с использованием различных методов подготовки трансплантата, таким образом контролируя вариации между образцами фекалий.После подготовки трансплантата мы затем разделили каждую подвыборку на три технических повтора. Мы использовали кПЦР для оценки общего содержания 16S рРНК. Затем мы оценили микробный состав репликатов с использованием стандартного секвенирования 16S рРНК [21,22] и PMA-seq, который избирательно секвенирует ДНК бактерий с интактными клеточными мембранами — прокси для живых клеток [23-25].

На основе данных секвенирования мы сгенерировали две таблицы операционных таксономических единиц (OTU), одну с 1362 OTU, сгруппированными с 97% -ным сходством (данные S1), а другую с 77 с высокой степенью достоверности OTU — присутствующими во всех выборках секвенирования — сгруппированными по 100 % сходства (данные S2).

Воздействие кислорода во время гомогенизации фекалий изменяет состав живых фекальных бактерий

Чтобы проверить влияние воздействия кислорода на фекальные бактерии во время гомогенизации пробы стула, мы подготовили подвыборки из двух проб стула от одного донора, используя пять различных процедур, каждая с разным уровнем воздействия кислорода (материалы и методы; S1, рис.). Чтобы гарантировать, что любые паттерны, которые мы наблюдали из PMA-seq, не были процедурными артефактами, мы также секвенировали контроли PMA-seq, которые заменяли PMA водой для некоторых препаратов трансплантата (см. Материалы и методы; S2 Рис).

Мы обнаружили, что общая численность 16S рРНК снижалась с увеличением воздействия кислорода, что указывает на то, что воздействие кислорода снижает количество жизнеспособных клеток (S3 фиг.). Эта деградация отражалась как в необработанных репликах, которые захватывали ДНК из живых клеток, мертвых клеток и свободно плавающей ДНК, не связанной с клеткой, так и в репликах, обработанных PMA, которые захватывали только ДНК в живых клетках (S3 Рис.).

Чтобы понять, какие бактерии были поражены, мы проанализировали результаты секвенирования 16S рРНК.Стандартное секвенирование 16S рРНК показало небольшое увеличение бета-разнообразия (несходство Брея-Кертиса) с увеличением воздействия кислорода, но эти различия были намного более четкими в данных PMA-seq во всех сравнениях (рис. 1а, рис. S4). Сравнение с контролем подтвердило, что наблюдаемые нами изменения были в значительной степени из-за исключения незащищенной ДНК PMA, а не других этапов процесса PMA-seq (S2 Рис). Эти результаты подтвердили, что PMA-seq более четко отражает изменения в бактериальном составе из-за дифференциального воздействия кислорода, чем стандартное секвенирование 16S.

Рис. 1. PMA-seq выявляет изменения в составе бактериального сообщества при воздействии кислорода.

(a) Бета-разнообразие (несходство Брея-Кертиса) между подвыборками, приготовленными с различными уровнями воздействия кислорода, указывает на то, что PMA-seq обнаруживает большее несходство, чем стандартное секвенирование 16S. (b) Бета-разнообразие между стандартным секвенированием 16S рРНК и результатами PMA-seq также отражает степень воздействия кислорода. Данные были получены из того же образца стула и того же препарата кислорода, секвенированы с использованием стандартного секвенирования 16S рРНК или PMA-seq.(c – d) PMA-seq также обнаруживает изменения в количестве отдельных OTU в большей степени, чем стандартное секвенирование 16S. (c) Относительная численность ОТЕ из родов Faecalibacterium и Megamonas в значительной степени уменьшалась при воздействии кислорода, тогда как относительная численность ОТЕ из Bacteroides увеличивалась. Этот сигнал был сильнее в результатах PMA-seq. Каждая точка представляет собой среднее изменение относительной численности одной OTU в трех технических повторностях. (d) Наш аналитический метод выявил отдельные OTU, относительное содержание которых значительно изменилось между различными препаратами кислорода, многие из которых не были бы обнаружены с помощью стандартного секвенирования 16S.Сокращения методов подготовки трансплантата: АНК, анаэробный + цистеин; АНА, анаэробный; AEC, аэробный + цистеин; AER, аэробный; АРС, аэробика + барботаж.

https://doi.org/10.1371/journal.pone.0170922.g001

Учитывая, что PMA-seq отражает только живые бактерии, а стандартное секвенирование 16S рРНК должно более точно отражать все бактериальное сообщество, мы предположили, что сравнение результатов секвенирования каждый из этих методов может дать представление о степени деградации бактериального сообщества.Мы обнаружили, что значения бета-разнообразия между секвенированием 16S рРНК и результатами PMA-seq для одной и той же подвыборки увеличивались с увеличением воздействия кислорода (рис. 1b). Этот результат предполагает, что сравнение результатов стандартного секвенирования 16S рРНК и PMA-seq может дать представление о деградации живых бактерий в фекальном материале.

Наши результаты PMA-seq также проливают свет на то, как определенные бактериальные таксоны реагируют на кратковременное воздействие кислорода, что в конечном итоге может повлиять на терапевтическую эффективность. Оказалось, что кислород оказывает наибольшее негативное влияние на численность бактерий из филума Firmicutes (рис. 2).В частности, численность двух из четырех наиболее распространенных родов от одного донора — Megamonas и Faecalibacterium (sp. prausnitzii ) — равномерно снизилась в обоих исследованных образцах стула (Рис. 1c, S4 Рис. и аэробная подготовка, двусторонний тест Стьюдента t , t = 6,293, P = 0,0033 и t = 7,494, P = 0,0017 соответственно). Мало что известно о роли, которую Megamonas играет в микробиоте кишечника [26,27]. Считается, что Faecalibacterium prausnitzii обладает противовоспалительными свойствами в кишечнике и помогает смягчать или предотвращать такие заболевания, как воспалительные заболевания кишечника [28,29]. Ф . prausnitzii продуцирует короткоцепочечные жирные кислоты, которые помогают регулировать иммунные клетки хозяина [30] и являются предпочтительным источником энергии эпителиальных клеток толстой кишки [31]. Таким образом, за счет снижения жизнеспособности F . prausnitzii клеток во время воздействия кислорода, мы можем поставить под угрозу терапевтическую ценность материала фекального трансплантата.

Рис. 2. Таксономическая реакция кластера на воздействие кислорода.

Филогения высоко достоверных ОТЕ с изменением их численности от препаратов АНК до трансплантата AER. PMA-seq выявил кластерные ответы на воздействие кислорода. Изобилие Firmicutes, особенно из Megamonas и Faecalibacterium , уменьшилось при воздействии кислорода, в то время как из Bacteroides увеличилось. Разветвления с поддержкой начальной загрузки более 90% аннотируются.

https://doi.org/10.1371/journal.pone.0170922.g002

Мы также идентифицировали устойчивые к кислороду бактерии, такие как Bacteroides , Parabacteroides , Barnesiellaceae и Rikenellaceae, относительная численность которых увеличилась (рис. 1c). и 2, S4 рис.). Мы выдвинули гипотезу, что эти увеличения были композиционными эффектами — которые возникают потому, что мы измеряем пропорции, а не подсчитываем напрямую — поскольку мы ожидали небольшого роста или его отсутствия во время краткой обработки образцов и хранения в морозильной камере.Действительно, многие из этих очевидных увеличений были сглажены путем нормализации данных к общему размеру сообщества (S3, рис.). OTU из рода Bacteroides чаще всего определялись как устойчивые к кислороду в наших данных, что согласуется с предыдущими данными о том, что некоторые виды Bacteroides могут выживать или даже расти в течение коротких периодов воздействия кислорода [32].

Чтобы идентифицировать отдельные OTU, численность которых значительно изменилась между различными препаратами трансплантата, мы создали конвейер анализа на основе texmex [33], который моделирует анализ микробного сообщества с использованием логнормального распределения Пуассона (см. Материалы и методы, Рис. 1d, S5 Рис. ).Используя этот конвейер и нашу таблицу ОТЕ с высокой степенью достоверности, мы обнаружили, что ОТЕ, численность которых значительно уменьшилась во время воздействия кислорода, чаще всего принадлежали к родам Faecalibacterium , Megamonas и Bifidobacterium , что отражает общие таксономические сдвиги (S1 Стол). Увеличившиеся OTU часто принадлежали Bacteroides , в том числе B . ovatus , B . униформа и B . caccae (Таблица S1).

Хотя ответы на воздействие кислорода отдельными OTU в значительной степени отражали паттерны более крупных таксономических групп, PMA-seq обнаружил некоторую неоднородность в этих ответах (S6 Рис). Например, не все наиболее распространенные OTU в пределах рода Oscillospira демонстрировали одинаковую динамику в ответ на воздействие кислорода (S6, рис.).

Циклы замораживания-оттаивания и время задержки в меньшей степени влияют на бактериальный состав фекалий

Помимо воздействия кислорода во время гомогенизации, мы также использовали PMA-seq для оценки эффектов циклов замораживания-оттаивания и времени задержки — общих проблем при работе с образцами кишечной микробиоты.Для экспериментов по замораживанию-оттаиванию мы подготовили два образца стула в соответствии с нашим протоколом анаэробный + цистеин (см. «Материалы и методы») и позволили им заморозить и оттаять в течение указанного количества циклов. Для экспериментов с задержкой мы оставили подвыборки двух образцов стула в шкафу биобезопасности на определенное время, прежде чем подготовить их с помощью нашего протокола анаэробных + цистеин. Как и в случае воздействия кислорода, мы повторили каждый из этих экспериментов с двумя отдельными образцами стула от одного донора.

Мы обнаружили, что состав бактериального сообщества оставался в значительной степени стабильным в ответ на циклы замораживания-оттаивания (рис. 3, S7, рис.) И не претерпевал значительных изменений по времени задержки (рис. 4, S8, рис.), Даже после 20 циклов замораживания-оттаивания. или 7 часов задержки. Результаты бета-разнообразия в обоих экспериментах показывают, что сообщества в целом действительно изменились с увеличением количества циклов замораживания-оттаивания (рис. 3a) и более длительным запаздыванием (рис. 4a), но изменения с циклами замораживания-оттаивания и временем запаздывания были меньше, чем у нас. наблюдаемые в наших экспериментах по воздействию кислорода (рис. 1).Бета-разнообразие между результатами секвенирования 16S и PMA-seq отражало количество циклов замораживания-оттаивания (рис. 3b), но не продолжительность задержки (рис. 4b). Эти результаты также предполагают, что сравнение этих двух методов секвенирования может служить косвенным показателем общего беспокойства сообщества, но не может охватить все типы стресса, особенно стрессы, в равной степени влияющие на все бактерии, которые не могут быть зафиксированы измерениями относительной численности.

Рис. 3. PMA-seq регистрирует небольшое изменение живого бактериального сообщества при большем количестве циклов замораживания-оттаивания.

(a) Бета-разнообразие между подвыборками из различных препаратов замораживания-оттаивания отражало беспокойство сообщества, но значения несходства были ниже, чем для воздействия кислорода. (b) Бета-разнообразие между стандартным секвенированием 16S рРНК и результатами PMA-seq отражало количество циклов замораживания-оттаивания. (c) OTU трех доминирующих родов не показали единообразных реакций на циклы замораживания-оттаивания.

https://doi.org/10.1371/journal.pone.0170922.g003

Рис. 4. PMA-seq регистрирует небольшие изменения живого бактериального сообщества с более длительным временем задержки.

(a) Бета-разнообразие между подвыборками, полученными с разным временем задержки, также отражало беспокойство сообщества, но значения несходства были ниже, чем для воздействия кислорода. (b) Бета-разнообразие между стандартным секвенированием 16S рРНК и результатами PMA-seq не отражало более длительное время задержки, предполагая, что время задержки не сильно повлияло на общий состав сообщества. (c) OTU трех доминантных родов не показали единообразных реакций на разное время задержки.

https: // doi.org / 10.1371 / journal.pone.0170922.g004

Из наших нормализованных данных кажется, что циклы замораживания-оттаивания имели небольшое отрицательное влияние на общую численность живых бактерий, причем большая часть этого эффекта происходила после одного цикла замораживания-оттаивания. (S9 Рис). Наши препараты фекальной микробиоты содержали глицерин в качестве криопротектора, который должен был ослабить любое влияние циклов замораживания-оттаивания на бактериальный состав и общую численность. Отсутствие сильных изменений в составе сообщества предполагает, что стресс из-за циклов замораживания-оттаивания с этим методом подготовки менее специфичен для определенных таксонов, чем кислородный стресс.

Оказалось, что более длительное время задержки снижает общую численность бактерий (S10 Рис). Мы подозреваем, что увеличение общего размера сообщества в образце стула 6 (S10 рис.) Является артефактом обращения: поскольку мы оставили подвыборки полностью открытыми в шкафу биобезопасности, они значительно высохли во время эксперимента, что привело к получению более толстых и жестких материалов. Мы предполагаем, что время задержки мало повлияло на состав бактерий, потому что это образование сухого жесткого внешнего слоя могло защитить внутреннее микробное сообщество от воздействия кислорода, разрушая при этом все микробы, пойманные внутри внешнего слоя.

Отражая наш анализ разнообразия, несколько отдельных OTU или таксонов были надежно идентифицированы как значительно уменьшившиеся или увеличившиеся в численности с различным количеством циклов замораживания-оттаивания или длительностью лагов (рис. S5, таблица S1). Одна OTU из Bifidobacterium действительно уменьшалась с циклами замораживания-оттаивания, в то время как некоторые OTU из Faecalibacterium и Megamonas были чувствительны к времени задержки, возможно, из-за воздействия кислорода (таблица S1). Наши статистические методы показали, что распределение изменений численности отдельных OTU между замораживанием-оттаиванием и приготовлениями с задержкой напоминало нашу нулевую модель, что дополнительно указывает на то, что сообщество было в значительной степени нетронутым (S5, рис.).Напротив, одинаковые распределения для разных препаратов кислорода резко различались (S5 Рис.), Подчеркивая сдвиг в составе сообщества.

Наши результаты показывают, что умеренное количество циклов замораживания-оттаивания и умеренное время задержки — особенно если пробы стула покрыты — не изменяют фекальные микробные сообщества так сильно, как воздействие кислорода во время гомогенизации, и на самом деле могут не сильно влиять на терапевтическую эффективность.

Обсуждение

Хотя в предыдущих исследованиях оценивалось влияние различных методов сбора и хранения на экстракцию 16S рРНК [34–37], насколько нам известно, наш первый анализ того, как эти переменные изменяют представление о живых бактериях.Наши результаты подтверждают распространенное предположение, что воздействие кислорода ухудшает состав жизнеспособных фекальных микробов [3,38,39]; они также поддерживают идею о том, что умеренное количество циклов замораживания-оттаивания и время задержки могут лишь минимально повредить микробному сообществу. Воздействие кислорода непропорционально сильно повлияло на бактерии из типа Firmicutes, особенно из родов Megamonas и Faecalibacterium , в то время как бактерии из рода Bacteroides оказались более устойчивыми к кислороду (рис. 2).Представители всех трех родов обычно считаются строго анаэробными [28,32,40], что позволяет предположить, что информации об условиях роста одной может быть недостаточно, чтобы предсказать, как таксоны бактерий в сложных сообществах будут реагировать на стресс.

В настоящее время неизвестно, могут ли эти изменения микробного сообщества повлиять на терапевтический потенциал. С одной стороны, существующая практика подготовки фекальных трансплантатов для лечения C . Инфекции difficile связаны с обработкой в ​​аэробных условиях [3,39] и замораживанием фекалий [39,41,42].Тем не менее лечение обычно бывает успешным, поэтому маловероятно, что эти методы повлияют на терапевтическую эффективность этой инфекции. С другой стороны, некоторые из бактерий, наиболее негативно пострадавших от воздействия кислорода, включали противовоспалительную бактерию F . праусницы [28]. Если F . prausnitzii обладает терапевтическими эффектами — как было установлено при воспалительных заболеваниях кишечника [28,29] — аэробная обработка фекальных трансплантатов может снизить терапевтическую эффективность при лечении воспалительных заболеваний.

Деградация микробного сообщества с увеличением воздействия кислорода указывает на терапевтическую эффективность трансплантатов фекальной микробиоты, особенно при заболеваниях, отличных от C . Инфекция difficile может быть наилучшим образом сохранена путем поддержания анаэробных условий во время обработки образцов (например, с помощью анаэробных камер и бескислородных буферов) и хранения (например, с помощью непроницаемых для кислорода контейнеров и мониторинга воздействия кислорода). Относительно меньшие эффекты, которые мы наблюдали от циклов замораживания-оттаивания и времени задержки, предполагают, что гибкость в этих аспектах обработки и доставки фекалий может не сильно влиять на последующую эффективность.

Наши эксперименты по методам подготовки трансплантатов фекальной микробиоты предполагают, что PMA-seq может предоставить ценный инструмент для оценки того, как идентифицировать, подготовить и управлять такими трансплантатами для повторяющихся трансплантатов C . difficile инфекции и другие показания. Другие методы количественной оценки бактериальных сообществ — такие как секвенирование 16S-рРНК, кПЦР или флуоресцентная микроскопия — либо не позволяют идентифицировать отдельные бактериальные таксоны, либо не нацелены только на живые клетки, которые предположительно являются терапевтическим агентом трансплантатов фекальной микробиоты.Устраняя эти недостатки, PMA-seq может обеспечить контроль качества и уменьшить источники вариабельности трансплантатов фекальной микробиоты.

Материалы и методы

Пробоподготовка

Чтобы подготовить трансплантаты фекальной микробиоты для анализа PMA-seq, мы использовали модифицированные протоколы, основанные на стандартных методах OpenBiome (http://www.openbiome.org/), крупнейшего банка стула в США. Все коллекции человеческого стула и процедуры согласия субъектов были рассмотрены и одобрены институциональным наблюдательным советом Массачусетского технологического института, номер утверждения 1510271631.Все участники дали письменное согласие.

Чтобы изучить, как воздействие кислорода влияет на фекальное микробное сообщество, мы использовали PMA-seq для оценки образцов стула, обработанных в различных кислородных условиях. Мы подготовили два образца стула от одного донора с пятью различными протоколами подготовки фекальной микробиоты с различными уровнями воздействия кислорода (S1, рис.). Мы перенесли каждый образец стула в анаэробную камеру (Coy) в течение 30 минут после прохождения. Мы разделили стул на четыре подвыборки по 30 г.Для каждой из этих четырех подвыборок мы приготовили трансплантат фекальной микробиоты, варьируя два фактора: буфер, используемый для гомогенизации стула, и среду, в которой стул был гомогенизирован. Мы использовали два похожих буфера: один из 50% глицерина, 50% физиологического раствора (0,9% NaCl) и 0,1% L-цистеинового буфера, а другой — из 50% глицерина плюс 50% физиологического раствора. L-цистеин — это восстановитель, который реагирует с кислородом, удаляя его из раствора. Что касается среды гомогенизации, мы гомогенизировали стул либо в анаэробной камере, либо в аэробных условиях окружающей среды.Для подобразцов, приготовленных в анаэробных условиях, мы предварительно восстановили каждый буфер для гомогенизации, оставив его в анаэробной камере как минимум на 48 часов. Эта процедура привела к четырем различным препаратам: анаэробный + цистеин, анаэробный, аэробный + цистеин и аэробный. Для окончательной подготовки (аэробная + промывка) мы поместили половину аэробного гомогената фекалий в герметичную стеклянную бутыль с питательной средой и продули гомогенат воздухом в течение 30 мин.

Мы гомогенизировали все 30-граммовые образцы в отдельных фильтровальных пакетах Whirl-Pak (Nasco) с 150 мл буфера.Мы перенесли каждый фильтровальный мешок в автоматический гомогенизатор easyMix (AES Chemunex) и гомогенизировали содержимое в течение 60 с. Затем мы перенесли аликвоты 498,75 мкл гомогената стула в пробирки с завинчивающейся крышкой, которые мы запечатали во вторичные стеклянные контейнеры с завинчивающейся крышкой и заморозили при –80 ° C в ожидании дальнейшей обработки.

Чтобы проверить влияние циклов замораживания-оттаивания на фекальные бактерии, мы подвергали трансплантаты фекальной микробиоты 0, 1, 5 и 20 циклам замораживания-оттаивания. Для этого эксперимента мы подготовили два образца стула от одного и того же донора, следуя нашему протоколу анаэробный + цистеин.Мы подготовили шесть пробирок с гомогенатом кала из каждого из этих образцов стула в качестве нашей подвыборки с нулевым циклом замораживания-оттаивания, а остальные мы перенесли в морозильную камеру с температурой –80 ° C как минимум на 3 часа. Затем мы позволили этим образцам разморозиться при комнатной температуре в течение 30 минут, прежде чем вернуть их в морозильную камеру на 3 часа для указанного количества циклов.

Мы также проверили влияние времени задержки на фекальную микробиоту. Для этих экспериментов мы перенесли каждый из двух образцов стула в анаэробную камеру и разделили каждый образец на пять подвыборок по 50 г каждая.Одна подвыборка была обработана немедленно как нулевой момент времени. Мы удалили оставшиеся образцы из анаэробной камеры и перенесли их в шкаф биобезопасности. Затем мы подготовили каждую подвыборку по истечении указанного времени воздействия (0,5, 1, 3 и 7 ч; 1 ч является стандартным пределом для OpenBiome). Затем мы подготовили каждую подвыборку в соответствии с нашим протоколом анаэробный + цистеин.

PMA для исключения незащищенной ДНК

Чтобы идентифицировать живые бактерии в каждом препарате фекальной микробиоты из всех трех экспериментов, мы использовали PMA для исключения ДНК из бактерий с нарушенной структурой мембраны, используя протокол, предложенный производителем.Далее мы разделили подвыборки из всех экспериментов на шесть технических повторов, три из которых мы проанализировали с помощью PMA-seq, а три из которых мы проанализировали с помощью стандартного секвенирования 16S. Для повторений PMA-seq мы добавили 1,25 мкл 20 мМ красителя PMA (Biotium) к каждой аликвоте гомогената стула до конечного объема 500 мкл и конечной концентрации 50 мкМ PMA. Мы накрыли аликвоты алюминиевой фольгой и инкубировали их при комнатной температуре в течение 5 минут, перемешивая каждую минуту. Затем мы удалили алюминиевую фольгу и фотолизовали аликвоты на льду под светодиодной лампой (Taotronics TT-AL09) в течение 30 минут, вращая их каждые 10 минут.После фотолиза мы экстрагировали ДНК с помощью набора для экстракции ДНК PowerSoil (MoBio). Параллельно мы также экстрагировали ДНК из неизмененных аликвот фекального гомогената для стандартного секвенирования 16S рРНК. Чтобы гарантировать, что любой сигнал, который мы наблюдали в результатах PMA-seq, не был результатом инкубации и фотолиза, мы также запускали контроли, которые заменяли 1,25 мкл 20 мМ красителя PMA водой и подвергали той же процедуре, что и для PMA-seq.

Подготовка и анализ библиотеки Illumina

Из этих обработанных PMA и необработанных образцов ДНК мы затем подготовили библиотеки 16S рРНК, используя двухэтапный протокол ПЦР [22] для определения состава бактериального сообщества.Во-первых, мы количественно определили концентрации экстрагированной ДНК, используя стандартный протокол кПЦР SYBR Green с полимеразой Phusion (New England Biolabs; используется для всех реакций ПЦР) и праймерами PE16S_V4_U515_F и PE16S_V4_E786_R (таблица S2). Мы разводили все образцы ДНК до концентрации наиболее разбавленного образца ДНК и использовали 2 мкл каждого образца ДНК для реакции ПЦР с праймерами PE16S_V4_U515_F и PE16S_V4_E786_R (таблица S2) и программой 98 ° C в течение 30 с [98 ° C для 30 с, 52 ° C в течение 30 с, 72 ° C в течение 30 с] на 20 циклов, выдержка 4 ° C.Для каждого образца ДНК мы провели четыре реакции ПЦР по 25 мкл, которые мы затем объединили, очистили с помощью гранул SPRI AmpureXP и элюировали 40 мкл буфера для элюции. Для второй реакции ПЦР мы использовали 4 мкл предыдущего продукта ПЦР с праймерами PE-PCR-III-F и PE-PCR-IV-штрих-код в четырех реакциях по 25 мкл с циклом ПЦР при 98 ° C в течение 30 с [98 ° C в течение 30 с, 83 ° C в течение 30 с, 72 ° C в течение 30 с] на 7 циклов, выдержка 4 ° C. Мы объединили каждый набор из четырех реакций ПЦР и очистили реакции с помощью гранул SPRI. Мы количественно оценили концентрации библиотеки, используя другую кПЦР SYBR Green с праймерами BMC Final F и R (таблица S2).Мы мультиплексировали библиотеки ДНК, чтобы они имели одинаковый входной ДНК. Библиотеки секвенировали на одном наборе дорожек Illumina MiSeq для парных считываний 250 пар оснований.

Мы очистили, объединили и отфильтровали необработанные чтения последовательностей с парным концом, используя параметры по умолчанию в UPARSE [43], и сгруппировали данные в OTU, используя 97% порог идентичности в QIIME [44]. Мы использовали настройки QIIME по умолчанию, чтобы удалить последовательности химер [45], выбрать de novo OTU [46] и назначить таксономию [47,48]. Мы присвоили таксономию каждой OTU на основе выпуска в августе 2013 г. базы данных рДНК Greengenes [47].Мы исключили OTU, которые не появлялись как минимум в двух выборках. Мы использовали результаты количественной ПЦР из первоначальной количественной ПЦР каждого образца ДНК, чтобы нормализовать наши результаты относительной численности.

Идентификация OTU, количество которых значительно изменилось

Чтобы идентифицировать OTU, которые значительно различались по численности между препаратами трансплантата, мы построили конвейер анализа, который включал два основных шага: во-первых, подгонку данных об изобилии OTU из каждого образца ДНК к логнормальному распределению Пуассона, что позволяет проводить перекрестные сравнения, а во-вторых, , подгоняя эти сравнения к обобщенному нормальному распределению, которое обеспечивает нулевую модель, с которой мы могли бы сравнивать и, таким образом, идентифицировать OTU со значительными изменениями в численности.

Для первого шага анализа мы начали с создания таблицы OTU с высоко достоверными OTU. Чтобы создать эту таблицу, мы сначала сгруппировали данные секвенирования с использованием DADA2 и параметров и процедур по умолчанию [49]. Затем мы отфильтровали OTU, которые присутствовали во всех образцах ДНК, в результате чего была получена таблица из 77 OTU с высокой степенью достоверности, где самые редкие OTU составляли 0,15% от всех считываний. Мы подогнали численность OTU из отдельных образцов ДНК к логнормальному распределению Пуассона с использованием pytexmex, реализации texmex на языке Python [33].Предыдущие исследования показали, что логнормальное распределение Пуассона является подходящей статистической моделью для микробных сообществ во многих различных средах обитания, включая микробиом человека [33].

Используя эту модель, мы затем рассчитали две метрики для каждой OTU, z и F , которые затем можно было сравнить по образцам ДНК, чтобы оценить изменения в содержании OTU в одном образце по сравнению с другим. Метрика z отражает нормализованную численность каждой OTU в рамках логнормального логарифма Пуассона.Метрика F отражает, как численность каждой OTU сравнивается с численностью всех других OTU в этом образце ДНК (т. Е. Положение OTU в логарифмически нормальном распределении Пуассона для этого образца ДНК). Для данной OTU сравнения этих показателей (Δ z и Δ F ) между двумя образцами ДНК, таким образом, отражали изменение нормированной численности OTU и изменение положения OTU в распределении численности из каждого образца [33 ].

На втором этапе анализа мы стремились создать статистическую основу для выявления OTU с предположительно значимыми показателями Δ z и Δ F между различными препаратами трансплантата.Чтобы построить нашу нулевую модель, мы использовали различия между техническими повторениями одного и того же препарата трансплантата и одного и того же образца стула. Таким образом, для данной пары препаратов трансплантата (из одного и того же образца стула) мы сначала вычислили все возможные значения Δ z и Δ F — для каждой OTU — среди технических копий каждого препарата. Затем мы подгоняем эти значения к обобщенному нормальному распределению (S5, рис.), Чтобы создать нашу «нулевую модель» значений, ожидаемых от технических вариаций, но не от биологических вариаций.

Чтобы идентифицировать OTU, у которых значения Δ z и Δ F были значительно больше или меньше, чем значения, ожидаемые от технических вариаций, мы затем вычислили значения Δ z и Δ F для каждой OTU в разных препаратах трансплантата. Мы считали те OTU, у которых значения Δ z и Δ F выходили за пределы 95% распределения нулевой модели — значения, которые имели только 5% шанс встретиться при сравнении технических повторений, — как предположительно значимые (S5 Рис.).Мы дополнительно урезали эти OTU, чтобы включить только те OTU, которые имели значительно большие (или меньшие) значения Δ z и Δ F во всех попарных повторных сравнениях. Мы определили, что эти заключительные OTU значительно изменились по численности. На значения Δ z , как правило, не влияла общая численность каждой OTU (S11 рис.), Но значения Δ F были (рис. S12), что означает, что значения Δ F могут быть более подвержены смещению.

Доступ к данным можно получить в базе данных SRA Национального центра биотехнологической информации США в разделе BioSample SAMN04962333.

Вспомогательная информация

S2 Рис. Элементы управления PMA-seq H

2 O проверяют, что PMA, а не другие этапы обработки PMA-seq, изменяют результаты секвенирования 16S.

(a) Бета-разнообразие между контролями H 2 O, стандартное секвенирование 16S и результаты PMA-seq. (b) Сложенные столбчатые диаграммы и (c) отдельные столбчатые диаграммы относительной численности бактериальных родов в анаэробных + цистеиновых и аэробных препаратах на основе данных, полученных с использованием стандартного секвенирования 16S, PMA-seq и контролей H 2 O.

https://doi.org/10.1371/journal.pone.0170922.s002

(EPS)

S4 Рис. Необработанные данные о содержании для экспериментов по воздействию кислорода.

Данные двух образцов стула, приготовленных с различной степенью воздействия кислорода и проанализированных с использованием стандартного секвенирования 16S или PMA-seq. (а) гистограммы с накоплением и (б) отдельные гистограммы относительной численности различных родов бактерий, наблюдаемых с помощью обоих методов секвенирования из образца стула 1; (c) и (d) показывают результаты для образца стула 2.

https://doi.org/10.1371/journal.pone.0170922.s004

(EPS)

S5 Рис. Использование логнормального распределения Пуассона для идентификации OTU, относительная численность которых значительно изменилась.

Гистограммы оценок OTU (a) Δ z и (b) Δ F , рассчитанных между техническими повторами (голубой) и для подготовки кислорода, замораживания-оттаивания и времени задержки (красный). Линии подгонки — это обобщенные нормальные распределения. Пунктирные синие линии показывают порог 0,05 для распределения оценок Δ z и Δ F между техническими повторениями.В случае воздействия кислорода распределение баллов Δ z и Δ F между препаратами трансплантата было намного шире, чем распределение баллов Δ z и Δ F между техническими повторами, что указывает на повсеместные сдвиги в изобилии. Напротив, одинаковые распределения для приготовления замораживания-оттаивания и времени задержки выглядят очень похожими.

https://doi.org/10.1371/journal.pone.0170922.s005

(EPS)

S6 Рис. Отдельные ОТЕ в пределах бактериальных родов показали различную реакцию на воздействие кислорода.

Логарифмически преобразованная относительная численность пяти наиболее распространенных OTU из обычных бактериальных таксонов. Планки погрешностей представляют стандартную ошибку. Хотя OTU в пределах родов Faecalibacterium и Megamonas аналогично реагировали на кислород, мы наблюдали разные ответы от OTU в пределах Ruminococcus и Oscillospira .

https://doi.org/10.1371/journal.pone.0170922.s006

(EPS)

S7 Рис. PMA-seq регистрирует небольшое изменение живого бактериального сообщества при большем количестве циклов замораживания-оттаивания.

(a) Гистограммы с накоплением и (b) отдельные столбчатые диаграммы относительной численности различных родов бактерий с большим количеством циклов замораживания-оттаивания, как определено с помощью PMA-seq.

https://doi.org/10.1371/journal.pone.0170922.s007

(EPS)

S8 Рис. PMA-seq регистрирует небольшие изменения в живом бактериальном сообществе с более длительным лагом.

(а) Гистограммы с накоплением и (б) отдельные гистограммы относительной численности различных родов бактерий с более длительным лагом, как определено с помощью PMA-seq.

https://doi.org/10.1371/journal.pone.0170922.s008

(EPS)

Благодарности

Мы благодарим Элейн Во и Джину Мендолиа за их вклад в экспериментальный дизайн и лабораторные процедуры, Скотта В. Олесена за помощь с texmex и Эллен В. Чу за существенные исправления рукописи. Благодарим Центр MIT BioMicro за помощь в секвенировании.

Вклад авторов

  1. Концептуализация: NDC MBS ARP ZK EJA.
  2. Обработка данных: NDC.
  3. Формальный анализ: НДЦ.
  4. Финансирование: EJA.
  5. Расследование: НДЦ.
  6. Методология: НДЦ МБС АРП.
  7. Администрация проекта: NDC EJA.
  8. Ресурсы: EJA.
  9. Программное обеспечение: NDC.
  10. Надзор: EJA.
  11. Проверка: NDC.
  12. Визуализация: НДЦ.
  13. Написание — первоначальный эскиз: НДЦ.
  14. Написание — просмотр и редактирование: NDC MBS ARP ZK EJA.

Ссылки

  1. 1. Lessa FC, Mu Y, Bamberg WM, Beldavs ZG, Dumyati GK, Dunn JR, et al. Бремя инфекции Clostridium difficile в США. N Engl J Med. 2015; 372 (9): 825–34. pmid: 25714160
  2. 2. Ван Нуд Э., Вризе А., Ньивдорп М., Фуэнтес С., Зоетендал Э. Г., де Вос В. М. и др.Дуоденальная инфузия донорских фекалий при рецидиве Clostridium difficile . N Engl J Med. 2013. 368 (5): 407–15. pmid: 23323867
  3. 3. Бороды Т.Дж., Хоруц А. Трансплантация фекальной микробиоты и новые применения. Нат Рев Гастроэнтерол Гепатол. 2012. 9 (2): 88–96.
  4. 4. Андерсон Дж. Л., Эдни Р. Дж., Уилан К. Систематический обзор: трансплантация фекальной микробиоты в лечении воспалительного заболевания кишечника. Алимент Pharmacol Ther. 2012; 36 (6): 503–16.pmid: 22827693
  5. 5. Borody TJ, Warren EF, Leis S, Surace R, Ashman O. Лечение язвенного колита с помощью фекальной бактериотерапии. J Clin Gastroenterol. 2003. 37 (1): 42–7. pmid: 12811208
  6. 6. Borody TJ, Wettstein AR, Leis S, Hills LA, Campbell J, Torres M. M1209 Clostridium difficile , осложняющая воспалительное заболевание кишечника: результаты до и после лечения. Гастроэнтерология. 2008; 134 (4): A – 361.
  7. 7. Колман Р.Дж., Рубин Д.Т.Трансплантация фекальной микробиоты как терапия воспалительного заболевания кишечника: систематический обзор и метаанализ. Колит Дж. Крона. 2014; 8 (12): 1569–81. pmid: 25223604
  8. 8. Цуй Б., Фэн Ц., Ван Х, Ван М., Пэн З., Ли П и др. Трансплантация фекальной микробиоты через средний отдел кишечника при рефрактерной болезни Крона: результаты испытаний безопасности, осуществимости и эффективности. J Gastroenterol Hepatol. 2015; 30 (1): 51–8. pmid: 25168749
  9. 9. Моайеди П., Суретт М.Г., Ким П.Т., Либертуччи Дж., Вулф М., Ониски С. и др.Трансплантация фекальной микробиоты вызывает ремиссию у пациентов с активным язвенным колитом в рандомизированном контролируемом исследовании. Гастроэнтерология. 2015; 149 (1): 102–9. pmid: 25857665
  10. 10. Бороды Т.Дж., Джордж Л., Эндрюс П., Брандл С., Нунан С., Коул П. и др. Изменение флоры кишечника: потенциальное лекарство от воспалительного заболевания кишечника и синдрома раздраженного кишечника? Med J Aust. 1989; 150 (10): 604.
  11. 11. Бороды Т.Дж., Уоррен Э.Ф., Лейс С.М., Сураче Р., Эшман О., Сиаракас С.Бактериотерапия с использованием фекальной флоры: игра с движениями человека. J Clin Gastroenterol. 2004. 38 (6): 475–83. pmid: 15220681
  12. 12. Vrieze A, Van Nood E, Holleman F, Salojärvi J, Kootte RS, Bartelsman JFWM и др. Перенос кишечной микробиоты от худых доноров увеличивает чувствительность к инсулину у людей с метаболическим синдромом. Гастроэнтерология. 2012. 143 (4): 913–6. pmid: 22728514
  13. 13. Консорциум проекта «Микробиом человека». Структура, функции и разнообразие микробиома здорового человека.Природа. 2012. 486 (7402): 207–14. pmid: 22699609
  14. 14. Дэвид Л.А., Матерна А.С., Фридман Дж., Кампос-Баптиста М.И., Блэкберн М.С., Перротта А. и др. Образ жизни хозяина ежедневно влияет на микробиоту человека. Genome Biol. 2014; 15: R89. pmid: 25146375
  15. 15. Smits LP, Bouter KEC, de Vos WM, Borody TJ, Nieuwdorp M. Терапевтический потенциал трансплантации фекальной микробиоты. Гастроэнтерология. 2013; 145 (5): 946–53. pmid: 24018052
  16. 16. Ли С.С., Чжу А., Бенеш В., Костя П.И., Херког Р., Хильдебранд Ф. и др.Устойчивое сосуществование штаммов донора и реципиента после трансплантации фекальной микробиоты. Наука. 2016; 352 (6285): 586–9. pmid: 27126044
  17. 17. Ван Нуд Э, Спилман П., Ньивдорп М., Келлер Дж. Трансплантация фекальной микробиоты: факты и противоречия. Курр Опин Гастроэнтерол. 2014; 30 (1): 34–9. pmid: 24241245
  18. 18. Аллен-Верко Э., Рид Дж., Винер Н., Глор Дж. Б., Хота С., Ким П. и др. Отчет канадской рабочей группы по фекальной микробной терапии: терапия микробных экосистем.Можно J Гастроэнтерол. 2012. 26 (7): 457–62. pmid: 22803022
  19. 19. Хоруц А, Садовский MJ, Гамильтон MJ. Развитие трансплантации фекальной микробиоты, подходящей для традиционной медицины. Clin Gastroenterol Hepatol. 2015; 13 (2): 246–50. pmid: 25460566
  20. 20. Келли С.Р., Кан С., Кашьяп П., Лайне Л., Рубин Д., Атреха А. и др. Обновленная информация о трансплантации фекальной микробиоты 2015: показания, методологии, механизмы и перспективы. Гастроэнтерология. 2015; 149 (1): 223–37.pmid: 25982290
  21. 21. Caporaso JG, Lauber CL, Walters WA, Berg-Lyons D, Lozupone CA, Turnbaugh PJ, et al. Глобальные паттерны разнообразия 16S рРНК на глубине миллионов последовательностей на образец. Proc Natl Acad Sci USA. 2011; 108: 4516–22. pmid: 20534432
  22. 22. Preheim SP, Perrotta AR, Martin-Platero AM, Gupta A, Alm EJ. Кластеризация на основе распределения: использование экологии для уточнения оперативной таксономической единицы. Appl Environ Microbiol. 2013. 79 (21): 6593–603. pmid: 23974136
  23. 23.Нокер А., Рихтер-Хайтманн Т., Монтижн Р., Шурен Ф., Корт Р. Различение живых и мертвых клеток в бактериальных сообществах из проб окружающей воды, проанализированных с помощью пиросеквенирования 454. Int Microbiol Off J Span Soc Microbiol. 2010. 13 (2): 59–65.
  24. 24. Карини П., Марсден П. Дж., Лефф Дж. В., Морган Э. Э., Стрикленд М. С., Фирер Н. ДНК реликта в изобилии присутствует в почве и затрудняет оценку микробного разнообразия почвы. bioRxiv. 2016; 043372.
  25. 25. Exterkate RA, Zaura E, Brandt BW, Buijs MJ, Koopman JE, Crielaard W. и др.Влияние лечения моноазидом пропидия на измеренный бактериальный состав клинических образцов после использования жидкости для полоскания рта. Clin Oral Investig. 2015; 19 (4): 813–22. pmid: 25106845
  26. 26. Ван Т., Цай Г, Цю И, Фей Н, Чжан М., Панг Х и др. Структурная сегрегация кишечной микробиоты между пациентами с колоректальным раком и здоровыми добровольцами. ISME J. 2012; 6 (2): 320–9. pmid: 21850056
  27. 27. Чжан Х, Шен Д., Фанг З., Цзе З, Цю Х, Чжан С. и др. Изменения микробиоты кишечника человека показывают прогрессирование непереносимости глюкозы.PLOS ONE. 2013; 8 (8): e71108. pmid: 24013136
  28. 28. Микель С., Мартин Р., Росси О., Бермудес-Хумаран Л., Шатель Дж., Сокол Н. и др. Faecalibacterium prausnitzii и здоровье кишечника человека. Curr Opin Microbiol. 2013. 16 (3): 255–61. pmid: 23831042
  29. 29. Сокол Х., Пиньер Б., Ваттерлот Л., Лахдари О., Бермудес-Хумаран Л.Г., Гратаду Дж. Дж. И др. Faecalibacterium prausnitzii — это противовоспалительная комменсальная бактерия, выявленная при анализе микробиоты кишечника пациентов с болезнью Крона.Proc Natl Acad Sci. 2008. 105 (43): 16731–6. pmid: 18936492
  30. 30. Smith PM, Howitt MR, Panikov N, Michaud M, Gallini CA, Bohlooly-Y M, et al. Микробные метаболиты, короткоцепочечные жирные кислоты, регулируют гомеостаз Treg-клеток толстой кишки. Наука. 2013; 341 (6145): 569–73. pmid: 23828891
  31. 31. Roediger WE. Роль анаэробных бактерий в метаболическом благополучии слизистой оболочки толстой кишки человека. Кишечник. 1980. 21 (9): 793–8. pmid: 7429343
  32. 32. Baughn AD, Malamy MH.Строгий анаэроб Bacteroides fragilis растет и извлекает пользу из наномолярных концентраций кислорода. Природа. 2004. 427 (6973): 441–4. pmid: 14749831
  33. 33. Olesen SW, Vora S, Techtmann SM, Fortney JL, Bastidas-Oyanedel JR, Rodríguez J и др. Новый метод анализа для экспериментов по микробной экологии с парными образцами. PLOS ONE. 2016; 11 (5): e0154804. pmid: 27152415
  34. 34. Ву Г.Д., Льюис Д.Д., Хоффманн К., Чен И-Й, Найт Р., Биттингер К. и др. Методы отбора проб и пиросеквенирования для характеристики бактериальных сообществ в кишечнике человека с использованием тегов последовательности 16S.BMC Microbiol. 2010; 10: 206. pmid: 20673359
  35. 35. Roesch LFW, Casella G, Simell O, Krischer J, Wasserfall CH, Schatz D, et al. Влияние хранения образцов фекалий на разнообразие бактериального сообщества. Open Microbiol J. 2009; 3 40–6. pmid: 19440250
  36. 36. Горзелак М.А., Гилл С.К., Тасним Н., Ахмади-Ванд З., Джей М., Гибсон Д.Л. Методы улучшения данных микробиома кишечника человека за счет уменьшения вариабельности за счет обработки образцов и хранения стула. PLOS ONE. 2015; 10 (8): e0134802.pmid: 26252519
  37. 37. Отт С.Дж., Мусфельдт М., Тиммис К.Н., Хампе Дж., Вендерот Д.Ф., Шрайбер С. Изменения кишечной бактериальной микробиоты в образцах фекалий во время хранения in vitro. Диагностика Microbiol Infect Dis. 2004. 50 (4): 237–45. pmid: 15582296
  38. 38. ван Нуд Э, Спилман П., Ньивдорп М., Келлер Дж. Трансплантация фекальной микробиоты: факты и противоречия. Курр Опин Гастроэнтерол. 2014; 30 (1): 34–9. pmid: 24241245
  39. 39. Сатокари Р., Маттила Е., Кайнулайнен В., Арккила ПЭТ.Простая подготовка фекалий и эффективность замороженного инокулята при трансплантации фекальной микробиоты при рецидивирующей инфекции Clostridium difficile — наблюдательное когортное исследование. Алимент Pharmacol Ther. 2015; 41 (1): 46–53. pmid: 25355279
  40. 40. Янгстер И., Саук Дж., Пиндар С., Уилсон Р.Г., Каплан Дж. Л., Смит М.Б. и др. Трансплантат фекальной микробиоты для рецидива инфекции Clostridium difficile с использованием замороженного инокулята от неродственных доноров: рандомизированное открытое контролируемое пилотное исследование.Clin Infect Dis Off Publ Infect Dis Soc Am. 2014. 58 (11): 1515–22.
  41. 41. Гамильтон MJ, Weingarden AR, Unno T, Khoruts A, Sadowsky MJ. Высокопроизводительный анализ последовательности ДНК показывает стабильное приживление кишечной микробиоты после трансплантации ранее замороженных фекальных бактерий. Кишечные микробы. 2013. 4 (2): 125–35. pmid: 23333862
  42. 42. Шах HN, Коллинз MD. Реклассификация Bacteroides hypermegas (Harrison and Hansen) в новый род Megamonas , как Megamonas hypermegas comb, ноя.Zentralblatt Für Bakteriol Mikrobiol Hyg Abt Orig C Allg Angew Ökol Mikrobiol. 1982. 3 (3): 394–8.
  43. 43. Эдгар RC. UPARSE: высокоточные последовательности OTU, полученные при считывании микробного ампликона. Нат методы. 2013; 10 (10): 996–8. pmid: 23955772
  44. 44. Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK, et al. QIIME позволяет анализировать данные секвенирования сообщества с высокой пропускной способностью. Нат методы. 2010. 7 (5): 335–6. pmid: 20383131
  45. 45. Хаас Б.Дж., Геверс Д., Эрл А.М., Фельдгарден М., Уорд Д.В., Яннукос Г. и др.Образование и обнаружение последовательности химерной 16S рРНК в ПЦР-ампликонах с секвенированием по Сэнгеру и 454-пиросеквенированием. Genome Res. 2011. 21 (3): 494–504. pmid: 21212162
  46. 46. Эдгар RC. Поиск и кластеризация на порядки быстрее, чем BLAST. Bioinforma Oxf Engl. 2010. 26 (19): 2460–1.
  47. 47. Макдональд Д., Прайс М.Н., Гудрич Дж., Навроцкий Е.П., ДеСантис Т.З., Пробст А. и др. Улучшенная таксономия Greengenes с явными рангами для экологического и эволюционного анализа бактерий и архей.ISME J. 2012; 6 (3): 610–8. pmid: 22134646
  48. 48. Ван Кью, Гроссмейстер Гаррити, Тидже Дж. М., Коул Дж. Р. Наивный байесовский классификатор для быстрого отнесения последовательностей рРНК к новой бактериальной таксономии. Appl Environ Microbiol. 2007. 73 (16): 5261–7. pmid: 17586664
  49. 49. Каллахан Б.Дж., Макмерди П.Дж., Розен М.Дж., Хан А.В., Джонсон А.Дж., Холмс С.П. DADA2: вывод образца с высоким разрешением из данных ампликона Illumina. Нат методы. 2016; 13 (7): 581–3. pmid: 27214047

Изменение микрофлоры кишечника после предоперационной механической подготовки толстой кишки

Ссылки

1 июня 1969 г. · The Journal of Infectious Diseases · ME Levison, D Kaye

1 января 1970 г. · The Journal of Infectious Diseases · SL GorbachK N Neogy

1 января 1970 г. · Кишечник · С. Л. Горбач Г. В. Хепнер

1 июля 1965 г. · Журнал экспериментальной медицины · RW SCHAEDLERR COSTELLO


Цитирование

1 сентября 1990 г. · World Journal of Surgery · MB SmithR L Nichols

1 сентября 1993 г. · Заболевания толстой и прямой кишки · R BledayF W Ackroyd

1 июля 1990 г. · Заболевания толстой и прямой кишки · JT LindseyR L Nichols

1 июля 1974 г. · Заболевания толстой кишки и прямая кишка · M Bridoux

1 января 1980 г. · Заболевания толстой и прямой кишки · GB Thow

20 ноября 2009 г. · Международный журнал колоректальных заболеваний · Цянь Д ЧжуВэнь Дж Ян

16 июля 2008 г. · Журнал гастроинтестинальной хирургии : Официальный журнал Общества хирургии пищеварительного тракта · Карлос Э. Пинеда Марк Л. Велтон

1 июля 1996 г. · Американский журнал хирургии · Р.Л. Николс

6 февраля 1999 г. · Американский журнал хирургии · JW MilsomD R Люк

декабря 1, 1976 · Журнал детской хирургии · Й. Берлацкий М. Шиллер

24 января 2002 г. · Журнал Американского колледжа хирургов · Дирк ван Гелдере Роберт П.А. Бум

27 июля 1999 г. · Британский журнал хирургии · М ОкадаТ Мидтведт

12 августа 1999 г. · BJU International · PD FurnessR M Decter

16 мая 2002 г. · BJU International · M ShafiiD P Hickey

6 октября 2005 г. · Хирургические инфекции · Ronald L. NicholsPhilip S Barie

1 октября 1973 г. · Annals of Хирургия · RL NicholsL M Nyhus

11 января 1975 · Анналы хирургии · GH Bornside, I Cohn

27 августа 2010 · Анналы хирургии · Джузеппе Бризинда Джорджио Мария

9 мая 2008 · Колоректальные заболевания: Официальный журнал Ассоциация колопроктологов Великобритании и Ирландии · СП RoigP Albors

28 апреля 2005 г. · Химиотерапия · Рональд Ли Николс Кристофер Б. Велдон

13 сентября 2014 г. · Хирургические инфекции · Бенджамин Д. Шоган Джон С. Алверди

24 марта 2005 г. · Британский журнал хирургии · P BucherP Morel

18 октября 2015 · Урологические клиники Северной Америки · Аманда Чи Роберт Б. Надлер

1 апреля 1986 · Американский журнал хирургии · М. Уивер М. Р. Кейли

1 марта 1985 · Американский журнал хирургии · F GottrupO Brandsborg

18 апреля 2015 г. · Журнал минимально инвазивной гинекологии · Эми Арнольд, Джейсон Эбботт

1 августа 1988 г. · Британский журнал хирургии · WY LauK K Ho

7 мая 2002 г. · Журнал урологии · Кеннет Х. Фергюсон, Аллен Ф. Морей,

,

, 2 июля 2005 г. · Журнал детской хирургии · Чарльз М. Лейс, Джон Б. Питч,

,

, 15 сентября 2012 г. хирургии · E Pa tchen Dellinger

28 сентября 2014 г. · Журнал Американского колледжа хирургов · Мэтью Д. Зелхарт, Рональд Л. Николс

1 января 1995 г. · Журнал урологии · DA McQuittyG M Preminger

1 января 2013 г. · Урология · Тору Сугихара Юкио Хомма

1 февраля 1995 г. · Журнал урологии · JK LightS Vohra

20 февраля 2003 г. · Американский журнал гастроэнтерологии · Марк Пиментель, Генри Линь

1 июля 1976 г. · Британский журнал хирургии · MR KeighleyJ Alexander-Williams

1 декабря 1976 г. · Британский журнал хирургии · Дж. Ф. Гарри, Р. Б. Эллис-Пеглер

1 мая 1977 г. · Британский журнал хирургии · М. Р. Кейли

1 июня 1982 г. · Австралийский и новозеландский хирургический журнал · DW Smart, GL Newstead

1 декабря 1978 г. · Кишечник · MR KeighleyJ Alexander-Williams

15 ноября 1986 г. · Последипломная медицина · JL Munson, JW Braasch

1 ноября 1994 г. · Всемирный журнал хирургии · EW Taylor, Дж. Линдси

1 мая 1997 г. · Болезни толстой кишки. on and Rectum · L OliveiraM Bernstein

6 февраля 2017 · Анналы хирургии · Sarah E KollerNestor F Esnaola

7 апреля 1978 · Langenbecks Archiv für Chirurgie · R SchiesselK Dinstl

10 февраля 2021 · Журнал акушерства Гинекологические исследования · Николаос Катопулис Атанасиос Протопапас


Применение пробиотического препарата в комбикормах для форели

Валентина Сидорова, Галина Дудикова, Анна Чижаева, Надежда Январева, Сая Койшибаева и Нина Бадрыева 9000 НИИ пищевой промышленности Казахстана , Казахстан Казахский научно-исследовательский институт рыбного хозяйства, Казахстан

Абстрактные
Пробиотический препарат «Биоконс» содержит консорциум антагонистов активных молочнокислых бактерий: Lactobacillus brevis-67, Lactobacillus casei var.alactosus-22, Lactobacillus fermentum-104 и Lactobacillus plantarum-2. Обладает широким спектр антибактериального действия в отношении Bacillus subtilis, Escherichia coli, Staphylococcus aureus, Salmonella readihg и Salmonella typhimurium. Введение препарата «Биоконс» с титром 109 КОЕ / г в количестве 0,5% обеспечивает метод напыления на готовые корма для форели и поддержание молочнокислых бактерий в комбикормах в титре 106 КОЕ / г. Исследование внутреннего пищеварения рыб выявило наличие небольшого допустимого количества спорообразующих бактерий Bacillus. subtilis и Bacillus mesentericus.Условно-патогенные и патогенные микроорганизмы (Escherichia coli, Salmonella typhimurium, Proteus mirabilis, Staphylococcus aureus, Enterobacter aerogenes, Klebsiella pneumoniae, Enterococcus faecalis) а также молочнокислые бактерии, дрожжи и грибки во внутреннем пищеварении рыб не обнаружены. В воде рыбоводных бассейнов и водосточные конструкции молочнокислых бактерий в титре 2 × 106 КОЕ / г и спорообразующих бактерий 1 × 106 КОЕ / г. Отсутствие молочнокислые бактерии в продуктах пищеварения рыб и наличие лактобацилл в воде подтверждают тот факт, что пробиотик преходяще.Лактобациллы в составе пробиотика «Биоконс» обладают низкой степенью адгезии к эпителию кишечника рыб. Молочнокислые бактерии и их метаболиты оказывают пробиотическое действие при прохождении через кишечник. Таким образом, введение пробиотический препарат «Биоконс» в комбикорма для форели способствует нормализации микрофлоры кишечника рыб и улучшение санитарных показателей воды рыбоводного бассейна.
Биография

Валентина Сидорова окончила Джамбулский технологический институт в 1982 году.Ведущий научный сотрудник лаборатории технологии зерновых продуктов и комбикормов. Ею опубликовано более 60 статей и 22 патента.

Электронная почта: [адрес электронной почты защищен]

PDF HTML

1000мл Свиньи, куры, утки, колибактериоз гусей, сальмонеллезный энтерит для нормализации микрофлоры кишечника — Зоветпец

Описание

1 литр = 1000 мл

Композиция

В 1000 мл препарата содержится:

Муравьиная кислота 150 мл;

Молочная кислота 300 мл;

Фумаровая кислота 20 мл;

Формиат аммония 300 мл;

Бензоат натрия 5 мл;

Фармакологические свойства:

Эффективность подкислителя обусловлена ​​синергетическим сочетанием свойств органических кислот.

Препарат снижает pH и буферную емкость в воде, а также в пищеварительном тракте животных и птицы.

Благодаря такому действию компонентов препарат подавляет рост и развитие болезнетворных бактерий (E.Coli, Salmonella spp., Campylobacter spp., Pseudomonas spp. И др.), Уменьшая при этом негативное влияние патогенной микрофлоры на организм.

Препарат также подавляет гнилостные процессы в пищеварительном тракте и создает благоприятные условия для роста полезной микрофлоры.

Кондиционированный подкислитель для снижения pH в желудочно-кишечном тракте активирует выработку пепсина, улучшает пищеварение, увеличивает усвоение белка.

Подкисление воды улучшает аппетит свиней и птицы и увеличивает потребление кормов.

Заявление:

Для улучшения санитарного состояния питьевой воды свиней и птицы; для нормализации микрофлоры кишечника, в том числе после антибактериальной терапии, снижения риска нарушений пищеварения, колибактериоза и сальмонеллезного энтерита; для повышения аппетита и улучшения переваривания кормов у животных и птицы, увеличения потребления кормов.

Препарат снижает стресс у свиней и птицы при смене рациона.

Средство эффективно и безопасно для дезинфекции доильных систем, не оказывает агрессивного воздействия.

Дозировка:

Подкислитель наносится путем добавления его в питьевую воду.

В зависимости от возраста и вида животных рекомендуются следующие дозы подкислителя:

домашняя птица и поросята (до 2 месяцев) — 0,5 мл на 1 л питьевой воды;

свиньи на откорме — 1 мл на 1 литр питьевой воды, для дезинфекции питьевой системы — 2-4 мл на 1 литр питьевой воды.

Предупреждения:

Соблюдайте правила обращения с жидкими органическими кислотами.

Хранилище

Хранить в оригинальной упаковке в сухом темном месте при температуре от 0 ° C до 20 ° C (32–68F).

Общий липополисахарид из кишечного микробиома человека подавляет сигнал толл-подобного рецептора

ВВЕДЕНИЕ

Микробиом кишечника человека состоит из большой и динамичной популяции микроорганизмов, представляющих одну из самых густонаселенных известных экосистем (1).Этот микробный консорциум предоставляет своему хозяину множество преимуществ, включая ключевые сигналы, которые определяют развитие желудочно-кишечного тракта, иммунное созревание, выработку витаминов, извлечение из рациона неперевариваемых углеводов и устойчивость к патогенам (2). Однако это создает проблему для хозяина, содержащего и оставшегося иммунологически толерантным к микробной нагрузке, превышающей 10 12 клеток / мл (1). Требуются продуманные механизмы для модуляции и сохранения этих симбиотических отношений.На сегодняшний день механизмы, поддерживающие этот симбиоз, основаны на толерантности, управляемой хозяином, включая физические барьеры ориентированного эпителия и слизистой оболочки, секрецию антимикробных пептидов и секретируемых антител или петли отрицательной обратной связи в передаче сигналов NF-κB (3). Также задействованы несколько механизмов, которые содержат как риск инфекции, так и амплитуду иммунного ответа (4). В последние годы в исследованиях сообщалось о примерах самих микроорганизмов, способствующих размножению регуляторных Т-клеток Foxp3 + (5, 6), подавлению продукции фактора некроза опухоли альфа (TNF-α) (7, 8) и поддержанию эпителия кишечника (9), предполагая, что микробиота может играть роль в формировании иммунных ответов хозяина.Однако конкретные производные микробиоты молекулярные медиаторы толерантности хозяина все еще в значительной степени неизвестны. Недавно мы сообщили, что комменсальный организм Bacteroides dorei продуцирует антагонистическую форму липополисахарида (ЛПС), которая может влиять на предрасположенность детей к аллергии и аутоиммунитету (10). . Хотя сообщалось о способности некоторых изоформ LPS ингибировать передачу сигналов Toll-подобного рецептора 4 (TLR4) (11), их более широкое значение в отношении здоровья и болезней кишечника остается неизученным.Здесь мы напрямую извлекли общий LPS из образцов фекалий здоровых взрослых людей и обнаружили, что LPS, продуцируемый консорциумом микробов, проживающих в кишечнике, сильно противодействует пути TLR4 хозяина. Используя метагеномное секвенирование, мы дополнительно определили вклад уровня штамма в пул ЛПС кишечника и обнаружили, что многие другие члены порядка Bacteroidales , которые являются доминирующими грамотрицательными бактериями в микробиоме здорового кишечника человека (12), продуцируют антагонистические формы бактерий. ЛПС, таким образом управляя иммунным молчанием всего микробного сообщества.Эти результаты подрывают текущую общепринятую парадигму, согласно которой сообщества кишечных микробов обладают сильной сигнальной способностью TLR4, против которой иммунная система должна быть хорошо толерантна (13). Наш первый отчет, описывающий внутренний микробиомный механизм, активно подавляющий врожденную иммунную активацию в здоровом кишечнике, и переопределяет то, как мы представляем себе иммунологическую динамику взаимоотношений хозяина и микробиоты.

ОБСУЖДЕНИЕ

Иммунные механизмы, лежащие в основе кишечного комменсализма, еще предстоит полностью выяснить.С момента осознания того, что наш кишечник является хозяином миллиардов бактерий в отсутствие подавляющего иммунного ответа, механизмы, поддерживающие эту взаимосвязь, стали предметом интенсивных исследований. Здесь мы формально демонстрируем, что общий LPS, продуцируемый микробиомом кишечника человека, не только сам по себе неиммуногенен, но также ингибирует TLR4-зависимую продукцию цитокинов (рис. 1B-F). Мы также показываем, что продукция иммуноингибиторных форм ЛПС является общей чертой членов порядка Bacteroidales (рис.3), которые вносят основной вклад в синтез ЛПС в кишечнике человека (рис. 2). Предыдущие публикации продемонстрировали, что различные структурные особенности домена липида А, продуцируемого несколькими видами бактерий, мешают правильной передаче сигналов TLR4-MD2 посредством конкурентного ингибирования (17, 19). Точный механизм ингибирования передачи сигналов LPS, полученным из фекалий, не был продемонстрирован в этом исследовании, но, вероятно, будет идентичен ранее описанным механизмам. Ранее мы сообщали об иммуноингибиторной функции LPS, продуцируемого B.dorei и роль, которую он, вероятно, играет в предотвращении надлежащего иммунного образования у младенцев, генетически предрасположенных к диабету 1 типа, что способствует развитию аллергии и аутоиммунитета (10). Мы также наблюдали общее переизбыток бактерий Bacteroidetes у этих младенцев, что в свете представленных здесь результатов предполагает, что коллективный вклад всех бактерий Bacteroides spp. вероятно, увеличили восприимчивость этих детей к болезни. Поэтому любые усилия по нацеливанию на кишечное микробное сообщество этих младенцев в терапевтических целях, вероятно, должны быть сосредоточены в целом на всех бактериях Bacteroidetes , а не только на B.dorei . Наши результаты также проливают новый свет на ряд открытий, сделанных в последние годы, которые предполагают связь между воспалительной стимуляцией, возникающей из просвета кишечника, и местными или периферическими воспалительными заболеваниями. Воспалительное заболевание кишечника (ВЗК) было связано с расцветом Proteobacteria (26, 27). Интересно, что лечение аминогликозидным антибиотиком гентамицином снижает численность Proteobacteria и приводит к преобладанию в кишечной флоре Bacteroidetes , что приводит к защите от колита на мышиной модели ВЗК.И наоборот, было показано, что лечение ванкомицином способствует увеличению количества протеобактерий и не предотвращает заболевание (28, 29). Хотя специфическая роль воспалительного ЛПС в этиологии и восстановлении ВЗК еще предстоит выяснить, возможно, что различия в иммуногенности ЛПС между Bacteroidetes и Proteobacteria лежат в основе этих наблюдений. При ожирении распространена гипотеза, что ЛПС кишечника просачивается в кровоток, что приводит к субклиническому хроническому воспалению в периферических жировых тканях, изменяя их метаболические функции (30–32).Однако наши результаты показывают, что свободно циркулирующий ЛПС, поступающий из просвета кишечника, имеет тенденцию предотвращать, а не способствовать воспалению. Интересно, что ожирение связано с уменьшением количества видов Bacteroidetes по сравнению с увеличением количества видов Firmicutes , которые в основном являются грамположительными бактериями (33). Таким образом, состав кишечного LPS у этих пациентов может быть изменен с противовоспалительных подтипов LPS Bacteroidetes в пользу воспалительных подтипов LPS, возможно, продуцируя более воспалительный LPS.Наконец, текущие методологии, используемые для количественной оценки периферического воздействия кишечного LPS, также чувствительны к гипоацилированным структурам LPS; поэтому в настоящее время не существует анализа, который мог бы отличить ингибирующий от воспалительного LPS на периферии. Хотя мы не оспариваем влияние воспалительного ЛПС на метаболический профиль периферической ткани, наши результаты требуют осторожности при интерпретации значения периферических уровней ЛПС в исследованиях, пытающихся связать ЛПС микробиома и периферическое воспаление.Что наиболее важно, наши результаты бросают вызов нынешнему представлению о механизмах, регулирующих совместное проживание кишечной микробиоты и хозяина. Комменсализм обычно рассматривается как равновесие двух мощных сил: тяжелой бактериальной нагрузки, наделенной высоким воспалительным потенциалом, и хорошо защищенного хозяина с жестко регулируемой иммунной системой. Эта модель долгое время направляла усилия по выяснению механизмов, лежащих в основе комменсализма между хозяином и микробиомом кишечника. Экспериментально это привело к использованию мощных воспалительных ЛПС патогенных организмов для моделирования взаимодействия с микробиомом in vitro и in vivo (34).Напротив, наши результаты показывают, что общий ЛПС кишечного микробиома, по сути, является общим иммуноингибирующим средством. Однако другие бактериальные факторы способствуют иммуногенности микробиома. Примечательно, что продукция пептидогликана лиганда TLR2 (PGN) широко распространена в кишечных бактериях. Хотя было показано, что некоторые патогенные бактерии могут использовать автолитические ферменты для изменения своих PGN, чтобы уменьшить стимуляцию TLR2, еще предстоит определить, продуцируют ли комменсальные бактерии измененные формы PGN или несут ослабленные иммунные функции (35, 36).Подавление опосредованной зимозаном стимуляции TLR2 Bacteroides EPS и LPS, которые мы наблюдали, также указывает на возможность более широкого подавления иммуногенности Bacteroidales , которое будет распространяться на другие сигнальные пути, помимо TLR4. в отчетах описан вклад отдельных видов в специфические механизмы, мешающие передаче сигналов NF-κB или активно модулирующие реакцию TLR в эпителии кишечника (37, 38). Важно отметить, что настоящий отчет — первое, в котором описан механизм, происходящий от микробиома в масштабах всего филума, который активно способствует развитию иммунной толерантности кишечной микробиоты.До сих пор врожденный иммунный воспалительный потенциал комменсальной микробиоты, вероятно, был переоценен, и сигнальная способность кишечного микробиома должна быть переоценена, чтобы точно смоделировать влияние, которое местные комменсальные микробы оказывают на здоровье и болезни.

МАТЕРИАЛЫ И МЕТОДЫ

Штаммы бактерий и условия роста.

Штаммы бактерий, использованные в этом исследовании, сведены в таблицы на https://figshare.com/s/5e56cc1a347ef4f1de49. Все штаммы были начаты из 20% глицерина, хранящегося при -80 ° C, посеяны на агар для инфузии мозга и сердца (BHI) с добавлением гемина и витамина K (Teknova; B1093) и выращены в анаэробных условиях при 37 ° C.Жидкие культуры всех штаммов были начаты с одной колонии, инокулированной в 1000 мл жидкой среды BHI с добавлением 10 мл раствора витамина К-гемина (BD; 212354), 10 мл микроэлементов (ATCC; MD-TMS), 10 мл. микроэлементов витаминов (ATCC; MD-VS) и 50 мл фетальной бычьей сыворотки (HyClone; Sh40071) и выращивали в анаэробных условиях в течение не менее 48 часов при 37 ° C. Гибкая анаэробная камера (Coy Laboratory Products), содержащая 20% CO 2 , 10% H 2 и 70% N 2 , использовалась для всех этапов анаэробной микробиологии.

выдержек из EPS. Матрица

EPS была извлечена из всех штаммов, как описано ранее (7). Вкратце, 250 мл 24-часовых культур получали центрифугированием при 18 400 × 90 786 g
в течение 10 минут (4 ° C). Предварительно промытый осадок клеток суспендировали в 8 мл фосфатно-солевого буфера путем встряхивания в течение 5 мин, позволяя связавшемуся с клетками EPS раствориться. Затем планктонные клетки осаждали центрифугированием при 18 400 × 90 786 g
в течение 10 мин (4 ° C). Затем осторожно удаляли супернатант, стерилизовали фильтрованием с помощью фильтрата 0.Фильтр с размером пор 2 мкм и добавление к 4 объемам ледяного абсолютного этанола для осаждения EPS. После центрифугирования при 3300 × g в течение 30 минут осадок осажденного EPS промывали 70% этанолом, лиофилизировали и затем хранили при -20 ° C. Для дальнейших экспериментов фракции лиофилизированного ЭПС нормализовали путем растворения в сверхчистой воде до желаемой концентрации. С использованием этого протокола было получено в среднем 5 мг лиофилизированного экстракта для каждого штамма.

Выделение и дифференциация клеток человека для иммуностимулирующих тестов.

Кровяной лейкоцит был получен от здоровых добровольцев после получения информированного согласия. Протокол исследования и любые поправки были рассмотрены и одобрены независимым наблюдательным советом (New England IRB, Newton, MA) перед началом исследования. Это исследование было проведено в соответствии с этическими принципами Хельсинкской декларации.

PBMC были свежевыделены из крови центрифугированием в градиенте Ficoll-Hypaque, как описано ранее (39). Дендритные клетки, происходящие из моноцитов, были дифференцированы in vitro из свежевыделенных моноцитов человека, как описано ранее (39).Вкратце, моноциты CD14 + выделяли из свежеочищенных PBMC путем отрицательной селекции и сортировки с помощью магнитных шариков (Miltenyi). Затем клетки инкубировали в полной среде RPMI 1640 в присутствии 50 нг / мл рекомбинантного человеческого фактора, стимулирующего колонии гранулоцитов-макрофагов, и 20 нг / мл рекомбинантного человеческого IL-4 (R&D Systems) в течение 7 дней. Для всех экспериментов с использованием человеческих донорских клеток данные были получены независимо, по крайней мере, с двумя донорами. Для включения в рисунок был выбран репрезентативный набор данных.

Очистка и анализ LPS.

Для выделения общего ЛПС из образца фекалий приблизительно 5 г фекального материала гомогенизировали в 10 мл воды, свободной от эндотоксинов, с помощью мягкого диссоциатора MACS. Полученной фекальной суспензии давали отстояться в течение 5 минут, давая возможность крупным частицам осесть, и супернатант лиофилизировали для очистки LPS. Очистку ЛПС от фекального материала выполняли с использованием 500 мг лиофилизированного материала, но в остальном выполняли, как описано для бактериальных штаммов ниже.

Для выделения ЛПС из штаммов бактерий, ЛПС из всех штаммов выделяли из 1000 мл жидкой культуры, выращенной в стандартных условиях в течение ~ 48 ч методом горячей воды-фенола, как описано ранее (15). Для удаления следовых количеств белка эндотоксина очищенный фенолом LPS дополнительно обрабатывали, как описано ранее (16), с модификациями, описанными ниже. После окончательного осаждения этанолом ЛПС лиофилизировали для определения выхода на аналитических весах Mettler Toledo XS105 Dual Range (чувствительность ≥0.1 нг) и ресуспендировали в воде, свободной от эндотоксинов для культур клеток HyPure (HyClone) до конечной концентрации 1 мг / мл без добавления триэтаноламина. Чтобы подтвердить чистоту и нормализацию ЛПС, полученного из фекалий, конечный продукт визуализировали с помощью набора для окрашивания в геле Pro-Q Emerald 488 (Thermo Fisher Scientific) в соответствии с инструкциями производителя. Во всех случаях набор для окрашивания в геле Pro-Q Emerald 488 показал чистоту, идентичную чистоте ЛПС, очищенного из бактериальных изолятов.Однако, учитывая сложную молекулярную природу фекального материала человека, наш анализ не исключает возможности контаминирования веществ в ЛПС, полученном из фекалий, и он не считается сверхчистым.

In vitro Анализы стимуляции LPS и конкурентные анализы.

PBMC (10 5 ) или дендритные клетки, полученные из моноцитов (5 × 10 4 ), инкубировали в присутствии LPS, очищенного из указанных бактериальных изолятов, в дозах от 10 -3 до 10 4 нг / мл в течение 18-20 часов.Для анализов ингибирования клетки высевали в среду. Затем добавляли ЛПС, очищенный из указанного штамма, а затем сразу же добавляли 100 пг / мл ЛПС, очищенный из E. coli . Супернатанты собирали через 18-20 часов культивирования и анализировали с помощью набора для анализа воспаления человека (BD Biosciences) в соответствии с инструкциями производителя. Этот набор анализирует уровни IL-10, IL-6, IL-8, TNF-α, IL-12p70 и IL-1b в одних и тех же образцах. Группы сравнивали с помощью двустороннего негомоскедастического теста t , скорректированного на множественное тестирование по методу Сидака-Бонферрони с программным обеспечением GraphPad Prism.

Сбор образцов стула и выделение ДНК.

Образцы стула были собраны у здоровых добровольцев после получения информированного согласия. Протокол исследования и любые поправки были рассмотрены и одобрены независимым наблюдательным советом (Western IRB, Puyallup, WA) до начала исследования. Образцы стула были собраны участниками утром и доставлены в Институт биомедицинских исследований Novartis в Кембридже, Массачусетс, в тот же день. Затем образцы хранили при -80 ° C до отправки в Институт Броуда для экстракции ДНК.Экстракцию ДНК из образцов стула проводили с помощью мини-набора QIAamp DNA Stool (QIAGEN).

Построение библиотеки метагенома.

Метагеномные библиотеки полногеномного секвенирования «дробовика» получали следующим образом. Образцы метагеномной ДНК количественно оценивали с помощью анализа дцДНК Quant-iT PicoGreen (Life Technologies, Inc.) и нормализовали до концентрации 50 пг / мкл. Библиотеки секвенирования Illumina получали от 100 до 250 пг ДНК с помощью набора для подготовки библиотеки ДНК Nextera XT (Illumina) в соответствии с рекомендованным производителем протоколом с соответствующим масштабированием реакционных объемов.Пакеты из 24, 48 или 96 библиотек были объединены путем переноса равных объемов каждой библиотеки с помощью устройства для обработки жидкостей Labcyte Echo 550. Размеры вставок и концентрации для каждой объединенной библиотеки определяли с помощью набора Agilent Bioanalyzer DNA 1000 (Agilent Technologies).

Секвенирование и анализ метагеномных образцов.

Метагеномное полногеномное секвенирование с дробовиком выполняли в основном, как описано ранее (10). Метагеномные библиотеки секвенировали на платформе Illumina HiSeq 2500, нацелив ~ 2.5 Гб последовательности на образец при считывании парных концов 101 пар оснований. Чтения контролировались по качеству путем обрезки низкокачественных баз и удаления чтений 40) и отфильтровывались. Образцы были профилированы таксономически с помощью MetaPhlAn 2.0 (41) (http://huttenhower.sph.harvard.edu/MetaPhlAn2) и функционально профилированы с помощью HUMAnN2 (42) (http://huttenhower.sph.harvard.edu/HUMAnN2). HUMAnN2 сопоставляет метагеномные чтения с семейством генов UniRef50 (41) видов, идентифицированных на этапе таксономического профилирования MetaPhlAn2. Кодирующие белки последовательности в этих пангеномах были предварительно аннотированы в соответствующие семейства UniRef50, которые служат в качестве всеобъемлющей, неизбыточной базы данных последовательностей белков.Чтения, которые не совпадают с известным пангеномом, отдельно сопоставляются со всем UniRef50 с помощью транслированного поиска с помощью DIAMOND (42). Все совпадения взвешиваются на основе качества выравнивания и длины последовательности, при этом совпадения по видам и неклассифицированные совпадения объединяются для получения общих значений для каждого семейства белков (в дополнение к суммам с разбивкой по видам) в количестве считываний на килобазу (RPK). Единицы RPK были далее нормализованы до числа RPK на миллион считываний образцов, чтобы учесть изменение глубины последовательности в разных образцах.Графики анализа главных компонентов были созданы с помощью пакета python scikit-learn с использованием данных о численности видов из MetaPhlAn2. Данные доступны по адресу https://figshare.com/s/5e56cc1a347ef4f1de49 и https://www.ncbi.nlm.nih.gov/bioproject/PRJNA414479. Функциональная аннотация

GO.

Мы использовали HUMAnN2 для сопоставления семейств генов UniRef50 с терминами GO, которые затем были объединены в более крупные метаболические кластеры с помощью инструмента CateGOrizer (43). Эта процедура дала полный, но управляемый набор из 13 неизбыточных условий биологического процесса GO для сравнения HMP1 и новых образцов (https: // figshare.com / s / 5e56cc1a347ef4f1de49).

Выделение липида А для анализа МС.

Для анализа сырой биомассы гранулы из 10 мл ночного бульона с бактериальными культурами промывали трижды водой, метанолом и хлороформом (0,8: 1: 2). Альтернативно, непосредственно использовали очищенный LPS (200 мкг). Материал подвергали слабому кислотному гидролизу при 100 ° C в течение 30 минут в 12,5 мМ натрий-ацетатном буфере, pH 4,5, в присутствии 1% SDS для разрыва связи 3-дезокси-d-маннооктулозоновой кислоты и свободного липида. A был извлечен двухфазной экстракцией по Блайю-Дайеру.Виды липида А анализировали с помощью масс-спектрометра MALDI-TOF (Bruker Ultraflex), оснащенного лазером smartbeam с частотой излучения 2 кГц. Спектры получали в линейном режиме отрицательных ионов. В качестве матрицы использовали насыщенный раствор 6-аза-2-тиотимина в 50% ацетонитриле и 10% трехосновном цитрате аммония (9: 1, об. / Об.). Образцы растворяли в смеси хлороформ-метанол (4: 1, объем / объем) и наносили на планшет для образцов, а затем равную часть раствора матрицы (0,5 мкл).

HEK-293 Анализы репортерных клеток NF-κB.

Клетки HEK-293 (5 × 10 4 ), стабильно экспрессирующие NF-κB-индуцибельный репортерный ген люциферазы люциферазы и гены для hTLR4, CD14 и MD2 (TLR4-HEK) или hTLR2 и CD14 (TLR2-HEK ) (5 × 10 4 ) высевали в лунки 96-луночных планшетов и стимулировали дозами ЛПС, очищенного от указанных штаммов, в дозах от 10 -3 до 10 4 нг / мл от 6 до 8 ч. Для анализов ингибирования клетки одновременно стимулировали 1 нг / мл ЛПС, очищенного из E.coli . Люциферазную активность измеряли с помощью BrightGlo (Promega) в соответствии с инструкциями производителя. Репортерные клетки HEK-293 были приобретены у InvivoGen. Все клеточные линии были протестированы на загрязнение микоплазмами с помощью анализа на основе ПЦР независимым поставщиком услуг.

Соотношение функции и состава.

PBMC человека стимулировали в присутствии возрастающих количеств фекального LPS или одновременно обрабатывали 1 нг / мл E. coli LPS и возрастающими дозами фекального LPS от указанных доноров.Концентрации IL-6, TNF-α и IL-1β в супернатантах измеряли через 20 часов культивирования и сравнивали с концентрациями, полученными при обработке только LPS (0: 1). Концентрация цитокинов при стимуляции на уровне 1 или 10 мкг / мл была получена для LPS из отдельных образцов стула и нормализована. Эффективность ингибирования в соотношении 10: 1 или 100: 1 была получена для отдельных образцов стула и нормализована. Было проведено пять независимых экспериментов. Ранговая корреляция Спирмена между численностью отдельных видов и либо стимуляцией, либо ингибированием продукции IL-6, TNF-α или IL-1β рассчитывалась с использованием объединенных данных из всех экспериментов.Показаны виды, которые значительно коррелируют с функцией всех трех цитокинов, измеренных после коррекции Бенджамини-Хохберга. Данные доступны по адресу https://figshare.com/s/5e56cc1a347ef4f1de49.

БЛАГОДАРНОСТИ

Мы благодарим Сену Фаулер, Джона Аннанда и Сяопина Чена за помощь в подготовке образцов и дизайне эксперимента, Глена Диллоу за помощь в лечении рассеянного склероза и членов NIBR Microbiome Hub за полезную беседу. Мы также благодарим Рамника Ксавьера и Тиффани Пун из Института Броуда за создание последовательностей и управление образцами.

Это исследование не получало специального гранта от какого-либо финансирующего агентства в государственном, коммерческом или некоммерческом секторах.

E.H. и T.W.C. спроектировал, провел и проанализировал все эксперименты. S.A. и E.H. провели анализ метагеномных данных. E.H., S.A., L.M. и T.W.C. собрал и написал рукопись. T.W.C. выполнял функции главного исследователя.

Абсолютное количественное определение микробов с использованием метабаркодирования гена 16S рРНК: быстрая нормализация относительной численности с помощью количественной ПЦР, нацеленной на стандарт с добавлением гена 16S рРНК — Zemb — 2020 — MicrobiologyOpen

1 ВВЕДЕНИЕ

Метабаркодирование на основе оперона рибосомной РНК — распространенный инструмент в микробной экологии для измерения относительной численности определенных микробов.Типичный процесс изучения генов 16S рРНК, характеризующих микробное сообщество, включает извлечение микробной ДНК из образца и секвенирование. Для получения таблицы относительной численности операционных таксономических единиц доступны различные конвейеры (OTUs; Sun et al., 2011). Хотя выбор конвейера, безусловно, может повлиять на результаты, обучающая выборка (Werner et al., 2012) и метод нормализации (Kumar et al., 2018) также имеют большое влияние, хотя это редко обсуждается.Наиболее распространенная процедура нормализации состоит в делении на общее количество чтений, чтобы получить долю каждой OTU. Этот метод создает связь между OTU (поскольку сумма постоянна) и преобразует каждую численность в соотношение, обеспечивающее относительную численность, тем самым вводя неоднозначность для интерпретации увеличения относительной численности OTU как обогащения этой OTU. Следовательно, существует необходимость в измерении абсолютного количества OTU на вес образца, что, по-видимому, является ключевым для многих процессов, таких как: поглощение бактериальных клеток хозяином (Lee et al., 2015), производство бактериальных метаболитов, связанных с ожирением (Rastelli, Knauf, & Cani, 2018), или микробное производство вторичных желчных кислот, изменяющих метаболизм в печени (Ipharraguerre, Pastor, Gavaldà-Navarro, Villarroya, & Mereu, 2018).

Измерение абсолютного количества OTU более действенно, чем расчет их соотношения, особенно в тех случаях, когда начальная плотность микробов существенно различается. Например, относительное содержание OTU X может быть идентичным в образце A и образце B, в то время как его абсолютная концентрация может быть в три раза ниже, если образец B имеет треть общей плотности бактерий образца A (Props et al., 2017). Это биологически значимо, поскольку в образцах фекалий человека наблюдались 10-кратные вариации микробной нагрузки, связанные с энтеротипом (Vandeputte et al., 2017). Кроме того, вывод о сетях взаимодействия страдает от эффекта композиционности при использовании данных об относительной численности, а не об абсолютной численности (Jackson, 1997; Vandeputte et al., 2017). Анализ соотношений между видами или вариаций кривой численности видов может обойти смещение данных об относительном составе для часто отбираемых временных рядов (Morton et al., 2019), но он менее точен, чем абсолютное количественное определение.

В последние годы были предприняты попытки измерить абсолютное количество микробов вместо того, чтобы рассчитывать их пропорцию (Таблица 1). Например, количественная полимеразная цепная реакция (кПЦР) использовалась для оценки абсолютной численности грибов по их относительной численности, измеренной с помощью секвенирования 454 (Dannemiller, Lang-Yona, Yamamoto, Rudich, & Peccia, 2014). Проточная цитометрия использовалась для оценки абсолютной концентрации их OTU и предотвращения ложных взаимосвязей из-за пропорций в окружающей среде (Props et al., 2017) или фекальных (Vandeputte et al., 2017) образцов. Последнее исследование показало, что кПЦР (без какого-либо внутреннего стандарта для измерения выхода ДНК) не так эффективна, как проточная цитометрия. Еще одно решение для учета микробной плотности — это добавление в образцы известного количества клеток. Например, Штеммлер и др. Добавили в образцы фекалий мышей смесь бактерий, которые не существуют в микробиоме кишечника в физиологических условиях, чтобы количественно оценить OTU (Stämmler et al., 2016).Совсем недавно Пивош и его коллеги добавили 7,5 × 10 7 клеток Escherichia coli на образец, чтобы восстановить абсолютную численность других ОТЕ, присутствующих в образце (Piwosz et al., 2018).

Таблица 1. Сравнение доступных методов оценки абсолютной концентрации микробов в пробах окружающей среды.
Добавление Метод обнаружения Меры Цель нормализации Ограничение Номер ссылки
  • Относительное количество прочтений в каждой выборке
  • Нет количественной оценки между образцами
Verschuren et al.(2018)
  • Проточная цитометрия
  • 16S секвенирование
  • Относительная численность ОТУ
  • Количество клеток на мг
  • Проточный цитометр требует свежих образцов
  • Возможное смещение, если клетки не могут быть извлечены / амплифицированы
Vandeputte et al.(2017)
Клетки микробные к образцу
  • Обилие ОТЕ относительно E.coli
  • Начальная плотность / эффективность экстракции
  • Вид должен отсутствовать в пробах
Piwosz et al.(2018), Stammler et al. (2018)
Геномная ДНК
  • Производительность рабочих процессов метагеномики
  • Вид должен отсутствовать в пробах
Venkataraman et al.(2018)
Внутренний стандарт синтетической ДНК
  • 16S секвенирование области V4
  • Относительное количество чтений
  • Начальная плотность / эффективность экстракции для получения количества OTU на мг (необязательно преобразовано в количество клеток на мг через базу данных)
  • 20–80% посвящено измерению внутреннего стандарта ДНК
  • Трудно калибруемая доза внутреннего стандарта
  • Может использоваться только с 515F / 806R
  • Предполагается 100% лизис на первом этапе экстракции ДНК
Tkacz et al.(2018)
  • Относительное количество чтений
  • копий 16S рРНК на мг
  • Начальная плотность / эффективность экстракции для получения количества ОТЕ на мг
  • Предполагается 100% лизис на первом этапе экстракции ДНК
Это исследование
  • Сокращения: OUT, операционная таксономическая единица; КПЦР, количественная ПЦР.

Некоторые авторы используют добавку ДНК, а не целые клетки, потому что количественное определение ДНК проще, точнее и воспроизводимо. Венкатараман и его коллеги продемонстрировали полезность такого стандарта в исследованиях, основанных на секвенировании дробовика (Venkataraman et al., 2018), но все же требовалось предварительное знание ДНК, которая могла присутствовать в образцах.

Чтобы создать дополнительный стандарт, который не требует предварительного знания видов, уже присутствующих в образцах, Ткач и др. Создали синтетический стандарт для метабаркодирования, который нельзя найти ни в каких известных живых клетках (Tkacz, Hortala, & Poole , 2018), что позволило им количественно оценить абсолютное содержание прокариотических 16S, эукариотических 18S и грибковых ITS в образцах почвы с помощью трех отдельных реакций секвенирования.Однако эта стратегия по-прежнему требует точной оценки плотности бактерий в образце, поскольку внутренний стандарт ДНК должен быть добавлен в количестве, соответствующем 20–80% генов 16S рРНК. Следует отметить, что это также означает, что очень большая часть усилий по определению последовательности посвящена стандарту. Кроме того, этот стандарт можно использовать только с набором праймеров 515F / 806R.

Здесь мы описываем внутренний стандарт синтетической ДНК, который может быть количественно определен с помощью кПЦР, чтобы учесть выход извлеченной ДНК (Рисунок A1).Этот стандарт также может быть определен количественно путем прямого секвенирования, нацеленного на области V3-V4 или V4-V5 гена 16S рРНК с любым праймером, фланкирующим гипервариабельные области V3 и / или V4 и / или V5 гена 16S рРНК. Мы также использовали праймеры для секвенирования для оценки бактериальной нагрузки, чтобы оптимально определить абсолютное количественное определение каждой OTU на основе секвенирования и количественной ПЦР. Предложенный здесь метод был протестирован на образце фекалий, но его можно применить практически к любому образцу окружающей среды.

2 МАТЕРИАЛЫ И МЕТОДЫ

2.1 Разработка и производство синтетического шипа, используемого в качестве внутреннего стандарта ДНК

Производство внутреннего стандарта ДНК выполнялось в соответствии со следующими этапами (Рисунок A2):

Шаг 1. Амплифицируйте соответствующую область внутреннего стандарта ДНК длиной 733 п.н. Эти 733 п.н. точно соответствуют 733 п.н. из E. coli str. К-12 подл. MG1655 NC_000913.3: 4035531-4037072, за исключением того, что 45 пар оснований между положениями 610 и 700 (в области 4) были модифицированы идентифицируемыми структурами из 17, 16 и 12 п.н. (Фиг.1). Эти 45 оснований были выбраны, чтобы избежать вторичных структур гена 16S рРНК и обеспечить простую количественную оценку внутреннего стандарта ДНК путем секвенирования или количественной ПЦР. В нашем случае синтетическая последовательность, заказанная у GeneArt (Thermo Fisher), была доставлена ​​в плазмиде pMK (Thermo Fisher), и получение синтетической последовательности было выполнено с парой праймеров 343F / 784R с адаптерами Illumina miseq для продукта, добавленными в образцы (т.е., 5′-CTTTCCCTACACGACGCTCTTCCGATCTTACGGRAGGCAGCAG и 5′-GGAGTTCAGACGTGTGCTCTTCCGATCTTACCAGGGTATCTAATCCT), так и с парой праймеров на 343F / 908R с miseq адаптеров Illumina (т.е. 5′-GGAGTTCAGACGTGTGCTCTTCCGATCTCCCCGYCAATTCMTTTRAGT) для того, чтобы генерировать стандартные кривые, которые могут быть использованы с 343F / 784R или 515F / 908R.

Схематическое изображение (TOP) и фактическая последовательность внутреннего стандарта ДНК 732bp на основе E. coli K12 MG1655 (BOTTOM).Основания, различающиеся между E. coli и внутренним стандартом синтетической ДНК, показаны красным. Пара праймеров E нацелена на внутренний стандарт ДНК, внесенный в образцы. Другие праймеры с адаптерами Illumina miseq нацелены на все гены 16S рРНК (включая внутренний стандарт). Нумерация соответствует основаниям, выделенным жирным шрифтом. Гипервариабельные области гена 16SrRNA отмечены синим цветом. Сайты связывания праймеров кПЦР отмечены зеленым цветом. Сайты связывания праймеров, использованных в этом исследовании, заключены в рамки

.

Шаг 2. Очистите ампликон с помощью набора Illustra microspin G-50 (GE Healthcare) путем центрифугирования продукта ПЦР при 450 g в течение 5 минут после подготовительного вращения 450 g в течение 5 минут (Рисунок A2).

Шаг 3: Количественно определите продукт ПЦР с помощью флуорометра Qubit 2.0 (Invitrogen), отрегулируйте концентрацию до 20 нг / мкл и преобразуйте в число копий с помощью размера ампликона (эквивалент 2,8 × 10 9 копий / мкл при использовании праймеров 343F / 908R).

2.2

экстракция ДНК, 16S-секвенирование , хранение данных и создание таблицы OTU

Шаг 4: Взвесьте каждый образец (наши образцы весили от 9 до 9 кг).3 и 55 мг).

Шаг 5: Добавьте внутренний стандарт ДНК в буфер для лизиса в соответствующем количестве и извлеките микробную ДНК из образцов, используя этот буфер для лизиса. Например, для 20 образцов мы добавили 20 × 10 8 копий внутреннего стандарта ДНК к 24 × 400 мкл лизирующего буфера, необходимого для экстракции с использованием набора Quick-DNA ™ Fecal или Soil Microbe Miniprep Kit ™ (Zymo Research ) согласно инструкции производителя. 15-минутную стадию взбивания шариков при 30 Гц применяли с помощью смесительной мельницы Retsch MM400.Объем элюирования составлял 100 мкл.

Шаг 6: амплифицировать вариабельные области гена 16S рРНК с совместимыми праймерами и последовательностями с помощью химии Illumina. Здесь мы использовали праймеры 343F и 784R и конвейер, описанный ранее (Verschuren et al., 2018). Вкратце, область V3V4 амплифицировали из очищенной геномной ДНК (гДНК) с праймерами F343 и R784 с использованием 30 циклов амплификации с температурой отжига 65 ° для получения ампликона 510 п.н., хотя точная длина варьируется в зависимости от организмов.Поскольку MiSeq позволяет выполнять парные чтения с битрейтом 250 бит / с, концы каждого чтения перекрываются и могут быть сшиты вместе, чтобы генерировать чрезвычайно высококачественные полноразмерные чтения всей области V3 и V4 за один прогон. Однократное мультиплексирование выполняли с использованием домашнего индекса 6 пар оснований, который был добавлен к R784 во время второй ПЦР с 12 циклами с использованием прямого праймера (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC) и обратного праймера (CAAGCAGAAGACGGCATACGAGAT-index-GTGACGGGAGTTCAG). Полученные продукты ПЦР очищали и загружали в картридж Illumina MiSeq в соответствии с инструкциями производителя.Качество прогона было проверено внутренне с помощью PhiX, а затем каждая пара-концевая последовательность была назначена своей выборке с помощью ранее интегрированного индекса. Последовательности на концах каждой пары были собраны с использованием программного обеспечения Flash (Magoc & Salzberg, 2011) с использованием перекрытия не менее 10 пар оснований между прямой и обратной последовательностями, что допускает 10% несоответствия. Все последовательности публично доступны на NCBI под BioProject PRJNA531076. Они были обработаны с помощью конвейера DADA2 (Callahan et al., 2016) со следующими параметрами: обрезать 17 п.н. из каждого фрагмента, чтобы удалить праймеры, отфильтровать последовательности ниже 390 п.н. после слияния R1 и R2 или последовательностей с неопределенными основаниями, удалить химеру с помощью метода консенсуса.

Шаг 7 (только если содержание внутреннего стандарта ДНК достаточно высоко для прямой количественной оценки последовательностей): Идентификация нашего внутреннего стандарта ДНК в данных секвенирования была выполнена путем обнаружения следующего шаблона в последовательности: «ATCGATCG.* .ACGTACGTACGT. *. CGATTGAAAT. «

2.3 КПЦР по внутреннему стандарту ДНК

Шаг 8a: Создайте пробирки, содержащие 10–10 8 копий ампликона 343F / 908R внутреннего стандарта ДНК (см. Выше; Рисунок A2).

Шаг 8b: Создайте пробирки, содержащие 2,5 мкл 100-кратно разведенной ДНК, экстрагированной из образца с добавлением 10 8 копий внутреннего стандарта ДНК на пробирку.

Step8c: Создайте пробирку, содержащую 2.5 мкл 100-кратно разведенной ДНК, экстрагированной из необработанного образца, чтобы убедиться, что образец не содержит фрагментов, амплифицируемых с парой праймеров E.

Шаг 9: Добавьте 0,1 мкл прямого и обратного праймеров E 5′-CAGATGTGAAATCATCGATCG / 5′-CCGATTTCAATCGTACACCTG, 5 мкл смеси PowerUp SYBR Green Master Mix (Thermo Fisher Scientific) и 2,3 мкл стерильной воды, свободной от нуклеаз, для получения 10 мкл смесей для ПЦР. . Обратите внимание, что прямой праймер E был разработан так, чтобы перекрывать два из трех тегов внутреннего стандарта ДНК (рис. 1).

Шаг 10: Выполните 40 циклов двухэтапной программы (95 ° C в течение 30 секунд и 60 ° C в течение 3 минут), чтобы обеспечить полное удлинение длинных ампликонов в системе QuantStudio 6 Flex с 384-луночными планшетами. Обратите внимание, что 3-минутное удлинение полезно для проведения qPCR всего 16S на том же планшете (см. Ниже). Проверьте отсутствие амплификации в образце без добавок и преобразуйте порог цикла в количество копий с помощью стандартной кривой.

2.4 КПЦР для количественного определения генов 16S рРНК

Шаг 11: Создайте пробирки, содержащие 10–10 8 копий ампликона 343F / 908R внутреннего стандарта ДНК после очистки и количественного определения (см. Выше). Обратите внимание, что внутренний стандарт ДНК также используется для калибровки qPCR, нацеленной на ген 16S рРНК с праймерами 343F / 784R, поскольку последовательность внутреннего стандарта ДНК идентична последовательности E. coli в сайтах связывания 343F и 784R. .

Этап 12: Добавьте 0,1 мкл праймеров 343F / 784R в смеси для ПЦР, состоящие из 5 мкл смеси PowerUp SYBR Green Master Mix (Thermo Fisher Scientific), 2,3 мкл стерильной воды, свободной от нуклеаз, и 2,5 мкл матричной ДНК, разбавленной в 100 раз. Обратите внимание, что также возможна амплификация с праймерами 515F / 806R.

Шаг 13: Выполните 40 циклов двухэтапной программы (95 ° C в течение 30 с и 60 ° C в течение 3 минут), чтобы обеспечить полное удлинение длинных ампликонов в системе QuantStudio 6 Flex с 384-луночными планшетами.Обратите внимание, что 3-минутное удлинение полезно, потому что ампликон длиннее, чем ампликон, который обычно используется в кПЦР (441 п.н. вместо 150 п.н.). Преобразуйте порог цикла в количество копий с помощью стандартной кривой.

2,5 Метод стандартизации

Стандартизация должна быть применена к любой OTU, чтобы получить количество каждой OTU на вес образца. Он использует процентное содержание соответствующих OTU в данных секвенирования, количественное определение внутреннего стандарта ДНК с помощью qPCR и количественное определение общего 16S с помощью qPCR.

Этап 14: Определите количественный выход экстракции ( E , экстракция ), разделив количество копий внутреннего стандарта ДНК, которое было измерено на этапе 10 (в копиях / мкл), на количество копий, добавленных на этапе 5 () . Как правило, на этом этапе необходимо учитывать объем, в котором была элюирована ДНК (здесь 100, см. Этап 5), и коэффициент разведения, использованный перед qPCR (здесь 100, см. Этап 8). Шаг 15: Умножьте этот выход экстракции на количество 16S копий на вес ( W ) образцов фекалий, используемых для экстракции (qPCR на разбавленном образце), и на соотношение каждой OTU в данных секвенирования.Например, нормализованная численность первой OTU в первом примере выглядит следующим образом: где — количество копий генов 16S рРНК, измеренное на этапе 13.

2.6 Эксперимент 1: Тестирование диапазона концентраций внутреннего стандарта ДНК

Чтобы проверить линейность количественного определения с различными соотношениями биомассы по отношению к внутреннему стандарту ДНК, мы протестировали различные количества внутреннего стандарта ДНК на этапе 5, а именно 2.8 10 6 , 2,8 10 7 , 1,4 × 10 8 и 2,8 × 10 8 копий внутреннего стандарта ДНК для извлечения 38, 55, 38 и 43 мг фекалий, происходящих от 99-дневного -старой свиноматке (следовательно, стремясь к содержанию генов 16S рРНК 0,05–4%).

2.7 Эксперимент 2: Имитация увеличения численности OTU в образце фекалий

Чтобы имитировать увеличение численности OTU в стабильном сообществе, мы добавили E.coli в образцы фекалий 99-дневной свиноматки. Точный вес каждого образца регистрировали с помощью весов Mettler AE200 (Mettler Toledo) с точностью 0,1 мг, и они варьировались от 9,3 до 16,1 мг. Штамм E. coli был предварительно выделен в лаборатории и выращен в течение ночи в 24 мл среды Лурия-Бертани (LB) при 30 ° C. Затем клетки центрифугировали при 8000 g в течение 5 мин при 20 ° C, чтобы уменьшить объем суспензии до 450 мкл. Мы добавили в трех экземплярах 0, 1, 5, 10 и 100 мкл E.coli в количестве 10 7 клеток / мкл до примерно 10 мг образца фекалий (точный вес варьировался от 9,3 до 16 мг) в 15 пробирок, помеченных в порядке возрастания (т. е. диапазон от 0 до 8,6 × 10 7 клеток / мг). Точная плотность клеток 1,1 10 7 ± 2,7 × 10 6 клеток / мкл была определена путем посева серийных разведений на планшеты LB в трех экземплярах. Внутренний стандарт ДНК добавляли в количестве 2,7 × 10 7 копий на пробирку, добавляя его к 400 мкл буфера для лизиса BashingBead, используемого для экстракции ДНК (следовательно, приблизительно 1% от общей концентрации копий 16S, исходя из предположения, что фекальные образцы содержат 10 10 бактериальных клеток / мг).Восстановление ДНК измеряли в 15 пробирках. Был секвенирован один из трех экземпляров (отсюда пять пробирок), и стандартное отклонение было аппроксимировано биномиальным законом.

3 РЕЗУЛЬТАТЫ

Внутренний стандарт — это искусственная последовательность ДНК, которая содержит определенный паттерн ATCG, который отличает его от каждой последовательности гена 16S рРНК, введенной в Genbank. Последовательность ДНК добавляется к образцу перед экстракцией ДНК, чтобы ее восстановление могло количественно определить выход экстракции.Затем мы можем рассчитать абсолютное количество генов 16S рРНК в образце после лизиса на основе измерения кПЦР, нацеленного на гены 16S рРНК, и этот выход экстракции. Здесь мы сначала проверяем линейность сигнала во всем диапазоне обнаружения. Во-вторых, для проверки точности метода был проведен эксперимент с использованием клеток E. coli .

3,1 Широкий допустимый диапазон соотношения внутреннего праймера и общего гена 16S рРНК

Эффективность пары праймеров E, детектирующей внутренний стандарт ДНК в серийных разведениях, составила 90% (рис. A3), что позволило точно определить количество внутреннего стандарта.Количественная оценка была линейной от 10 2 до 10 8 копий / мкл ( R 2 = 0,99; Рисунок A3), что позволяет определять очень широкий диапазон 6 log. Эффективность праймеров, определяющих нагрузку гена 16S рРНК с помощью кПЦР с парой праймеров 343F / 784R, была удовлетворительной (68,7%; R 2 = 0,998; Рисунок A4). Оба праймера имели одинаковый диапазон применимости, то есть от 10 2 до 10 8 копий на реакцию ПЦР. Неудивительно, что количественная оценка внутреннего стандарта была линейной в четырех образцах, в которых значение внутреннего стандарта находилось в диапазоне от 0.05% и 3,8% от общего количества генов 16S рРНК (данные не показаны). Выход извлечения ДНК составил 46 ± 4% для этих четырех экстракций, выполненных на одном и том же образце фекалий. Следовательно, количественное определение внутреннего стандарта является точным и не зависит от биомассы, присутствующей в образце.

3.2 Обнаружение OTU, численность которой увеличивается

Значение абсолютного количества микробов для понимания динамики видов между выборками очевидно в случае сильного увеличения численности OTU, в то время как большинство OTU остаются стабильными.Чтобы имитировать эту ситуацию, мы добавили различное количество клеток E. coli в образец фекалий свиньи — то есть , между 0 и 8 × 10 7 на мг фекалий, таким образом, создав набор искусственных образцов в при этом все OTU, кроме E. coli , остаются постоянными. Затем мы демонстрируем, что использование внутреннего стандарта позволяет нам точно охарактеризовать эту динамику, в то время как отношения, полученные с помощью классического конвейера секвенирования, этого не делают. Действительно, при использовании измерений кПЦР для корректировки выхода выделения ДНК (таблица 1) общая микробная нагрузка увеличилась с 43 ± 2 до 110 ± 65 × 10 7 копий на мг.Рассчитанное количество копий гена 16S рРНК E. coli варьировало от 10 6 копий / мг в пробирке 1 до 8 × 10 8 копий / мг в пробирке 13 (Таблица A2), что относительно близко к ожидаемые значения, поскольку мы искусственно добавили 8 × 10 7 клеток E. coli / мг в пробирке 13 и E.coli имеет семь копий генов рРНК на геном. Другими словами, добавление одной клетки E. coli привело к добавлению 8,9 копий генов 16S (рис. 2).Таким образом, использование внутреннего стандарта действительно может обнаружить повышенное содержание конкретной OTU среди сложного образца, содержащего 428 OTU, которые являются стабильными в течение эксперимента (рисунок A6).

Взаимосвязь между количеством добавленных клеток E. coli и количеством генов 16S РНК E. coli , рассчитанных с помощью метода, представленного в статье. Поскольку каждая клетка E. coli содержит 7 копий генов 16S рРНК, мы ожидаем 7-кратного различия.Тем не менее, мы наблюдаем 8,9-кратную разницу, что означает, что каждая клетка E. coli имеет 8,9 копий генов 16S рРНК, что, вероятно, связано с остаточным ростом клеток. Планки погрешностей могут быть меньше символа

.

3.3 Обнаружение внутреннего стандарта в данных секвенирования

Теги внутреннего стандарта могут использоваться для идентификации внутреннего стандарта в таблице содержания OTU. При использовании простого метода пропорциональности для наших данных (от четырех до девяти отсчетов из 10 808 последовательностей) мы получаем 1.На 9 оценок выше, чем при кПЦР (данные не показаны).

3.4 Измерение выхода выделенной гДНК как побочного продукта добавления внутреннего стандарта

Описанный метод кПЦР позволяет количественно оценить восстановление гДНК для каждого образца. В настоящем исследовании восстановление гДНК в 15 образцах эксперимента 1 и четырех образцах из эксперимента 2 варьировалось от 40% до 84% (60 ± 12%), что свидетельствует о необходимости внутреннего стандарта (рисунок A5).

4 ОБСУЖДЕНИЕ

4.1 Полезность широкого приемлемого диапазона соотношения между внутренним праймером и общим геном 16S рРНК

В этом исследовании мы предлагаем метод получения количественных данных о численности на основе микробиологических исследований путем добавления внутреннего стандарта перед экстракцией ДНК. Мы также предлагаем метод на основе количественной ПЦР в качестве альтернативы прямому измерению этого внутреннего стандарта в данных секвенирования следующего поколения (NGS). Вкратце, qPCR с парой праймеров E количественно определяет внутренний стандарт, а qPCR с праймерами 343F / 784R количественно определяет общее количество генов 16S рРНК (праймеры 343F / 784R также определяют внутренний стандарт, который представляет собой слегка измененную последовательность из E.coli , ген 16S РНК). Обнаружение внутреннего стандарта с помощью qPCR вместо использования прямого подсчета последовательности внутреннего стандарта в данных NGS позволяет нам добавлять незначительные количества внутреннего стандарта, что позволяет избежать потери 20% -80% усилий по секвенированию для внутреннего стандарта в качестве в методе с использованием синтетического стандарта, разработанного Tkacz et al. (Tkacz et al., 2018). Наш метод на основе qPCR позволяет избежать недооценки редких последовательностей путем секвенирования (Gonzalez, Portillo, Belda-Ferre, & Mira, 2012).Действительно, цели ниже 1% недооцениваются с помощью ПЦР, когда присутствует несколько целей. К счастью, мишени, представляющие 30% образца, хорошо оцениваются при глубине секвенирования 10 4 последовательностей на образец (Gonzalez et al., 2012). Интересно, что при использовании простого метода пропорциональности для наших данных (от четырех до девяти отсчетов из 10808 последовательностей) мы получаем в 10 раз более высокие оценки, чем при кПЦР, вероятно, потому, что стандартные подсчеты занижены, как и любая другая цель, около 1% от относительное обилие.Следует отметить, что недооценка редких OTU с помощью ПЦР не относится к обнаружению с помощью количественной ПЦР, которая конкретно нацелена на внутренний стандарт (следовательно, присутствует только одна цель). В этом контексте добавление незначительных количеств внутреннего стандарта вместо 20–80% также позволяет избежать потенциальных ошибок в расчетах, которые могут привести к перегрузке внутреннего стандарта.

4.2 Полезность измерения выхода извлеченной гДНК для количественной ПЦР оценки бактериальной нагрузки

Еще одним преимуществом описанного здесь метода кПЦР является то, что мы смогли количественно оценить восстановление гДНК для каждого образца с точностью 5% (таблица A4).В настоящем исследовании извлечение гДНК варьировалось от 46% до 84%, что согласуется с извлечением 37%, о котором сообщалось ранее для методов взбивания шариков (Вишнивецкая и др., 2014). Отчасти это связано с неполным извлечением супернатанта во время процедуры экстракции ДНК. Изменчивость экстракции также наблюдается в исследовании, сравнивающем технические повторения с биологическими повторениями (Dannemiller et al., 2014). Такая вариабельность затрудняет использование количественной ПЦР без внутреннего стандарта, и нельзя игнорировать двукратную разницу в выходе ДНК.Действительно, Vandeputte сообщает о биологически значимых трехкратных различиях в плотности бактерий между пациентами с болезнью Крона и здоровыми людьми из контрольной группы (Vandeputte et al., 2017).

Внутренний стандарт следует добавить перед экстракцией ДНК, чтобы получить абсолютное количественное определение. Вариабельность скорости выделения гДНК (и, следовательно, вариабельность эффективности экстракции ДНК) может частично объяснить неточность оценки микробной плотности с помощью кПЦР, когда она не сочетается с внутренним стандартом, корректирующим эффективность экстракции (Dannemiller et al., 2014; Vandeputte et al., 2017). Для сравнения, Хардвик и его коллеги создали набор из 86 дополнительных стандартов для метагеномики дробовика (Hardwick et al., 2018): 86 синтетических стандартов были добавлены после этапа экстракции ДНК, что позволило оценить только систематические ошибки секвенирования. но ни исходная численность, ни выход восстановления гДНК. Добавление внутреннего стандарта перед экстракцией ДНК и оценка эффективности экстракции имеет решающее значение. Поскольку мы добавили синтетическую ДНК, мы фактически измерили выходы извлечения гДНК, а не эффективность извлечения ДНК, которая была бы комбинацией эффективности лизирующих клеток и выхода извлечения гДНК.Следует отметить, что взбивание шариков обычно эффективно разрушает клетки (de Bruin & Birnboim, 2016), и рекомендуются протоколы, основанные на избиении шариков (Yuan, Cohen, Ravel, Abdo, & Forney, 2012). Синтетическую ДНК добавляли в лизирующий буфер, чтобы избежать быстрой деградации во внеклеточной среде.

4.3 Сравнение с другими методами измерения абсолютного количества бактерий

Было предложено несколько методов разработки внутреннего стандарта с использованием ДНК или клеток (таблица 1).Некоторые недавние исследования рекомендуют использовать проточную цитометрию для оценки общей бактериальной нагрузки (Props et al., 2017; Vandeputte et al., 2017). Несмотря на относительную сложность доступа к высококачественному проточному цитометру, способному своевременно обнаруживать бактериальные клетки, этот метод основан на диссоциации бактериальной биомассы на отдельные клетки путем разбавления, перемешивания и фильтрации образца сразу после сбора. Это нетривиальный шаг для образцов, в которых бактерии прикреплены друг к другу или к субстрату, и точный протокол диссоциации, используемый перед проточной цитометрией, может ввести двойной фактор (Falcioni et al., 2006), что требует процедуры межлабораторной калибровки для точного сравнения результатов. Для ценных или трудноизвлекаемых образцов количество материала может быть ограничено и не позволяет использовать материал как для проточной цитометрии, так и для экстракции ДНК. Однако, как обсуждалось выше, для точности количественной ПЦР перед экстракцией ДНК требуется добавить внутренний стандарт. По нашему мнению, кПЦР — это непревзойденный способ нормализации данных секвенирования, поскольку он использует тот же методологический рабочий процесс, от выделения ДНК до тех же праймеров, что и реакция секвенирования.Другими словами, бактериальный вид, который не может быть амплифицирован (поскольку его клетки устойчивы к протоколу выделения ДНК или его фрагмент не амплифицируется используемыми праймерами), не повлияет на расчеты численности, наблюдаемой в данных секвенирования, скорректированных с помощью данных qPCR. . Для видов, у которых сложно выделить ДНК путем взбивания шариков, наш метод сообщает, что присутствовало не менее X копий / мг образца.

Некоторые авторы предложили добавлять клетки в качестве внутренних стандартов перед экстракцией ДНК, но мы полагаем, что добавление синтетической ДНК обеспечивает больший контроль, чем добавление клеток, точное количество генов 16S рРНК на клетку которых трудно контролировать.Действительно, растущие клетки E. coli могут содержать до 38 копий на клетку вместо семи копий на геном из-за множественных репликационных вилок (Bremer & Dennis, 2008). Добавление голодных клеток является более точным (рисунки A7 и A8; таблица A3), но также следует отметить, что базы данных, связывающие роды и количество копий гена 16S рРНК, основаны на секвенировании генома, а не на фактических измерениях растущих клеток. Следовательно, любая база данных будет связывать семь копий на клеток E. coli (Vandamme & Coenye, 2003), даже если это число может не соответствовать растущим клеткам E.coli в реальном образце (Bremer & Dennis, 2008). Это означает, что любая оценка бактериальной популяции на основе генов 16S рРНК по-прежнему подвержена систематической ошибке, если популяция растет. Например, наша популяция E.coli имела 9,5 ± 1,5 копий на клетку, что иллюстрирует сложность методов, основанных на клетках, а не на синтетической ДНК.

Наш дизайн внутреннего стандарта ДНК включает несколько ключевых особенностей, представляющих собой улучшение по сравнению с синтетическим стандартом, разработанным Ткачем и др. (Ткач и др., 2018). Первое улучшение — это возможность добавлять крошечные количества внутреннего стандарта нашей ДНК и при этом обнаруживать его с помощью кПЦР, что позволяет сосредоточить усилия по секвенированию на неизвестных микробах, как упоминалось выше. Во-вторых, широкий диапазон измерений позволяет добавлять одинаковое количество внутреннего стандарта ДНК к каждому образцу независимо от количества клеток. Один из простых способов использовать наш внутренний стандарт ДНК — это добавить его в буфер для лизиса, что делает его очень простой модификацией протокола. В-третьих, наш стандарт способен справиться с областями V3-V4 или V4-V5 гена 16S рРНК, что дает лучшее разрешение, чем только область V4 Ткач и др. (Tkacz et al., 2018). Наш внутренний стандарт ДНК совместим с любым праймером, фланкирующим эти области, потому что мы просто добавили метки в область V4 фрагмента 313-1034 гена 16S рРНК. Следовательно, в дополнение к праймерам, используемым в этом исследовании, следующие праймеры также совместимы с нашим внутренним стандартом ДНК в соответствии с номенклатурой Baker и его коллег (Baker, Smith, & Cowan, 2003): E334F, E341F, U341F, U515, U519F, E926R, U926R и E939R. В-четвертых, метки внутреннего стандарта ДНК минимизируют потенциальную ошибку ПЦР.Этого смещения можно избежать, поскольку основная последовательность внутреннего стандарта ДНК основана на E. coli , а 45 модифицированных оснований избегают известных вторичных структур, сохраняя при этом сбалансированное содержание GC, поскольку содержание GC в последовательности может влиять на пропорцию в данные секвенирования (Aird et al., 2011).

4.4 Область применения нашей системы внутренних стандартов DNA

Несмотря на точное количественное определение количества копий гена 16S рРНК в образце, внутренний стандарт ДНК не снимает общих ограничений методов на основе ПЦР, связанных с количеством копий гена 16S рРНК на клетку или с клеточно-специфической разницей в экстракции. эффективность, например стойкость спор (de Bruin & Birnboim, 2016).Следует отметить, что ингибиторы ПЦР могут повлиять на оценку количественной ПЦР. Таким образом, мы рекомендуем проверять эффективность каждой кривой амплификации и применять индивидуальную линейную регрессию (Ruijter et al., 2009) или при необходимости добавлять поливинилполипирролидон для удаления ингибиторов ПЦР (Fuentes & Arbeli, 2007).

В заключение, мы рекомендуем регулярно добавлять внутренний стандарт ДНК к любому образцу окружающей среды, который необходимо секвенировать, перед выделением ДНК. Небольшие количества добавленного внутреннего стандарта ДНК, разрешенные нашим методом qPCR (0.05% от общего числа копий гена 16S рРНК, если используется кПЦР, 20%, если внутренний стандарт ДНК оценивается по данным секвенирования) и сходство с E . coli 16S рРНК гарантирует, что это добавление не препятствует классическому конвейеру метабаркодирования. Это дополнение позволяет корректировать начальную плотность бактерий, тем самым позволяя исследователям лучше связывать свои микробные данные с фенотипами, для которых абсолютная концентрация бактерий имеет решающее значение. Кроме того, количественная оценка с использованием внутреннего стандарта ДНК может частично компенсировать различные методы экстракции, необходимые в реальных исследованиях.Эта особенность важна, поскольку представленная здесь методология предназначена для применения во многих сложных средах, таких как почва, отложения, компост, биопленка, инженерные среды и кишечник.

БЛАГОДАРНОСТИ

Эта работа была выполнена в сотрудничестве с основным предприятием GeT, Тулуза, Франция (http://get.genotoul.fr), при поддержке инфраструктуры France Génomique National, финансируемой в рамках программы «Investissement d’avenir» под управлением Агентства Nationale pour la Recherche (контракт ANR-10-INBS-09).Мы также благодарим Матильду Хазон-Ле Шеллур и Дэвида Ренодо за предоставленный образец свиньи.

    КОНФЛИКТ ИНТЕРЕСОВ

    Авторы заявляют об отсутствии конфликта интересов.

    ВКЛАД АВТОРА

    OZ, JJG, CA, LV и JH концептуализировали данные; LC участвует в курировании данных; OZ формально проанализировал данные и участвовал в привлечении финансирования, администрировании проектов и привлечении ресурсов; BG, MLDA и LV провели расследование; OZ, MLDA и LV, вовлеченные в методологию; OZ и JJG участвовали в надзоре и написали первоначальный черновик; BG провела валидацию; все авторы писали, рецензировали и редактировали статью.

    Приложение 1

    1. Сравнение традиционного конвейера для анализа обследований 16S рРНК и использования внутреннего стандарта

    Принцип метода основан на добавлении известного количества синтетической цепи ДНК перед этапом экстракции (на рисунке 2 копии / г) для оценки выхода извлечения ДНК во время экстракции. Эта информация позволяет использовать количественную оценку экстрагированной ДНК в конце этапа экстракции для оценки исходного содержания суспендированной ДНК сразу после лизиса

    Конвейер, использующий внутренний стандарт, оценивает количество копий 16S рРНК на грамм образца вместо простой оценки соотношений.Это очень полезно, если нужно сравнить образцы с разной плотностью.

    Следует отметить, что соотношение внутреннего стандарта и генов 16S рРНК можно оценить либо путем прямого подсчета в данных секвенирования, либо с помощью количественной ПЦР. КПЦР предлагает широкий диапазон, что позволяет избежать сложного первоначального предположения о микробной плотности в каждом образце.

    2. Схема трубопровода с использованием внутреннего стандарта и КПЦР

    Подробная схема трубопровода с использованием внутреннего стандарта, оцененного с помощью количественной ПЦР и NGS

    Следует отметить, что суть метода основана на оценке внутреннего стандарта для корректировки выхода извлеченной ДНК.Количественная ПЦР позволяет добавлять небольшие количества внутреннего стандарта, что позволяет избежать перерегулирования и затруднить получение данных секвенирования путем простого секвенирования слишком большого количества внутреннего стандарта. При использовании большого количества внутреннего стандарта количественная ПЦР бесполезна, поскольку данные секвенирования можно использовать напрямую.

    3. Количественная ПЦР генов внутреннего стандарта и тотальной 16S рРНК

    3.1 Принцип количественной ПЦР

    Количественная ПЦР — это ПЦР, в которой флуоресценция измеряется в конце каждого цикла.Флуоресценция пропорциональна количеству двухцепочечных цепей ДНК. В нижеследующем абзаце мы описываем, как эту технологию можно использовать для количественной оценки внутреннего стандарта и общего количества генов 16S рРНК (включая внутренний стандарт). Для оценки начальной концентрации 16S рРНК. Затем общее количество генов рРНК корректируется на выход извлеченной ДНК.

    3.2 Количественное определение внутреннего стандарта с праймерами E

    Стандартные кривые количественной ПЦР для измерения внутреннего стандарта ДНК (TOP) и соответствующие кривые амплификации с серийными разведениями внутреннего стандарта (BOTTOM).Пробирки от серийных разведений, которые используются для расчета эффективности праймеров, отмечены синим цветом (здесь 91%). Тройной замер на пробирке из эксперимента выделен красным. Заготовки ПЦР окрашены в зеленый цвет. Стандартное отклонение может быть меньше символа

    .

    3.3 Количественная оценка общих генов 16S рРНК с 343F / 784R

    Стандартные кривые количественной ПЦР для измерения общего количества копий 16S рРНК (TOP) и соответствующие кривые амплификации с серийными разведениями внутреннего стандарта (который представляет собой модифицированную последовательность 16S) (BOTTOM).Пробирки от серийных разведений, которые используются для расчета эффективности праймеров, отмечены синим цветом (здесь 68%). Тройной замер на пробирке из эксперимента выделен красным. Заготовки ПЦР окрашены в зеленый цвет. Стандартное отклонение может быть меньше символа

    .

    3.4 Расчет эффективности грунтовки

    Эффективность праймеров (E) рассчитывалась с использованием серийных разведений, содержащих от 100 до 10 8 копий внутреннего стандарта с: E = 10 ^ (- 1 / наклон) -1.

    4. Подробные данные эксперимента по добавке

    4.1 Полные данные кПЦР для 15 образцов с увеличением

    концентраций E. coli Таблица A1. Данные КПЦР для 15 образцов с увеличением концентрации E. coli
    1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
    Данные для метода qPCR мг кал 11.2 10,2 12,4 13,1 9,6 11,4 12,5 9.9 9,3 13,9 13 9,7 12,7 11,1 16.1
    added_std 3.E + 07 3.E + 07 3.E + 07 3.E + 07 3.E + 07 3.E + 07 3.E + 07 3.E + 07 3.E + 07 3.E + 07 3.E + 07 3.E + 07 3.E + 07 3.E + 07 3.E + 07
    added_std_per_mg 2.E + 06 3.E + 06 2.E + 06 2.E + 06 3.E + 06 2.E + 06 2.E + 06 3.E + 06 3.E + 06 2.E + 06 2.E + 06 3.E + 06 2.E + 06 3.E + 06 2.E + 06
    Velution 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100
    коэффициент разбавления 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100
    измерения КПЦР Std_M1 (копий / мклПЦР) 2,082 1880 1886 1,762 2,443 2,048 1834 1 914 2,044 1 706 1,729 1873 1,357 1,232 1,469
    Std_M2 (копий / мклПЦР) 1,526 1 935 1,568 1819 2,073 2 178 1,712 1834 1,761 1,682 1,780 1,980 1,267 1,227 1,458
    Std_M3 (копий / мклПЦР) 1 704 1 970 2 005 1826 2,512 2,064 1898 1 802 1,730 1823 1,767 1,998 1,368 1,378 1,730
    Std_in_tube (копии) 2.E + 06 2.E + 06 1.E + 06 1.E + 06 2.E + 06 2.E + 06 1.E + 06 2.E + 06 2.E + 06 1.E + 06 1.E + 06 2.E + 06 1.E + 06 1.E + 06 1.E + 06
    Выход восстановления ДНК 0,64 0,69 0,66 0,65 0,84 0.75 0,65 0,67 0,66 0,63 0,63 0,70 0.48 0,46 0,56
    всего 16S_M1 (копий / мкл pcr) 3.E + 05 4.E + 05 4.E + 05 4.E + 05 3.E + 05 4.E + 05 3.E + 05 3.E + 05 2.E + 05 4.E + 05 4.E + 05 4.E + 05 8.E + 05 9.E + 05 3.E + 05
    всего 16S_M2 (копий / мкл pcr) 3.E + 05 2.E + 05 4.E + 05 2.E + 05 3.E + 05 2.E + 05 4.E + 05 2.E + 05 3.E + 05 3.E + 05 5.E + 05 1.E + 05 6.E + 05 9.E + 05 3.E + 05
    всего 16S_M3 (копий / мкл pcr) 3.E + 05 3.E + 05 4.E + 05 3.E + 05 3.E + 05 4.E + 05 4.E + 05 3.E + 05 4.E + 05 4.E + 05 5.E + 05 3.E + 05 7.E + 05 9.E + 05 4.E + 05
    среднее 16S (копий / мкл pcr) 3.E + 05 3.E + 05 4.E + 05 3.E + 05 3.E + 05 3.E + 05 4.E + 05 3.E + 05 3.E + 05 4.E + 05 5.E + 05 3.E + 05 7.E + 05 9.E + 05 4.E + 05
    среднее 16S (copy_in_tube) 3.E + 09 3.E + 09 4.E + 09 3.E + 09 3.E + 09 3.E + 09 4.E + 09 3.E + 09 3.E + 09 4.E + 09 5.E + 09 3.E + 09 7.E + 09 9.E + 09 4.E + 09
    среднее 16S (копий / мг) 3.E + 08 3.E + 08 3.E + 08 2.E + 08 3.E + 08 3.E + 08 3.E + 08 3.E + 08 3.E + 08 3.E + 08 4.E + 08 3.E + 08 6.E + 08 8.E + 08 2.E + 08

    4.2 Перераспределение выхода восстановления ДНК

    Распределение выхода извлеченной ДНК по образцам. Например, 2 образца имели выход восстановления ДНК от 0,4 до 0,45. Очень большой разброс результатов восстановления ДНК подчеркивает необходимость внутреннего стандарта для коррекции этого смещения

    4.3 Данные кПЦР для отношения

    E. coli / внутренний стандарт, представленные на рисунке 2 Таблица A2.Сравнение количества добавленных клеток E. coli , количества отсчетов в последовательностях и конверсии количества генов 16S рРНК E. coli на мг фекалий. Поскольку каждая клетка E. coli содержит 7 копий генов 16S рРНК, мы ожидаем 7-кратного различия.
    Метод QPCR
    Добавленный объем суспензии E. coli при 1,1 10 7 клеток / мкл (мкл) Добавлено E.coli (клетки) Добавлено E. coli (клеток / мг_фек) # количество 16S генов из E. coli в данных NGS (последовательности E. coli из 10808 последовательностей на образец) Количество генов 16S РНК E. coli , рассчитанное с помощью внутреннего стандарта (копий 16S coli / мг)
    0 0 0.00E + 00 31 (95% доверительный интервал 21–44) 1E + 06
    1 1E + 07 8.38E + 05 191 (95% доверительный интервал 165–220) 6E + 06
    5 5E + 07 4.39E + 06 987 (95% доверительный интервал 928–1047) 5E + 07
    10 1E + 08 7.90E + 06 2214 (95% доверительный интервал 2132–2297) 9E + 07
    100 1E + 09 8.65E + 07 7 172 (95% доверительный интервал 7 074–7 268) 8E + 08

    4,4 Абсолютная концентрация

    E. coli по сравнению с долей в 15 пробирках

    Доля E.coli (ВЕРХНИЙ), соответствующий увеличению E. coli (ВНИЗ). Черные квадраты представляют собой оценку E. coli после нормализации внутренним стандартом ДНК, белые треугольники — OTU, которые не являются E. coli . Общая плотность представлена ​​пунктирной линией. Использование внутреннего стандарта ДНК может определить, что абсолютная концентрация E. coli увеличивается (ВНИМАНИЕ), а не классическое изображение пропорции E.coli 16S последовательности рРНК, которые варьируются (TOP)

    Этот рисунок показывает потенциальную разницу в восприятии, когда рассуждают об абсолютной концентрации бактериальной популяции, а не просто о пропорциях. Мы считаем, что абсолютные концентрации дают преимущество для понимания динамики популяции.

    5. Точность метода при голодании

    клеток E. coli

    Чтобы показать точность метода, мы добавили внутренний стандарт к DH 10B E.coli , выращенные в LB при 30 ° C в течение 7 дней. Плотность бактерий определяли путем посева, и она составляла 3,5 × 10 8 ± 7 × 10 7 coli / мл.

    Затем мы экстрагировали 50 мкл этой суспензии клеток E. coli , используя 750 мкл буфера для лизиса с добавлением 7 × 10 5 копий внутреннего стандарта с использованием набора zymo fecal. Конечный объем элюции составлял 50 мкл. Измерение проводилось в двух экземплярах, чтобы минимизировать ошибки пипетирования.

    Измерение внутреннего стандарта с помощью пары праймеров E для стационарных клеток E. coli . В результате ПЦР мы обнаружили 20,4 ± 1,5 копий внутреннего стандарта. Поскольку ДНК была разбавлена ​​в 10 раз для экстракции, и у нас было 50 мкл элюированной ДНК, это равняется 1,08 × 10 4 копий, обнаруженных после экстракции (из 7 × 10 5 копий стандарта, добавленных к 750 мкл раствора). буфер для лизиса, используемый для каждого образца)

    Измерение общего количества копий 16S рРНК (поэтому эта мера включает внутренний стандарт) с помощью пары праймеров 334F / 784R для стационарного E.coli клеток. Мы обнаружили 3296 ± 146 копий общих генов рРНК в реакции ПЦР. Поскольку ДНК была разбавлена ​​в 10 раз для экстракции и у нас было 50 мкл элюированной ДНК, это равно 1,13 10 8 копий, обнаруженных после экстракции (включая 1,08 × 10 4 копий внутреннего стандарта, обнаруженных после экстракции)

    Для оценки точности метода использовали образец чистых клеток E. coli в стационарных клетках. Для этого конкретного эксперимента мы заменили соотношение, обычно полученное с помощью NGS, на отношение, полученное с помощью qPCR.

    Таблица A3. Пример расчета плотности голодных клеток E. coli с использованием внутреннего стандарта с qPCR
    Volume_added_coli_from_culture_in_stationary_phase (мкл) 50
    Added_coli_cells (так как суспензия содержит 3,5 × 10 8 coli / мл) 1.75E + 07
    Added_internal_standard (копии добавляются через буфер для лизиса) 7.00E + 05
    Количество внутреннего стандарта (qPCR primerE) (копий в пробирке для ПЦР) 20,4
    Разведение_ перед_PCR 10
    Volume_DNA_suspension 50
    Восстановленный_стандарт (копии) 1.08E + 04
    Выход восстановления ДНК 0,015
    Количество всех 16S рРНК (343F / 784R, которые также нацелены на внутренний стандарт) (копии в пробирке для ПЦР) 3296
    Отношение коли к общему количеству фрагментов 16S (обычно определяется секвенированием, здесь определяется данными кПЦР, потому что E.coli — единственный вид в выборке) (3296–20,4) / 3296 = 0,994
    Количество фрагментов 16S, принадлежащих E. coli (копий) 1.13E + 08
    Число копий 16S на клетку E. coli (информация доступна из Picrust2 для любой последовательности 16S) 7
    Estimated_coli_cells 1.47E + 07
    Точность метода (оценка коли / добавленная коли) 92%

    В заключение, принимая во внимание тот факт, что E. coli имеет 7 копий генов 16S рРНК, мы получили 92 ± 11% от количества клеток, оцененного при посеве серийных разведений.Расчет, проиллюстрированный выше, можно использовать для использования внутреннего стандарта без данных NGS, если нужно измерить только несколько представляющих интерес видов и что праймеры qPCR доступны для их количественной оценки (внутренний стандарт просто корректирует вариации в ДНК. выход при извлечении). Этот результат подтверждает, что обнаружение 8,9 копий генов 16S рРНК на клетку E.coli, представленное в статье, является не просто артефактом калибровки метода, но действительно результатом остаточного роста.

    6. Воспроизводимость количественной оценки и погрешность метода

    Чтобы показать воспроизводимость метода, мы извлекли два образца по 10 мг в дубликатах и ​​измерили количество общего содержания гена рРНК, скорректированное на количество внутреннего стандарта. Приведенные ниже данные показывают, что погрешность метода в таком случае составляет <5%.

    Таблица A4. Воспроизводимость метода оценки плотности клеток с помощью КПЦР внутреннего стандарта и общих генов рРНК.Образцы извлекаются и измеряются отдельно. Погрешность метода не превышает 5%.
    Образец 1 (реплика 1) Образец 1 (реплика 2) Образец 2 (реплика 1) Образец 2 (реплика 2)
    Метаданные для метода qPCR вес кала (мг) 10.1 10,5 10,5 9,9
    added_std (копии) 2.78E + 07 2.78E + 07 2.78E + 07 2.78E + 07
    added_std_per_mg 2.75E + 06 2.65E + 06 2.65E + 06 2.81E + 06
    Velution 100 100 100 100
    коэффициент разбавления 100 100 100 100
    измерения КПЦР Std_Measure1 (соответствует / мклПЦР) 17.5 17,8 17,4 17,3
    Std_Measure2 (compies / мклПЦР) 17,4 18,5 17.3 17,3
    Std_Measure3 (compies / мклПЦР) 17,2 17,3 17,3 17,1
    Std_in_tube (копии) 17,185.3 17038,7 16 511,7 17 378,6
    КПД 0,0 0,0 0.0 0,0
    всего 16S_Measure1 (копий / мкл pcr) 17,9 16,8 17,9 16,7
    всего 16S_Measure2 (копий / мкл pcr) 17.7 17,4 17,3 16,9
    всего 16S_Measure3 (копий / мкл pcr) 17,6 18,0 17.7 16,7
    Количество_16S (копий / мкл шт.) 17,7 17,4 16793,5 16932,5
    Количество_16S (копий_в_трубке) 1.8E + 05 1.7E + 05 1.7E + 08 1.7E + 08
    Кол-во_16S (копий / мг) 1.8E + 04 1.7E + 04 1.6E + 07 1.7E + 07
    Оценка ошибки между дубликатами average_between_replicates (копий / мг) 1.71E + 04 1.65E + 07
    std_dev_between_duplicates 6.98E + 02 7.85E + 05
    Ошибка между репликациями (в%) 4,1% 4,7%

    Внутренний круг без контроля




    Избыточный бактериальный рост тонкой кишки (СИБР) оказался более распространенным, чем предполагалось ранее, у 20% людей без симптомов, у 50-75% людей с синдромом раздраженного кишечника (СРК) и у 100% людей с фибромиалгией.СИБР — это форма дисбактериоза, при которой микроорганизмы не только нарушаются по видовому составу, но также поднимаются по кишечному тракту до двенадцатиперстной кишки и желудка, которые должны быть почти стерильными. Из-за трудностей при постановке диагноза распространенность СИБР может быть даже больше, чем предполагалось.


    СИБР является распространенным объяснением неполной реакции на здоровые методы, такие как удаление зерна. Распространенным сценарием является тот, кто болеет фибромиалгией или розацеа и испытывает частичное улучшение с помощью стратегий «Нераскрытый дикий», «Голый», «Немытый», но не испытывает полного облегчения.Обычно СИБР выявляется, затем корректируется, после чего наступает полная ремиссия симптомов. Другими словами, SIBO позволяет возникать состояниям здоровья и позволяет им сохраняться даже после устранения первоначальной причины или способствующих факторов. Поэтому для полного восстановления здоровья часто требуется специальная коррекция СИБР.
    СИБР вызывается рядом факторов: употреблением зерна и сахара, частым употреблением алкоголя, пониженной кислотностью желудка (ахлоргидрия, гипохлоргидрия) из-за предыдущего потребления зерна (через аутоиммунное разрушение париетальных клеток желудка, вырабатывающих желудочную кислоту) или из-за приема желудочной кислоты. блокирующие препараты (ИПП, блокаторы h3), предшествующий прием антибиотиков и факторы, снижающие перистальтику кишечника, такие как диабет, опиатные препараты и нескорректированный гипотиреоз.
    Несколько состояний тесно связаны с SIBO, предполагая, что коррекция SIBO может быть необходимым шагом для достижения полной ремиссии / ответа. Такие условия включают
    • Фибромиалгия: в одном исследовании 100% людей с фибромиалгией имели СИБР.
    • Синдром раздраженного кишечника.
    • Розацеа: лечение СИБР сильно коррелирует с ремиссией.
    • Синдром беспокойных ног.
    • Дефицит витамина B12 и / или фолиевой кислоты, макроцитарная анемия (высокое значение MCV).
    • Боль в суставах.
    • Хронический простатит.
    • Интерстициальный цистит.
    • Полинейропатия.
    • Жировая печень (неалкогольный стеатогепатит).
    • Тромбоз глубоких вен.
    • Целиакия, болезнь Крона, язвенный колит.
    • Колоректальный рак.
    SIBO также может привести к увеличению вероятности колонизации желудка H. pylori, что увеличивает риск гипо- или ахлоргидрии (недостаток желудочного сока) и рака желудка, а также увеличивает вероятность колоректального рака от одного SIBO.

    SIBO может также привести к увеличению вероятности колонизации желудка H. pylori, что увеличивает риск гипо- или ахлоргидрии (недостаток желудочного сока) и рака желудка, а также увеличивает вероятность колоректального рака от одного только SIBO.

    Если присутствует ранее существовавшее желудочно-кишечное состояние, такое как синдром раздраженного кишечника, глютеновая болезнь, болезнь Крона или язвенный колит, или если присутствуют метаболические заболевания, такие как диабет 2 типа, ожирение, аутоиммунное или неврологическое состояние, тогда вероятность SIBO очень высока.Диабет 2 типа, гипотиреоз и употребление опиатов также связаны со снижением перистальтики тонкого кишечника, замедлением прохождения частично переваренной пищи и тем самым способствуя развитию СИБР. (Эффект опиатов, снижающий перистальтику кишечника, также может объяснять одно из средств, которыми пшеница и родственные зерна вносят вклад в SIBO, т. Е. Производные глиадина опиоидные пептиды, которые, как опиаты, отпускаемые по рецепту, замедляют прохождение пищи в кишечнике.)

    SIBO предполагают симптомы, которые сохраняются даже после завершения 6-недельной программы Undoctored Wild, Naked, Unwashed, например:

    • Аномальное вздутие живота и газы, особенно при употреблении продуктов, содержащих пребиотические волокна
    • Диарея (иногда запор)
    • Мальабсорбция — i.е., неспособность усвоить некоторые компоненты диеты, чаще всего жирность, о чем свидетельствуют капли жира или масляная пленка в туалете с кишечником движение, плавающие табуреты
    • Необъяснимые кожные высыпания
    • Чувствительность к кофе — с диареей
    • Другая пищевая чувствительность — например, новая непереносимость молочных продуктов, орехов, кофе, чая и других продуктов
    • Перепады настроения — тревога, депрессия
    • Нарушения сна — особенно бессонница или неспособность наслаждаться длительным сном
    Вы можете оценить, насколько серьезным может быть СИБР с последствиями для здоровья желудочно-кишечного тракта, кожи и даже эмоционального и психического здоровья.Если не исправить, вероятность рака толстой кишки, дивертикулярной болезни, аутоиммунных состояний, диабета 2 типа, сердечных заболеваний, эмоциональных расстройств и других состояний увеличивается. Таким образом, выявление, а затем исправление этого состояния имеет решающее значение для долгосрочного здоровья.

    Водородный дыхательный тест является предпочтительным методом диагностики SIBO. Хотя это несколько обременительно, поскольку оно включает в себя 24-часовую диетическую подготовку с последующим 12-часовым голоданием, прием сахара, такого как лактулоза или глюкоза (метаболизируется кишечной флорой, которая выделяет газообразный водород или метан, но не пищеварением человека) с последующим по нескольким коллекциям дыхательных путей, это наиболее практичный и неинвазивный способ определения SIBO с умеренной уверенностью.Поскольку некоторые формы СИБР, особенно связанные с запорами, также увеличивают выработку газообразного метана, сбор газообразного метана при дыхании также может выполняться отдельно или одновременно с сбором водорода при дыхании.

    Образец ненормального водородно-метанового дыхательного теста можно увидеть здесь: BioHealth-Sample-Report-900-1

    Существует также новый продукт под названием Aire, который представляет собой потребительское тестовое устройство, которое можно использовать повторно, избегая необходимости покупать устройства для тестирования h3 для каждого эпизода тестирования.Наш предварительный опыт показывает, что он прост в использовании и действительно дает положительные результаты, соответствующие формальному h3-тестированию. Он сообщает уровни h3 по шкале от 0 до 10 и полезен для построения кривой распределения по времени, т. Е. Для выполнения теста перед едой с последующим тестированием каждые 15 минут в течение до 3 часов: чем раньше будет получен положительный ответ, тем более вероятно, что объяснением является SIBO. (Поздний ответ через 3 часа и позже может быть вызван нормальными микроорганизмами толстой кишки.) Устройство Aire также полезно для оценки ответа на антибиотики, если его проводить ежедневно после провокации пребиотической клетчаткой, а также для оценки рецидивов после лечения.(Не обращайте внимания на описание пакета приложений этого устройства, поскольку в нем обсуждается только его использование для определения продуктов FODMAP для исключения, подход, который ничего не делает для устранения SIBO, вызывающего непереносимость FODMAP.)

    Также было бы разумно просто приступить к программе лечения, если кластер симптомов не может быть объяснен никаким другим диагнозом и включает дискомфорт в животе, вздутие живота и газы; ненормальный ответ на пребиотические волокна; понос; мальабсорбция жира; и новая пищевая непереносимость и сыпь.Обратной стороной эмпирического подхода, однако, является оценка реакции и выявление рецидива.

    Гастроэнтерологи предпочитают выполнять эндоскопию для извлечения материала из верхней части тощей кишки для выявления чрезмерного количества микроорганизмов в месте, которое должно быть почти стерильным, но это инвазивно и в подавляющем большинстве случаев недооценивает состояние, так как существует много « ложноотрицательные результаты », т. е. образцы, которые не могут выявить степень заболевания, поскольку для обнаружения колонизирующие бактерии должны подняться до двенадцатиперстной кишки или проксимального отдела тощей кишки.Вы можете себе представить, что у кого-то может быть, скажем, колонизация всего лишь 10 футов тонкой кишки, но она еще не достигает верхних отделов пищеварительного тракта, и поэтому не может быть обнаружена этим методом. Таким образом, водородный дыхательный тест остается наиболее рациональным стартовым тестом.

    Водородный дыхательный тест также является самым простым способом оценить реакцию на какое-либо вмешательство. Другими словами, если стартовый водородный дыхательный тест оказывается ненормальным, соблюдается режим приема антибиотиков или диеты, затем дыхательный тест повторяется для оценки ответа и необходимости дополнительной терапии.Это также может быть повторено в долгосрочной перспективе, поскольку повторение — довольно распространенная проблема. Но поскольку каждый тест h3 стоит около 150–300 долларов, вы можете увидеть привлекательность устройства Aire по текущей единой цене в 159 долларов с неограниченными возможностями тестирования.

    Также разумно лечить SIBO эмпирически, т. Е. На основании вашего здравого смысла, без использования теста h3 или эндоскопии. Если, например, непереносимость пребиотических волокон присутствует с пониженным газообразованием, дискомфортом в животе и диареей, которые развиваются в течение 60 минут после приема любого пребиотического волокна, это очень надежный признак наличия SIBO (или его рецидива после лечения).Еще одним надежным признаком является множественная необъяснимая непереносимость пищевых продуктов, особенно продуктов, к которым вы привыкли в прошлом. Наконец, такие состояния, как фибромиалгия, синдром раздраженного кишечника, псориаз, синдром беспокойных ног и аутоиммунные состояния, с большой вероятностью могут быть связаны с SIBO. Однако вам следует четко указать, какие признаки вы используете для предположительной идентификации SIBO, поскольку вам нужно будет наблюдать за рецидивом после курса лечения.



    Существует четыре основных подхода к уничтожению организмов, поднявшихся по желудочно-кишечному тракту:

    Только пробиотики: Эта стратегия не была должным образом изучена, хотя предварительные данные свидетельствуют о том, что некоторые люди реагируют только на добавку пробиотиков.Это говорит о том, что набор пробиотиков, рекомендованный в программе без контроля, может полностью изменить SIBO, по крайней мере, у некоторых людей. Если наш йогурт L. reuteri входит в схему лечения, шансы могут быть сложены в пользу реакции на пробиотики, поскольку эти микроорганизмы обладают уникальной способностью колонизировать верхние отделы желудочно-кишечного тракта и продуцировать бактериоцины, то есть природные антибиотики, эффективные против Bacteriaceae, виды, характеризующие SIBO.

    Однако, если чрезмерное газообразование, вздутие живота, дискомфорт в животе или симптомы депрессии возникают при добавлении пребиотических волокон в программе без контроля, рекомендуется удерживать пребиотические волокна в течение 4 недель, продолжая принимать только пробиотик, а затем повторить попытку ввести пребиотики. опять таки.Если неприятные симптомы повторяются, следует рассмотреть возможность дальнейших попыток, например, водородного дыхательного теста для документирования SIBO.

    Антибиотики, отпускаемые по рецепту: Рифаксимин является предпочтительным средством, поскольку он эффективен против большинства видов микроорганизмов в кишечнике и очень мало всасывается за пределами кишечного тракта. Сам по себе рифаксимин эффективен примерно у половины людей, которые его принимают. Продолжительность лечения широко варьируется от 7 до 30 дней без явного преимущества продолжительной терапии.

    Эффективность можно повысить, комбинируя его с пребиотическим волокном (например, 5 граммов в день), предположительно потому, что пребиотическое волокно стимулирует рост бактерий, делая микроорганизмы более восприимчивыми к антибиотику и препятствуя их споруляции или переходу в фазу гибернизации спор. в котором они не чувствительны к антибиотику. Обратная сторона: стоимость (обычно около 1200 долларов за 4-недельный курс) и 3% -ный риск энтероколита Clostridium difficile, кровавой диареи, которую необходимо лечить с помощью еще одного курса антибиотиков, специфичных для этого организма.Метронидазол и ципрофлоксацин также применялись с ограниченным успехом, хотя формальных клинических испытаний их применения было немного.

    Растительные противомикробные препараты: Одно исследование показало, что смесь растительных противомикробных препаратов в составе FC Cidal + Dysbiocide (Biotics Research Laboratories) или Candibactin-AR + Candibactin-BR (Metagenics) немного превосходит рифаксимин, отпускаемый по рецепту, с эффективностью 46% в растительном рука по сравнению с 34% в руке с рифаксимином. Каждый препарат содержит смесь травяных препаратов, и неясно, все ли компоненты необходимы для эффективности.(Например, берберин, компонент Candibactin-BR, может оказаться эффективным сам по себе. Однако в настоящее время данных недостаточно.) В этом исследовании также использовалась схема, немного отличающаяся от рекомендованной производителем. (Маркировка Candibactin-AR рекомендует принимать одну капсулу три раза в день, в то время как в исследовании использовались две капсулы два раза в день.)

    Лишить кишечную флору всех пребиотических волокон: Этот подход по существу лишает микроорганизмов основных пребиотических волокон.Некоторые называют это диетой FODMAP. Этот подход имеет неопределенную эффективность для SIBO (хотя известно, что он эффективен для IBS с непереносимостью фруктозы и лактозы), но является чрезвычайно ограничительным, выходя за рамки исключения всех зерен и сахаров, чтобы также исключить бобовые, большинство фруктов, многие овощи, молочные продукты, и ликер. Для достижения успеха также требуется длительный период времени, обычно 8 недель или дольше. Это также, вероятно, не полное решение, поскольку разнообразие видов микробов снижается (нежелательный эффект) и не включает никаких усилий по рекультивации здоровых видов бактерий.

    Исключенные продукты включают почти все фрукты, молочные продукты, крахмалистые овощи, чеснок, лук, грибы и яйца. Разрешенные продукты включают мясо, птицу, рыбу, избранные некрахмалистые овощи, такие как салат и стручковая фасоль. Обратите внимание, что ограничение углеводов не заложено в этот диетический подход и будет необходимо для поддержания веса, а не для здоровья из-за чрезмерного потребления углеводов.

    Более подробную информацию о диете можно найти здесь: http: // www.ibsdiets.org/fodmap-diet/fodmap-food-list/

    На сегодняшний день самые высокие показатели успеха связаны с комбинацией стратегий, а именно:

    1) Курс антибиотиков или растительных антибиотиков в сочетании с пребиотической клетчаткой, за которым следует

    2) Пробиотик с высокой активностью (например, 50 миллиардов КОЕ или более в день), содержащий лактобациллы и другие виды, и

    3) Повторные курсы лечения в течение нескольких месяцев

    Другими словами, для полного искоренения SIBO может потребоваться более одного раунда лечения.

    Неопределенность: Успех антибиотиков в искоренении популяций H. pylori в желудке (вызывающих язвы) повышается за счет включения агента, разрушающего биопленку, такого как N-ацетилцистеин, то есть агента, который временно растворяет слизистую оболочку в какие бактерии могут изолировать и быть менее восприимчивыми к антибиотикам. Применимо ли это же преимущество к микроорганизмам SIBO, которые расположены дальше по кишечному тракту, например, в подвздошной кишке? Нет данных, но нет никакого вреда от курса N-ацетилцистеина по 600-1200 мг два раза в день, чтобы сопровождать курс антибиотиков в надежде, что будет достигнут более полный ответ.



    Рецидив SIBO является распространенной проблемой, хотя неясно, можно ли в этом винить пренебрежение причинными факторами (как правило в клинических испытаниях) или ответ был неполным, а рецидив представляет собой повторное заселение устойчивых или стойких микробов. Те же усилия, которые мы предпринимаем для профилактики и лечения дисбактериоза, аналогичны тем, которые мы прилагаем для предотвращения рецидивов SIBO. Это включает:
    • Избегайте зерновых и сахара, минимизируйте употребление алкоголя
    • Фильтрация воды для удаления хлора / хлорамина и фторида
    • По возможности выбирать органические продукты, чтобы свести к минимуму гербициды, пестициды и генетически модифицированные продукты
    • Избегайте эмульгаторов, таких как полисорбат 80 и карагинан
    • Свести к минимуму воздействие антибиотиков, отпускаемых по рецепту
    • Курс высокоэффективных многовидовых пробиотиков после завершения терапевтического курса SIBO
    • Долгосрочное включение пребиотических волокон
    • Попытки нормализовать кислотность желудочного сока, такие как отмена препаратов, блокирующих кислоту желудка, дополнительное введение бетаина гидрохлорида при выявлении гипо- или ахлоргидрии
    • Добавки для компенсации недостаточности ферментов поджелудочной железы или желчной кислоты, если диагностирована
    • Включая ферментированные продукты, e.г., в вашем рационе ферментированные овощи, йогурт, кефир и др.

    Может быть полезно наблюдать за SIBO и дисбактериозом, как если бы вы рассматривали сорняки в своем саду — простая прополка вашего сада один раз не помешает новым сорнякам пустить корни через несколько дней. Эпиднадзор и профилактические меры по сдерживанию СИБР и дисбактериоза и поддержанию здорового профиля флоры кишечника — это постоянные усилия, требующие вашего постоянного внимания.


    Есть новое умное и элегантное устройство для тестирования здоровья потребителей под названием AIRE, произведенное компанией FoodMarble.Устройство (на фото выше) измеряет газообразный водород, h3, в выдыхаемом воздухе, так же, как формальное тестирование h3, используемое для диагностики избыточного бактериального роста в тонкой кишке, SIBO.

    Формальная проверка дыхания h3 — хлопот. За день до подготовки вы выпиваете раствор сахара (лактулозы или глюкозы), затем каждые 30 минут собираете образцы дыхания в течение 3 часов, а затем отправляете посылку в лабораторию. При получении напрямую без врача каждый одноразовый тестовый набор (только на глюкозу) стоит 149 долларов. При получении через врача обычно добавляются дополнительные расходы, особенно если тестирование проводится в лаборатории или офисе.Каждый тестовый набор полезен только для одного раунда тестов. Если вы хотите убедиться, например, что SIBO был ликвидирован после курса антибиотиков, вам необходимо приобрести еще один тестовый набор и снова пройти процесс. То же самое верно и при оценке слишком распространенных рецидивов: еще один тестовый набор за 149 долларов, еще один раунд тестирования.

    Таким образом, устройство AIRE меняет правила игры, поскольку его можно использовать снова и снова. При цене 159 долларов за устройство он может сэкономить много денег с течением времени, а также значительно сократить хлопоты.Он исключительно прост в использовании: включите устройство, нажав кнопку, откройте приложение на своем смартфоне. Для прогрева устройства требуется около двух минут, затем он сообщает вам подуть в устройство в течение примерно 5 секунд и дает показания 0-10 ч3 в течение нескольких секунд.

    Настоящая полезность этого устройства, однако, заключается в создании графика выпуска h3. Другими словами, проведите тест перед едой, потребляйте пищу, содержащую пребиотическую клетчатку, затем снова проверяйте каждые 30 минут в течение 3 часов; прекратить, если получен положительный результат.Другими словами, вы пытаетесь оценить, превращаются ли пребиотические волокна в газ h3 бактериями в желудке, двенадцатиперстной кишке, тощей кишке или подвздошной кишке. Если вы дали положительный результат в течение первых 90 минут, у вас СИБР. Положительный ответ между 90–180 минутами неоднозначен, поскольку трудно отличить мягкий СИБР от брожения в толстой кишке, особенно у людей с быстрым «временем прохождения», то есть быстрым прохождением переваренной пищи в толстую кишку.

    Устройство AIRE также полезно для оценки реакции на курс лечения.Например, курс антибиотиков можно начать с постоянных уровней h3 8-10, а затем снизить до 1-2 на 6 или 7 день; это говорит о положительной реакции на выбранный режим. После успешного лечения SIBO устройство AIRE можно использовать в будущем для оценки рецидива.

    Обратите внимание, что устройство лучше всего использовать в день после ночного голодания продолжительностью не менее 8 часов, чтобы максимизировать вероятность начать с низкого уровня h3 перед потреблением пребиотической клетчатки.

    Чтобы использовать устройство AIRE для проверки дыхания h3, выполните следующие действия:

    Предыдущий день

    В течение 24 часов до проверки дыхания h3 употребляйте только те продукты, которые не содержат пребиотических волокон.Поэтому вам следует избегать бобовых, хумуса, инулина, клетчатки акации, фруктов, крахмалистых или корнеплодов, лука, чеснока, сахара или фруктозы, молочных продуктов. Также избегайте употребления алкоголя.

    Ограничьте свой рацион продуктами, богатыми жирами и белками, такими как яйца, масло, говядина, птица, рыба, листовая зелень, орехи, масла, семена и некрахмалистые овощи (например, шпинат, капуста, салат, зеленый перец , огурцы, стручковая фасоль, кабачки).

    День тестирования h3

    1. Включите устройство AIRE
    2. Активируйте приложение AIRE / FoodMarble на своем смартфоне, затем следуйте инструкциям в приложении
    3. Подуйте в устройство по запросу приложения — это ваше базовое значение h3
    4. Употребляйте пищу с пребиотической клетчаткой, например.г., 2 чайные ложки инулина в кофе или йогурте, 1/4 стакана бобовых и т. д. Вы также можете есть другие продукты по вашему выбору, например, яйца, бекон, колбасу и т. д.
    5. Пробное дыхание h3 каждые 30 минут в течение до 3 часов.
    Что означают показания

    Каждая единица измерения на устройстве AIRE, от 0 до 10, соответствует увеличению концентрации газообразного водорода на 5 частей на миллион (ppm) при формальном тестировании дыханием h3. Следовательно, значение 4 равно 20 ppm h3, значение 8 — 40 ppm, а 10 — 50 ppm и выше.

    Значение:

    • 4-6 наводит на мысль о SIBO
    • Повышение на 4 единицы выше исходного уровня также свидетельствует о SIBO, например, увеличение на 2 до 6.
    • Любое значение выше 6 уверенно указывает на наличие SIBO. Чем выше значение, тем больше уверенность в наличии SIBO.
    Каким бы элегантным ни было устройство, у него есть несколько недостатков:
    1. Информация, предоставленная с устройством, описывает эту технологию как полезную только для выявления непереносимости продуктов FODMAP.Другими словами, если вы съедите яблоко и через 30 минут у вас будет h3-положительный результат, FoodMarble рекомендует прекратить есть яблоки. Вы можете видеть безрассудство в этом и во всех разговорах о FODMAP: он не устраняет причину, то есть SIBO или тяжелый дисбактериоз. Вот почему мы советуем людям, что диета с низким содержанием FODMAPS — это не более чем маневр по уменьшению симптомов, но не устраняет основную причину, не восстанавливает здоровый микробиом или не устраняет мощный источник воспаления (СИБР). Следуйте инструкциям по использованию устройства, но игнорируйте советы, как избегать использования FODMAP.
    2. Это устройство предназначено для личного использования одним человеком. Мундштук не одноразовый, его можно протирать влажной тканью или бумажным полотенцем. Компания настоятельно рекомендует не употреблять алкоголь, поскольку он может повредить силиконовый мундштук. Вы, конечно, можете поделиться устройством с близким человеком, но делиться этим, скажем, с коллегами или соседями — плохая идея. Фактически, одно устройство для каждого человека или семьи, которые хотят участвовать в тестировании.
    3. Мы спросили компанию, поделятся ли они своими данными, соотнося свою шкалу 0-10 h3 с формальным тестом h3 в частях на миллион h3.Как я и ожидал, они сказали «нет», заявив, что это проприетарно. (Это происходит практически каждый раз, когда мы просим компанию предоставить данные о проверке или воспроизводимости, поскольку это может быть частью их усилий по защите своей интеллектуальной собственности.) Таким образом, у нас остается небольшая неуверенность в том, что именно представляет собой шкала от 0 до 10. . Однако на практическом уровне это устройство дало достоверные и значимые результаты.

    ОБНОВЛЕНИЕ: Согласно интервью доктора Дэвиса с изобретателем устройства Aire докторомAonghus Shortt, были обнаружены следующие показания устройства: 2 = 10 PPM h3 газа, 8 = 40 PPM h3 газа (это также было отмечено в инструкциях по применению выше)

    Тем не менее, устройство является важным шагом вперед в управлении SIBO, точно так же, как определение уровня сахара в крови пальцем значительно расширило возможности людей в управлении, а теперь и обращении вспять диабета 2 типа. Это особенно полезно для тех из нас, кто самостоятельно управляет SIBO в мире, в котором врачи не справляются с проблемами здоровья, если они не приносят большой доход.


    Сводка

    Как только SIBO идентифицирован и / или подтвержден, например, высокими показаниями h3 на устройстве AIRE, у нас есть возможность искоренить чрезмерный рост нездоровых видов бактерий, которые поднялись по длине желудочно-кишечного тракта.

    Для достижения идеальных результатов мы в настоящее время объединяем по крайней мере некоторые усилия по искоренению грибков одновременно с усилиями SIBO, поскольку чрезмерный рост грибков сопровождает SIBO по крайней мере в 60% случаев и потому, что уничтожение популяций бактерий часто вызывает чрезмерный рост грибков.

    Растительные антибиотики

    Мы выбираем либо Candibactin AR + Candibactin BR, либо FC Cidal + Dysbiocide, две схемы лечения растительными антибиотиками с доказанной эффективностью. Мы принимаем либо схему в течение 14 дней, либо до тех пор, пока провокация пребиотической клетчаткой не даст низкие значения (<4) по показаниям устройства AIRE.

    Кандибактин АР: 1-2 капсулы два раза в день. Кандибактин BR: 2 капсулы два раза в день.

    Дисбиоцид: 2 капсулы два раза в день. FC Cidal: по 1 капсуле два раза в день.

    Поскольку схема приема кандибактина включает два противогрибковых средства (масло душицы и берберин), нет необходимости добавлять еще одно противогрибковое средство в начале.

    Если вы выбрали режим Дисбиоцид / ФК Сидал, рассмотрите возможность добавления куркумина 600–1000 мг в день (разделенных на 2 или 3 приема) из-за его противогрибковых свойств.

    Если вы планируете следовать противогрибковому режиму после завершения усилий по искоренению SIBO, рассмотрите такие агенты, как куркумин 600-1000 мг в день (разделенный на 2 или 3 приема) + несколько капель одной или двух пищевых продуктов. эфирные масла (орегано, корица, гвоздика, мята), разведенные в столовой ложке оливкового, авокадо или кокосового масла два раза в день (начиная с 2 капель на столовую ложку, постепенно увеличивая до 6 капель на столовую ложку) в течение минимум 4 недель или до появления признаков грибковых разрастаний отступили.

    Нарушение биопленки

    Добавление агента, разрушающего биопленку, созданную бактериями, что делает их менее восприимчивыми к антибиотикам, может повысить эффективность.

    N-ацетилцистеин 600-1200 мг два раза в день с антибиотиком

    (Усилия по разрушению биопленки не требуются во время противогрибковых мероприятий, поскольку эфирные масла разрушают биопленку.)

    Предотвратить споруляцию

    Некоторые бактерии могут переходить в режим спорообразования и тем самым становиться невосприимчивыми к антибиотикам.После нескольких дней приема антибиотиков (см. Выше) вы, вероятно, сможете снова добавить пребиотические волокна, к которым у вас раньше была непереносимость.

    Увеличьте потребление пребиотической клетчатки по мере переносимости до нашего долгосрочного целевого потребления 20 или более граммов в день из таких источников, как бобовые, чеснок, спаржа, лук-порей, зелень одуванчика, хикама, сырой белый картофель, зеленый незрелый банан, инулин в порошке, пектин, клетчатка акации.

    Йогурт L. reuteri

    В то время как Л.йогурт reuteri, вероятно, обеспечивает преимущества в искоренении или предотвращении рецидивов SIBO, он также генерирует положительные показания h3 устройством AIRE, что делает невозможным отличить SIBO от поколения h3, вызванного L. reuteri. Если вы планируете использовать устройство AIRE для отслеживания показателей h3 во время или сразу после курса лечения травяными антибиотиками, вам следует прекратить употребление йогурта L. reuteri как минимум на 2 недели до получения отрицательных значений h3, а затем возобновить. Колонизирующая способность L.reuteri, где он поселяется и производит бактериоцины, эффективные против видов SIBO, вероятно, обеспечивает дополнительное преимущество в предотвращении повторного SIBO.

    Меры по предотвращению повторения СИБР

    После завершения курса лечения растительными антибиотиками мы также прекращаем прием N-ацетилцистеина, но продолжаем прием пребиотических волокон. Мы добавляем высокоэффективный многовидовой пробиотик; ферментированные продукты, такие как чайный гриб, квашеная капуста, кефир и ферментированные овощи; добавить L.йогурт реутери. Если устройство AIRE доступно, отслеживайте / оценивайте потенциальные рецидивы с помощью показаний h3 после провокации пребиотической клетчаткой. Обратите внимание, что йогурт с L. reuteri необходимо прекратить за 2 недели до любых показаний AIRE.



    Водородный дыхательный тест: Ваш лечащий врач сообщает ваш почтовый адрес, и вам на дом отправляется тестовый набор, или ваш поставщик медицинских услуг предоставляет вам тестовый набор. Вам выставят счет за тест, который вы можете, при желании, передать своей медицинской страховой компании.

    Вы можете попросить своего лечащего врача получить тестовый набор:

    Genova Диагностика
    https://www.gdx.net/

    Лаборатория биологического здоровья
    https://www.biohealthlab.com/

    Устройство Aire: https://foodmarble.com Просто имейте в виду, что эта компания, похоже, не понимает, что делает их устройство, поскольку они обсуждают использование устройства только для соблюдения диеты с низким содержанием FODMAP.

    Кандибактин: Хотя Кандибактин можно получить через первоисточник Metagenics (www.metagenics.com), он продается только практикующим врачам. Вы также можете получить без поставщика медицинских услуг через розничных продавцов, таких как Amazon и другие. (Ищите Candibactin-AR и Candibactin-BR), хотя цена иногда выше.

    FC Cidal + Дисбиоцид:
    Как и в случае с Metagenics, Biotics Research (www.bioticsresearch.com) предоставляет свои продукты только для здравоохранения. практикующие. Найдите в Интернете розничных продавцов, таких как Amazon, которые предоставляют эти продукты напрямую.

    Каталожные номера:

    Роль пробиотиков в лечении СИБР Чен В.К., Куигли Е.М. Пробиотики, пребиотики и синбиотики в тонком кишечнике избыточный бактериальный рост: открытие новых терапевтических горизонтов! Индийский журнал J Med Res 2014, ноябрь; 140 (5): 582-4.

    СИБР и другие заболевания

    Пиментел М., Уоллес Д., Халлегуа Д. и другие. Связь между синдромом раздраженного кишечника и фибромиалгией может быть связана к результатам анализа дыхания на лактулозу.Ann Rheum Dis. 2004. 63 (4): 450–2.

    Джейкобс С., Косс Адаме Э, Атталури А и другие. Нарушение моторики и использование ингибиторов протонной помпы являются независимыми факторами риска. при чрезмерном росте бактерий и / или грибков в тонком кишечнике. Алимент Фармакол Ther. 2013. 37 (11): 1103–11.

    Parodi A, Paolino S, Greco A и др. al. Избыточный бактериальный рост тонкого кишечника при розацеа: клиническая эффективность его искоренение. Clin Gastroenterol Hepatol 2008; 6 (7): 759–64.

    Weinstock LB, Fern SE, Duntley SP.Синдром беспокойных ног у пациентов с синдромом раздраженного кишечника: ответ на терапия избыточного бактериального роста в тонком кишечнике. Dig Dis Sci 2008; 53 (5): 1252–6.

    Антибиотик, за которым следует пробиотик, может повысить успешную эрадикацию SIBO

    Cuoco L, Salvagnini M. Small избыточный бактериальный рост в кишечнике при синдроме раздраженного кишечника: ретроспектива исследование с рифаксимином. Минерва Гастроэнтерол Диетол 2006; 52: 89–95.

    Khalighi AR, Khalighi MR, Behdani R et al.Оценка эффективности пробиотика на лечение пациентов с избыточным бактериальным ростом тонкой кишки (СИБР) — a обучение пилота. Индийский журнал J Med Res 2014, ноябрь; 140 (5): 604-8.

    Rosania R, Giorgio F, Principi M et al. Эффект добавление пробиотиков или пребиотиков при антибактериальной терапии в небольших количествах избыточный бактериальный рост в кишечнике: сравнительная оценка. Curr Clin Pharmacol 2013; 8: 169–72.

    Совместное применение антибиотика с пребиотиком может повысить эффективность.

    Фурнари М., Пароди А., Геминьяни Л. и соавт.Клинический испытание: комбинация рифаксимина с частично гидролизованной гуаровой камедью более эффективна. эффективен, чем один рифаксимин в уничтожении бактерий тонкой кишки. разрастание. Алимент Pharmacol Ther. 2010. 32: 1000–6.
    Растительные противомикробные препараты

    Дисбиоцид и FC Cidal (лаборатории биотических исследований) или Candibactin-AR и Кандибактин-BR (Metagenics) может быть эквивалентным или незначительно превосходящим рифаксимин

    Chedid V, Dhalla S, Clarke JO et al.Травотерапия эквивалентна рифаксимину для лечения небольших чрезмерный бактериальный рост в кишечнике. Glob Adv Health Med 2014 Май; 3 (3): 16-24.

    Искоренение СИБО май коррелируют с улучшением симптомов

    Пиментел М., Чоу Э.Дж., Лин Х.С. Нормализация дыхательного теста на лактулозу коррелирует с улучшением симптомов при синдроме раздраженного кишечника. двойной слепой, рандомизированный, плацебо-контролируемый учиться. Am J Gastroenterol 2003; 98 (2): 412–9


    Перейти к обсуждению на форуме.

    Выписка:

    Это не контролируемый протокол для избыточного бактериального роста тонкой кишки, формы дисбиоза, при которой микроорганизмы нарушенной кишечной флоры поднимаются вверх через 20 сантиметров тонкой кишки, вплоть до двенадцатиперстной кишки и даже в желудок. и колонизация частей желудочно-кишечного тракта, которые не должны быть колонизированы.

    Это очень большая проблема. Становится ясно, что это гораздо более распространенное явление, чем мы когда-либо думали, и оно может быть причиной многих заболеваний.Он также может учитывать ваш частичный ответ на базовую программу без контроля. Например, если у вас ревматоидный артрит или фибромиалгия, и вы выполняете программу Undoctored Wild-Naked-Unwashed , и у вас есть улучшение только на 70-80%, но у вас все еще остаются некоторые обострения и проблемы. Подумайте, серьезно подумайте о чрезмерном бактериальном росте в тонкой кишке.

    Есть отдельное видео по распознаванию контрольных признаков, которые могут вызвать подозрение, что они у вас есть.Я призываю вас посмотреть это видео. Вкратце, это:

    • … ищите непереносимость жиров: то есть, если у вас жир в туалете или ваш стул плавает, это может быть связано с избыточным бактериальным ростом в тонком кишечнике, вызывающим мальабсорбцию жира.
    • Если у вас появилась новая пищевая непереносимость — неожиданно вы показались непереносимыми к арахису или другим орехам, и вы не знаете почему, подумайте об этом процессе.
    • Если у вас чрезмерно газообразная или неприятная реакция на пребиотические волокна, особенно если она возникает быстро, скажем, в течение первых получасов после их приема, подумайте о чрезмерном бактериальном росте в тонком кишечнике.
    • Если в вашей жизни вы принимали много антибиотиков, подумайте об этом.

    Подумайте о чрезмерном бактериальном росте в тонком кишечнике всякий раз, когда у вас возникнет какая-либо из этих ситуаций, и выполните некоторые из шагов, которые мы обсуждаем в протоколе без контроля. Как всегда, этот протокол без контроля над всеми шагами, которые вы начинаете в программе Undoctored Wild-Naked-Unwashed , потому что эти базовые шаги играют большую роль. Вы просто не можете выполнить этот протокол, не выполнив базовую программу.Сначала вы должны выполнить базовую программу.

    Это помогает оценить избыточный бактериальный рост в тонком кишечнике, провести его собственное обследование. Есть только несколько способов сделать это.

    Водородный дыхательный тест

    ПРИМЕЧАНИЕ. Следующее мнение было высказано до выпуска устройства Aire (см. Выше), которое в большинстве случаев заменяет водородный дыхательный тест.

    Я думаю, что лучший способ — это так называемый водородный дыхательный тест. Это не очень дорого; это около 150 долларов. Иногда за это может заплатить страховка.Вы должны получить это через врача, поэтому вам нужно найти практикующего врача, который открыт для этого разговора. Большинство гастроэнтерологов не поймут, о чем вы говорите, потому что их больше интересует ваше исследование, а не постановка диагноза. Возможно, вам придется пойти к практикующему терапевту функциональной медицины, интегративному практикующему врачу или мануальному терапевту, натуропату — кому-то, кто действительно интересуется здоровьем. Они могут пройти водородный дыхательный тест.

    Это немного громоздко.Он включает период голодания и изменение диеты перед тем, как это сделать. Вкратце, это просто означает выпить раствор сахара, такого как лактулоза или глюкоза, а затем взять образцы дыхания в течение примерно трех часов и посмотреть, какова кривая выделения водорода или метана в дыхании. Это потому, что микроорганизмы производят водород или метан, которые захватываются дыханием, и это показывает, есть ли у вас организмы, которые выделяют его быстро, то есть колонизацию тонкой кишки бактериями.

    Эндоскопия аспирата двенадцатиперстной кишки или верхнего отдела тощей кишки

    Гастроэнтерологи любят делать эндоскопии (фактически это почти все, что они делают), но они могут поставить диагноз, взяв образец, аспират жидкого материала или частично переваренного пищевого материала в двенадцатиперстной кишке или проксимальном отделе тощей кишки, верхней части тонкой кишки — это инвазивно. Им это нравится, потому что они могут брать за это большие деньги.

    Проблема в том, что (1) он инвазивен и (2) он обычно дает ложноотрицательные результаты, то есть обычно не обнаруживает микроорганизмов или их слишком мало, даже если у вас наблюдается избыточный бактериальный рост в тонком кишечнике.Это могло произойти из-за того, что они делают это как образец, или из-за того, что организмы не поднялись полностью туда, где может дотянуться прицел. Прицел действительно не может дотянуться очень далеко, верно. Если длина тонкой кишки составляет 24 фута, а прицел может достигать только первого дюйма, двух, трех или чего-то в этом роде — вы видите проблему в том, что большое количество избыточных бактерий в тонкой кишке недоступно для эндоскопа. Но, если вам нужна эндоскопия по другой причине, это будет хорошей возможностью хотя бы получить образец и посмотреть, окажется ли он положительным.Если он положительный, вы знаете, что он у вас есть. Если он отрицательный, он может быть у вас.

    Эмпирическая терапия

    Наконец, некоторые люди предпочитают проводить курс терапии эмпирически, то есть просто наугад — они думают, что они у них есть. Я думаю, что это разумно, если у вас есть достаточно веские доказательства, например, мальабсорбции. Если у вас в туалете есть жир или масло, велика вероятность чрезмерного бактериального роста в тонком кишечнике. Если у вас необъяснимая кожная сыпь и такая специфическая реакция на пребиотические волокна, это довольно веские признаки того, что у вас избыточный бактериальный рост в тонком кишечнике, и вы можете приступить к его лечению или лечению.

    Обратной стороной? Что делать, если у вас есть только частичный ответ после лечения, или, что если у вас рецидивы некоторых симптомов, но не всех? У вас не будет теста, на который можно было бы положиться, чтобы узнать, есть ли оно у вас, есть ли рецидивы, избавились ли вы от него. Таким образом, у эмпирической терапии есть обратная сторона, но это один из ваших вариантов, особенно если вы или ваш лечащий врач считаете, что симптомы или признаки, присутствующие вначале, убедительно указывают на избыточный бактериальный рост в тонком кишечнике.

    Лечение

    Варианты лечения тоже неплохие. Их всего несколько.

    Рифаксимин

    Есть рецептурные антибиотики. Самый популярный — рифаксимин. Обратная сторона: очень дорого; около 1200 долларов за таблетки на месяц. Он также несет риск (около 3%) энтероколита clostridium difficile . Это происходит только у 3% людей, но это очень серьезное осложнение этого и других антибиотиков. Так что это обратная сторона. И он работает только в 50% случаев — немного лучше, если вы комбинируете его с пребиотическими волокнами.Это обсуждается в протоколе Undoctored ниже [под видео на странице протокола; выше стенограммы] .

    Растительные антибиотики — например, Кандибактин-AR® / -BR®

    Я считаю, что есть некоторые свидетельства того, что лучшим решением являются растительные антибиотики или противомикробные препараты, и они обсуждаются ниже [под видео] , такие как Candibactin AR и BR. По неофициальным данным, они работают. В одном исследовании сравнивали растительные противомикробные препараты / антибиотики с рифаксимином, и травяные препараты были несколько лучше и не имели риска для clostridium difficile .Так что я думаю, что это должно быть вашим первым выбором, если вы хотите пойти путем антибиотиков.

    Неясно, как долго вы этим занимаетесь, но я думаю, что две недели — это, вероятно, довольно хороший срок. Были опробованы более длительные периоды действия антибиотика рифаксимина, и, похоже, он не принес никакой дополнительной пользы. Более короткие курсы дают меньший эффект, например, семь дней, поэтому я думаю, что хороший компромисс — 14 дней, может быть, всего 10 дней.

    Удалите пребиотические волокна, например FODMAP диета

    Наконец, соблюдайте диету, в которой вы исключаете все пребиотические волокна.Фактически, вы голодаете свои кишечные организмы, и они со временем умирают, хотя некоторые из них образуют споры. Это обратная сторона. Они переходят в покоящуюся споровую форму. Это может быть причиной того, что это не всегда работает.

    Есть что-то, что называется диетой FODMAP. Это очень ограничительная диета. В этом и проблема — крайне ограничительные: никаких яиц, очень мало овощей, очень мало фруктов, никаких бобовых, никакого алкоголя. Таким образом, вы найдете более подробную информацию в обсуждении ниже [под видео] и по предоставленным ссылкам.

    Не совсем понятно, сколько времени у вас есть на это. Он может начать приносить пользу всего через несколько недель, но иногда для этого требуются месяцы или годы, и это рискованно, потому что, если вы навсегда лишите флору кишечника пребиотических волокон, вы подвергнетесь риску рака толстой кишки, дивертикулярной болезни и воспалительных заболеваний. Так что будь осторожен. Данные о FODMAP лучше подходят для лечения симптомов синдрома раздраженного кишечника, особенно связанных с непереносимостью фруктозы. Нет большого количества данных о чрезмерном бактериальном росте в тонком кишечнике, но у некоторых людей это работает, и это один из ваших вариантов.

    Обычно необходимы повторные курсы лечения

    Имейте в виду, что редко проводится один курс лечения, будь то диета с FODMAP или антибиотики, такие как рифаксимин, или растительные антибиотики, такие как кандибактин. В редких случаях эффективен только однократный курс лечения. Обычно людям приходится проходить многократные циклы лечения. Обычный способ сделать это — принимать Candibactin-AR® и -BR®, скажем, в течение двух недель. Потом уйти на две недели. Сделайте это снова в течение двух недель. Уйти на две недели; или что-то подобное.Никто не составлял для этого идеального расписания. Возможно, вам придется проделать это 3, 4, 5 или более раз. Вы можете увидеть, где в данном случае лучше провести водородный дыхательный тест, или, по крайней мере, наблюдать за повторением некоторых признаков и симптомов избыточного бактериального роста в тонком кишечнике.

    И, наконец, вы хотите предотвратить повторение. Делайте все возможное, чтобы предотвратить рецидивы и поощрять положительный ответ на любую терапию, которую вы выберете. Так что они также перечислены под [под видео] , и они будут знакомы всем, кто участвует в базовой программе без контроля.Это включает в себя такие вещи, как избегание антибиотиков, когда это возможно, употребление органических продуктов, чтобы избежать гербицидов, пестицидов и ГМО, фильтрация вашей воды, отказ от эмульгирующих агентов, таких как полисорбат 80 и некоторых десен и других эмульгирующих агентов, потому что они также эмульгируют вашу слизистую оболочку кишечника, и это нарушает флору кишечника. Есть еще несколько шагов, которые вы можете предпринять, чтобы предотвратить повторение.

    Избыточный бактериальный рост в тонкой кишке — это то, что нельзя просто лечить один раз, уйти и покончить с этим.Это то, над чем вы должны работать, постоянно сокращая время, пока вы не повернете вспять этот процесс, на становление которого ушли многие годы. Но продолжайте это делать, потому что это очень хорошее дело, чтобы избавиться от чрезмерного бактериального роста в тонком кишечнике, потому что, если вы этого не сделаете, со здоровьем впереди плохие вещи.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *