Прогерия это: Найдена самая пожилая женщина с синдромом преждевременного старения: Люди: Из жизни: Lenta.ru

Содержание

Найдена самая пожилая женщина с синдромом преждевременного старения: Люди: Из жизни: Lenta.ru

Жительница США оказалась одной из самых пожилых среди преждевременно постаревших в результате редчайшего заболевания прогерия (синдром Хатчинсона-Гилфорда). Об этом сообщает издание Daily Mail.

Тиффани Ведекинд (Tiffany Wedekind) из города Колумбус, штат Огайо, диагностировали прогерию (генетическое заболевание, при котором происходит преждевременное старение — прим. «Ленты.ру») только во взрослом возрасте. Как правило, медики ставят такой диагноз ребенку в первые два года после его рождения, при этом средняя продолжительность жизни пациента — 12 лет.

Врачи посчитали случай Тиффани уникальным, поскольку она дожила до 41 года. Женщина весит всего 26 килограммов при росте 135 сантиметров и страдает от выпадения зубов, потери волос и проблем с сердцем. Однако, несмотря на состояние здоровья, американка занимается йогой и управляет клининговой компанией.

Материалы по теме:

В 2012 году от болезни умер ее 39-летний брат Чад (Chad). Тогда родители женщины обеспокоилось, что их дочь также настигнет ранняя смерть. «Я знала, что отличаюсь от остальных, но меня это не тревожило. Мне нравилась моя индивидуальность, — рассказывает американка. — Но когда скончался мой брат, я вдруг осознала, что так может завершиться и моя жизнь».

По словам Тиффани, родители решили разобраться в причинах недуга их детей, когда состояние здоровья Чада стало критическим. Тогда члены семьи прошли обследование и узнали, что Тиффани и ее мать Линда (Linda Wedekind) страдают прогерией. Медики удивились, что у Линды за всю ее жизнь не проявились симптомы болезни.

Доктора заключили, что мать Тиффани также можно признать одной из самых пожилых носителей синдрома Хатчинсона-Гилфорда. По данным издания, в мире официально зафиксировано лишь 156 случаев заболевания преждевременным старением.

Что происходит в России и в мире? Объясняем на нашем YouTube-канале. Подпишись!

Ключ от старости. Детская прогерия и луч надежды / Хабр

16+

Еще в самом первом моем посте на Хабре я вскользь затронул один маркер цивилизации XX века, а конкретнее – его медицины, который на самом деле поражает меня сильнее космонавтики и даже сильнее Интернета.

Я упоминал о серповидноклеточной анемии. Это генетическое заболевание, приводящее к деформации эритроцитов, мешает развитию малярии, поэтому в Африке повышало шансы индивида на выживание – как меньшее зло.

XX век – его конец и начало XXI века – отметились стратегической победой над инфекционными болезнями и переходом к борьбе против генетических, к которым по ряду показателей примыкает рак. Хина и карболка Миклухо-Маклая уступили место чудесам фармакологического искусства, названия которых оканчиваются на –маб и –вир.

Генетические заболевания принципиально отличаются от инфекционных как по принципу передачи (вертикально, а не горизонтально), так и гораздо меньшей распространенностью в глобальной популяции с резкими всплесками локально – как в случае с болезнью Хантингтона на озере Маракайбо (глава 12).   

Тем не менее, организованная борьба с генетическими заболеваниями уже началась. Поскольку она требует не просто «знать врага в лицо», но и «разбирать врага до косточек», эта борьба дает богатый урожай знаний о природе человека, его фичах и багах. И даже на фоне генетических заболеваний особняком стоит «баг» невообразимо чудовищный, редчайший и при этом крайне информативный. Это синдром Вернера, а также синдром Гетчинсона-Гилфорда, более известные как «взрослая» и «детская» прогерия соответственно.    

Прогерия — это генетический дефект, приводящий к стремительному физическому одряхлению. Впервые прогерия была выявлена в 1886 году Джонатаном Гетчинсоном, который описал истончение кожных покровов и исчезновение подкожной клетчатки у шестилетнего мальчика. С тех пор в мире зафиксировано более 300 случаев прогерии.

Из-за крайней редкости прогерии (примерно 1 случай на 8 миллионов детей) и ее глубокой генетической подоплеки до сих пор невозможно уверенно судить о механизмах ее наследования. Взрослая прогерия (синдром Вернера) связана с дефектом гена WRN, детская прогерия – с дефектом гена LMNA. Оба этих гена в исправном состоянии отвечают за репарацию клеток и гомеостаз стволовых клеток.

Хотя прогерия и является врожденной, признаки ее проявляются примерно на 2-3 году жизни. Болезнь начинается с характерных пигментных пятен или сыпи на теле. Затем у ребенка истончается кожа, через нее начинают просвечивать вены. Ребенок перестает набирать вес, у него происходят все более быстрые старческие изменения, в первую очередь затрагивающие кожные покровы: выпадают волосы, кожа сморщивается и обвисает. Также наступают прочие старческие изменения, связанные с одряхлением: атеросклероз, нарушение функции почек, артрит.

При этом прогерия нисколько не усугубляет интеллектуального развития ребенка; напротив, дети с прогерией быстро и хорошо учатся, а также зрело осознают не только свое состояние, но и восприятие этой болезни со стороны окружающих и близких.

Люди и лица

Возможно, прогерия наследуется по аутосомно-рецессивному типу по мужской линии. Среди изученных случаев детской прогерии отмечается сравнительно немолодой возраст отцов: около 37 лет. Все известные случаи детской прогерии относятся к представителям белой расы, кроме черной Онталаметсе Фалатсе из Йоханнесбурга, которая умерла в 2017 году в возрасте 18 лет.

Онталаметсе Фалатсе

 Абсолютное большинство детей с прогерией не доживают до совершеннолетия. Известны единичные случаи преодоления двадцатилетнего возраста. В таком возрасте некоторые больные уже даже успевают реализоваться и жить полной жизнью, насколько это возможно. Так, одним из самых возрастных людей с прогерией был Леон Бота (1985 — 2011) из Кейптауна. Он стал диджеем и прославился под псевдонимом DJ Solarize; также Леон Бота был талантливым живописцем:

Леон Бота

В 2010 году Леон Бота пережил инсульт и прожил еще около года, умерев на следующий день после своего 26-летия.

Среди известных больных с прогерией рекорд долгожительства принадлежит Тиффани Ведекинд (род. 1978) из города Колумбус, штат Огайо, которая дожила до настоящего времени (сейчас ей 43):

Тиффани Ведекинд

Прогерией также болел ее старший брат Чед, умерший в 2012 году в возрасте 39 лет вскоре после того, как ему был диагностирован стеноз (сужение) аорты. При этом, и у Чеда, и у Тиффани болезнь проявилась сравнительно поздно; так, у Тиффани старческие изменения начались примерно в 12 лет, когда большинство детей с прогерией уже являются глубокими стариками:

Генетическая основа прогерии

Из-за экстремально редкой встречаемости и неясной этиологии прогерия еще в XX веке абсолютно не поддавалась лечению, даже паллиативному. Но после того, как были локализованы гены, отвечающие за развитие прогерии, появилась не только возможность бороться с ней – но и понимание, что именно эти гены отвечают за физическое старение человека. Более того, прогерия демонстрирует, что физическое старение человека не имеет жесткой привязки к умственной и социальной деградации личности. Соответственно, скорректировав работу гена LMNA, можно как отсрочить или отменить старость, так и наладить «стабильное производство» стволовых клеток в организме.

Ген LMNA кодирует белок ламин А. Данный белок отвечает за образование ламины – оболочки, выстилающей внутреннюю поверхность клеточного ядра. При единичной мутации всего в одном кодоне, то есть, при замене ГГЦ (гуанин-гуанин-цитозин) на ГГТ (гуанин-гуанин-тимин), образуется дефектная версия ламина А, белок, называемый прогерином. Прогерин, в отличие от ламина, не встраивается в подложку ядра, и ядро теряет целостность. В результате возникает целая совокупность патологических изменений:

  1. Нарушается репликация ДНК, поэтому клетки начинают стареть гораздо быстрее, чем положено (это явление называется «сенильность»)

  2. ДНК выскальзывает за пределы ядра и за пределы клетки, из-за чего может запускаться аутоиммунная реакция

  3. Нарушается стабильность генома, поэтому хаотически накапливаются другие мутации, которые с физиологической точки зрения напоминают старческие

  4. В поврежденном ядре укорачиваются теломеры, что дополнительно ускоряет старение клетки   

Прогерин, то есть, дефектный ламин А, с возрастом образуется и в обычных соматических клетках. Именно поэтому нарушается их репликация, теряется функция и сбиваются механизмы деления, что приводит к раку.

У детей с прогерией такие изменения особенно выражены в фибробластах (клетках кожи) и в клетках кровеносных сосудов. Именно поэтому основной причиной смерти при детской прогерии являются инфаркты и инсульты.

Если считать старение болезнью или совокупностью накапливающихся патологий, то основная сложность изучения такой болезни – в том, что она неравномерно и очень долго развивается. Именно детская прогерия показывает своеобразную «быструю перемотку» человеческого увядания, а на основе детской прогерии удалось получить и еще более стремительную модель этой болезни – мышиную. У мышей изучались в основном фибробласты (клетки кожи), клетки гладкой мышечной ткани, поджелудочной железы и клетки селезенки.

Исследование мышиных моделей прогерии привело к открытию удивительной возможности затормозить не только прогерию, но и старение. Были открыты четыре фактора транскрипции, блокирующих образование ламина-А: Oct4, Sox2, Klf4 и c-Myc. Эти факторы в 2006 году впервые получил японский ученый Синъя Яманака, в честь которого они также иногда именуются «факторами Яманаки». При внедрении четырех этих веществ в клетку в виде «кассеты», выработка ламина-А в клетке глушится, а сама соматическая клетка не только прекращает стареть, но и превращается в индуцированную плюрипотентную стволовую клетку. Индуцированные стволовые клетки, как и эмбриональные (эмбриональные стволовые клетки были открыты в 1998 году), могут превращаться в любые соматические клетки, в частности, «ремонтировать» ткань, поврежденную как прогерией, так и обычным старением.

Следует оговориться, что неконтролируемое внедрение кассет с OSKM также до добра не доводит: стволовые клетки возникают в огромном количестве и приводят к формированию тератом, злокачественных образований из эмбриональной ткани. Поэтому дозировку факторов транскрипции приходится тщательно контролировать и вводить их курсами, выдерживая между процедурами интервал в несколько часов.

Тем не менее, открытие этих факторов, получивших общее название OSKM, стало настоящим прорывом на пути к пониманию и лечению рака, а не только к пониманию старения. Синъя Яманака был удостоен за свое открытие Нобелевской премии по физиологии и медицине в 2012 году.   

Лечение прогерии

Первые попытки лечить детскую прогерию предпринимались еще в 2006 году, также на мышиных моделях. Удалось воссоздать весь процесс поступления преламина-А (своеобразной «заготовки» для ламина-А) в ядро. Когда преламин-А направляется в ядро, к нему прикреплена молекула фарнезила, сигнализирующая, что данная молекула должна быть добавлена в оболочку, выстилающую внутреннюю поверхность ядра. Фарнезил выглядит как лишний «кончик» этой молекулы, и по прибытии в ядро должен быть отсечен, что делается при помощи фермента ZMPSTE24. У больных прогерией этот фермент не работает, фарнезил не отсекается, и именно из-за встраивания ламина А с фарнезилированными кончиками в оболочку ядра эта оболочка деформируется и теряет целостность.

В 2006 году впервые удалось затормозить развитие прогерии у мышей, у которых развитие этой болезни было специально спровоцировано. У них был заблокирован фермент фарнезилтрансфераза, подцепляющий фарнезильный кончик к ламину. В результате ламин лишился «опознавательного знака», и в клеточное ядро стала попадать лишь незначительная часть молекул этого белка. Это было сделано при помощи так называемых ингибиторов фарнезилтрансферазы (FTI), которые в целом токсичны для организма и замедляют рост клеток. Но именно благодаря этому свойству они применяются для угнетения раковых опухолей.

В ноябре 2020 года американское агентство по контролю над лекарственными препаратами и пищевыми добавками (FDA) наконец одобрило первый препарат, действующий именно таким образом. Он называется лонафарниб и в среднем продлевает жизнь больных с прогерией на 2,5 года, то есть, на 15-20%.

Обнуление или разворот биологических часов, регулирующих обычное старение – значительно более сложная задача, рассказ о которой выходит за рамки этой публикации. Интересующимся я советую почитать об этом в книге Полины Лосевой «Против часовой стрелки» — именно эта книга и побудила меня после долгого отсутствия написать на столь тяжелую тему как прогерия. Как бы то ни было, вдумчивые обреченные дети-уродцы, дряхлеющие на глазах – настоящее воплощение неотвратимой смерти, и именно понимание их страданий открывает единственный реалистичный путь к победе над старостью, подталкивает трактовать старость именно как болезнь, а не как неизбежность. Поэтому они все-таки дают нам надежду, а также напоминают, как скоротечна жизнь, и как важно ценить ее во всех проявлениях.   

Генетическое заболевание, приводящее к ускоренному старению, смоделировано на животных

Первый случай прогерии (синдрома Гетчинсона — Гилфорда) был описан в 1886 году. Больные дети при рождении ничем не отличаются от остальных, но вскоре рост ребёнка резко замедляется, а признаки преждевременного старения становятся всё более заметными. Каждый год жизни больного примерно соответствует одному десятилетию у здорового человека. Средний возраст детей с прогерией на момент смерти, причиной которой чаще всего становится прогрессирующий атеросклероз, составляет 13 лет.

Прогерия развивается в результате мутации в гене LMNA, который кодирует белок ламин А, участвующий в образовании ядерной ламины. «Усечённая» версия ламина А — так называемый прогерин — не может адекватно выполнять функции протеина, в результате чего ядра клеток деформируются.

Авторы изучали мутацию в LMNA, которая у людей вызывает мышечную дистрофию и кардиомиопатию. Как оказалось, у мышей такая же мутация соответствует состоянию, очень похожему на прогерию. Животные получают «усечённый» ламин А, в результате чего клетки соединительной ткани перестают выделять вещества внеклеточного матрикса и делиться, а затем погибают. Однако при исследовании эмбриональных клеток обнаружить подобные изменения не удалось. В этом авторы видят ещё одно сходство с прогерией, которая проявляется не сразу. У мышей отмечались и характерные для прогериии аномалии в развитии черепа, склеродермия, облысение и потеря подкожного жира.

Биологи также показали, что изменение уровня экспрессии генов, кодирующих белки внеклеточного матрикса, связано с дефектами известного сигнального пути Wnt. «Полученные нами результаты свидетельствуют в пользу того, что прогерия — это «заболевание» внеклеточного матрикса соединительной ткани, которое приводит к отклонениям в развитии скелета, зубов, кожи и сосудистой сети, — заключает один из авторов Колин Стюарт, представляющий сингапурский Институт медицинской биологии. — Если причиной здесь действительно являются дефекты сигнального пути Wnt, мы, вероятно, сможем найти способы борьбы с прогерией».

Полная версия отчёта опубликована в журнале Developmental Cell.

Источник: Компьюлента

Ученые сделали шаг к лечению синдрома преждевременного старения

Ученые Национального научно-исследовательского института генома человека Национальных институтов здоровья США, Института Броудов и Университета Вандербильта с помощью метода генетического редактирования смогли намного продлить жизнь мышей с генетической вариацией, ассоциированной с прогерией — редким наследственным заболеванием, вызывающим у детей резкое преждевременное старение. Результаты исследования описаны в статье, опубликованной в журнале Nature. 

Прогерия — это редкое заболевание, которое диагностируется у одного из четырех миллионов детей в возрасте до двух лет. Как правило, они сталкиваются с проблемами, характерными для пожилых людей (замедление роста, развитие сердечно-сосудистых заболеваний, потеря волос, слуха и т.д.) и умирают в возрасте 14-15 лет от атеросклероза или сердечного приступа.

Прогерия вызывается мутацией в гене LMNA, при которой азотистое основание С заменяется на T. Это приводит к усиленной выработке прогерина, вызывающего ускоренное старение. В конце 2020 года в США было одобрено использование первого препарата против прогерии — лонафарниба, но он не лечит заболевание, а лишь на некоторое время продлевает жизнь пациента.

Исследователи решили изучить, как редактирование оснований (методика редактирования генома, при которой «буквы» ДНК меняются без ее повреждения) повлияет на мышей с симптомами, сходными с прогерией.

Протестировав метод на тканях, полученных от пациентов с прогерией, они смогли исправить мутацию в 90% клеток.

Затем ученые внутривенно ввели мышам с вызывающей синдром мутацией смесь из редактирующих белков и доставляющих их синтетических лентивирусов. Генетическому редактору удалось восстановить правильную последовательность гена LMNA в большинстве органов, а в аорте отредактированные клетки даже смогли полностью заместить клетки, несущие мутацию. В результате продолжительность жизни мышей выросла почти вдвое.

Авторы исследования отмечают, что его конечной целью является разработка этого метода лечения для людей, но пока существует ряд проблем, которые нужно решить на модельных системах.


Прогерия — Эндокринология — Болезни

Фото и иллюстрации

Развитие клетки ребенка, больного прогерией

Источник: www.

helpfulhealthtips.com

Внешний вид детей, больных прогерией

Источник: http://rumbur.ru/science/195-yunie-stariki-progeriya

Десятилетние дети, больные прогерией

Источник: www.helpfulhealthtips.com

24-летний больной прогерией

Источник: http://dynameet.ru/tag/%20%D0%BF%D1%80%D0%BE%D0%B3%D0%B5%D1%80%D0%B8%D1%8F/

Болезнь старения, Синдром Гетчинсона — Гилфорда, Болезнь Гетчинсона — Гилфорда, Гиперстарение


Общее описание болезни

 

Прогерия – это патологическое состояние, при котором во всех органах и тканях наступают изменения, связанные с преждевременным старением. Данная патология встречается достаточно редко – 1 больной на 4-8 миллионов родившихся детей. Поэтому в литературе ее описания впервые появились всего лишь век назад. Заболевание является генетически наследуемым и присутствует в двух формах:

 

  1. Прогерия детского возраста, известная также как синдром Хатчинсона-Гилфорда. Предполагается аутосомно-рецессивный тип наследования патологии, так как она возникает у детей неожиданно, причем, родители всегда абсолютно здоровы.
  2. Прогерия взрослых также известна в качестве синдрома Вернера. Для нее установлен аутосомно-рецессивных тип наследования.

 

 На данный момент во всем мире известно в общем всего 52 случая прогерии.

Редакция Medclub

28.03.2011

 

К какому врачу обратиться

 

Вопросы врачам

Добрый день, Светлана Владимировна. Я уже не знаю к кому обратиться со своей проблемой. Всё началось приблизительно полгода назад. Сначала я стала

Добрый день, Светлана Владимировна. Я уже не знаю к кому обратиться со своей проблемой. Всё началось приблизительно полгода назад. Сначала я стала чувствовать себя хуже. Ни с того, ни сего кружилась голова, приливы жара, ноги сводило судорогой. Потом я заметила, что у меня появились морщины вокруг глаз и вокруг рта, хотя мне всего 17 лет. Я сильно похудела, ноги стали худыми, даже неестественно как-то. Кожа стала сухая, а потом на ногах появились ранки, которые долго не заживают. До сих пор у меня на ногах язвы. Я была у кучи врачей, которые ничего конкретного мне не говорили. Мне поставили диагноз остеопороз, сахар повышен совсем немного, нашли изменения в щитовидной железе и паращитовидной. Дерматолог сказал, что у меня гиперкератоз, что неестественно для моего возраста, посоветовали обратиться к генетику. После всех этих скитаний по врачам мне поставили диагноз прогерия. У сестры моей бабушки тоже такое было. Это что-то вроде быстрого старения? Лечения именно этого заболевания мне не назначили, только отдельно для некоторых органов. Какое лечение необходимо для прогерии? Почему развивается это заболевание?

Очень жду ответа. Марина.

Ответ выше не является медицинским советом или рекомендацией. Обязательно получите очную консультацию у врача. Не откладывайте посещение к врачу и не занимайтесь самолечением, которое может привести к тяжелым последствиям!

Создана:  08.01.2011 | Mary | Россия, Саратов  | 
Статус: отвечен (08.01.2011 04:31) Посмотреть ответ

Здравствуйте, уважаемая Светлана Владимировна. Уже неделю не могу найти себе покоя. Я беременна, срок 28 недель. Неделю назад узнала, что у моего

Здравствуйте, уважаемая Светлана Владимировна. Уже неделю не могу найти себе покоя. Я беременна, срок 28 недель. Неделю назад узнала, что у моего деда была сестра, которая умерла в 6 лет от старости. Я сначала подумала, что это шутка или ошибка, но потом выяснила, что у сестры деда было какое-то странное заболевание, приводящее к быстрому старению. Дед говорит, что сестра была похожа на маленькую старушку и умерла от сердечного приступа. Скажите, пожалуйста, какова вероятность этой патологии у моего ребенка? Что это за заболевание такое? Можно ли профилактировать это заболевание?

Заранее спасибо за ответ. Очень жду.

Ответ выше не является медицинским советом или рекомендацией. Обязательно получите очную консультацию у врача. Не откладывайте посещение к врачу и не занимайтесь самолечением, которое может привести к тяжелым последствиям!

Создана:  09.01.2011 | Kary | Россия, Гатчина  | 
Статус: отвечен (09.01.2011 23:30) Посмотреть ответ

Здравствуйте, Светлана Владимировна. У нас в семье горе. У моей сестры родилась девочка, и ей поставили диагноз прогерии, точней у неё синдром

Здравствуйте, Светлана Владимировна. У нас в семье горе. У моей сестры родилась девочка, и ей поставили диагноз прогерии, точней у неё синдром Хадчинсона-Гилфорда. Врачи говорят, что это преждевременное старение и что спасти девочку не удастся. Почему это произошло, ведь беременность протекала идеально, не было даже токсикоза. Сестра и её муж здоровы, не курят и тем более не принимают никаких запрещенных средств. Неужели нет средства хоть как-то помочь ребенку? Может быть за границей есть клиники, которые лечат прогерию? Что будет, если не найдем средства вылечить?

С уважением, Людмила.

Ответ выше не является медицинским советом или рекомендацией. Обязательно получите очную консультацию у врача. Не откладывайте посещение к врачу и не занимайтесь самолечением, которое может привести к тяжелым последствиям!

Прогерия – преждевременное старение: причины, видео

Прогерия является одной из самых необычных и загадочных болезней. На самом деле ее вызывают не зловредные вирусы, а генетический дефект. Прогерия сопровождается изменением кожи и внутренних органов, а пациенты выглядят чрезмерно постаревшими. У этих людей наблюдается характерный внешний вид: невысокий рост, большая голова и уменьшенная лицевая часть.

♥ ПО ТЕМЕ: Чревовещатели (вентрологи), или как говорить и петь не раскрывая рта (видео).

 

Что такое «прогерия»?

Для начала расшифруем само слово «прогерия». Оно составлено из двух греческих слов – «сверх» и «старик». Таким образом больные становятся «сверхстариками», что выглядит удручающе. Прогерия может быть, как детской, так и взрослой. Впервые такой случай был описан еще в 1886 году английским врачом Хатчинсоном. Он наблюдал за шестилетним мальчиком, который начал быстро стареть, что сопровождалось отмиранием кожи. На основе этой истории и появился в медицине термин «прогерия». Аналогичное заболевание у взрослых было описано чуть позже – немецкий врач Карл Вернер на основе наблюдений за четырьмя пациентами защитил докторскую диссертацию в 1904 году. Прогерия – редчайшая болезнь, всего зафиксировано около 350 ее случаев.

♥ ПО ТЕМЕ: Что такое синдром Туретта: симптомы, причины, видео.

 

Причины возникновения прогерии

Сегодня науке удалось выявить причину такого заболевания. У детей прогерия появляется из-за мутации гена LMNA, отвечающего за кодировку белков-ламинов. В некоторых семьях прогерия встречается у детей одних и тех же родителей (например, Анджали Кумари и Кешав Кумари, видео в конце статьи), иногда ими являются кровные родственники, что тоже может являться причиной сбоя в наследственности.

Прогерия чаще всего не проявляется с рождения, ее признаки дают о себе знать на 2-3 году жизни. Ребенок снижает темпы роста, резко меняется состояние кожи и подкожной клетчатки. Поверхность тела становится сухой и морщинистой, начинают просвечиваться вены. У ребенка увеличивается голова, но не лицо, а нижняя челюсть остается недоразвитой. Развитие организма тоже происходит с явными нарушениями: атрофируются мышцы, выпадают зубы, волосы и ногти, слабым становится костный аппарат и суставы, прекращаются развиваться половые органы, ухудшается зрение.

К сожалению, с таким набором болезней человеку трудно бороться – средняя продолжительность жизни при детской прогерии составляет всего 13 лет. Смерть наступает в возрасте от 7 до 27 лет, в истории медицины известны только 2 пациента, прожившие дольше 27 лет.

Прогерия у взрослых обусловлена нарушением гена WRN. Проявляется заболевание в период полового созревания человека, что приводит к замедлению его роста. На третьем десятке жизни начинают седеть и выпадать волосы, развивается катаракта, тонкой становится кожа. На ней появляются язвы. Ротовое отверстие и нос становятся узкими, тем самым лицо начинает быть похожим на маску. В 30-40 лет проявляет себя сахарный диабет, атеросклероз, возможны и злокачественные опухоли. К сожалению, общего лечения нет – врачи борются с конкретными осложнениями в зависимости от силы симптомов. И в данном случае прогерия заканчивается смертью из-за многочисленных осложнений сосудистой системы и злокачественных образований.

Уже установлено, что прогерия напрямую связана с молекулярными изменениями в организме, происходящими во время старения. Заболевание называют «синдромом Бенджамина Баттона» в честь киноперсонажа, тоже выглядевшим пожилым в детском возрасте.

К сожалению, человечество еще не нашло способа бороться со старостью, да и нужно ли это? Увы, но некоторые люди начинают стареть не душой, а телом еще в детстве. Но история Сэма Бернса показывает, что любовь к жизни все равно сильнее страха смерти. Американский подросток, который умер от прогерии в возрасте всего 17 лет, много выступал с мотивационными лекциями. Сэм публично рассказывал, как даже с физическими ограничениями пытается радоваться каждому прожитому дню и осуществлять свои мечты.

 

Другие дети с заболеванием прогерия

Адалия Роуз (видео 2018 года, девочке 11 лет, ссылка на Instagram Адалии)

 

Байезид Хуссейн (видео 2016 года, на видео мальчику всего 4 года)

 

Анджали Кумари и Кешав Кумари (видео 2016 года, девочке 11 лет, мальчику 1,5 года)

Смотрите также:

это 📕 что такое ПРОГЕРИЯ

мед.
Прогерия — патологическое состояние, характеризующееся преждевременным старением организма (появление дряблой кожи, алопецйи, птичьего лица и т.д.).
• Прогерия взрослых (Вернерасиндром) (*277700, 8р12, дефект гена WRN, р) проявляется склеродермоподобными изменениями кожи (особенно конечностей) и скелетных мышц, развитием катаракты, гипогенитализма, преждевременного артериосклероза, инсулярной недостаточности, повышенным риском развития остеосаркомы; наблюдают чаще у мужчин в возрасте 20-30 лет.
• Прогерия детская (176670,R) проявляется пропорциональной кар-ликовостью, алопецйей, микрогнатией, преждевременным артериосклерозом, отсутствием подкожной клетчатки и рецидивирующими патологическими переломами
• Гилфорда синдром
• Гартингса синдром
• Геродермия детская
• Гётчинсона (Хатчинсона)-Гилфорда болезнь.
• Синдром преждевременного старения (тип Окамдто) (601811, р).Клинически:
• Нарушения роста и нормального развития
• Повышенный риск развития остеосаркомы
• Микроцефалия
• Уплощение носа
• Катаракта
• Деформация ушей
• Сахарный диабет 4 Остеопороз
• Макроцитоз эритроцитов.
• Синдром преждевременного старения (тип Пёнттинен) (601812, р). Клинически:
• Нормальные рост и интеллект
• Задержка костного возраста и прорезывания зубов
• Акроостеолиз
• Брахидактилия
• Сливные очаги уплотнения кожи, напоминающие юношеский гиалиновый фиброматоз кожи
• Дальнозоркость
• Нейросенсорная тугоухость Лабораторно: повышение уровня ТТГ в крови.

МКБ

Е34.8 Другие уточнённые эндокринные расстройства

MIM

• 277700 Синдром Вернера
• 176670 Синдром Гилфорда
• 601811 Синдром преждевременного старения (тип Окамото)
• 601812 Синдром преждевременного старения (тип Пёнттинен)

Литература

Gilford H: Ateleiosis and progeria: continuous youth and premature old age. Brit. Med. J. 2: 914-918, 1904; Goto M et al: Analysis of helicase gene mutations in Japanese Werner’s syndrome patients. Hum. Genet. 99: 191-193, 1997; Gray MD et al: The Werner syndrome protein is a DNA helicase. Nature Genet. 17: 100-103, 1997; Hutchinson J: Case of congenital absence of hair, with atrophic condition of the skin and its appendages, in a boy whose mother had been almost wholly bald from alopecia areata from the age of six. Lancet I: 923, 1886; Penttinen M et al: New progeroid disorder. Am. J. Med. Genet. 69: 182-187, 1997

Синонимы:

старение

Информационный центр генетических и редких заболеваний (GARD) – программа NCATS

80–99% людей имеют эти симптомы
Отсутствие подкожной жировой клетчатки

Отсутствие жира под кожей

Отсутствие жировой ткани под кожей

[ более ]
0007485
Кондуктивное нарушение слуха

Кондуктивная глухота

Кондуктивная тугоухость

[ более ]
0000405
Микрогнатия

Маленькая нижняя челюсть

Маленькая челюсть

Маленькая нижняя челюсть

[ более ]
0000347
Узкое горлышко

Маленький рот

0000160
Преждевременное сморщивание кожи 0100678
Выдающиеся поверхностные кровеносные сосуды

Выраженная поверхностная сосудистая сеть

0007394
Выступающий пупок

Выступающий пупок

Выдающийся пупок

[ более ]
0001544
Задержка полового развития у женщин 0008647
Тяжелая задержка развития

Сильный шаткий вес

Сильный скачок веса

[ более ]
0001525
Тонкая красная кайма

Уменьшение объема губ

Тонкие губы

[ более ]
0000233
Потеря веса 0001824
30-79% людей имеют эти симптомы
Тотальная алопеция 0007418
Анкилоглоссия

язык связан

0010296
Атеросклероз

Сужение и уплотнение артерий

0002621
Coxa valga 0002673
Черепно-лицевая диспропорция 0005461
Снижение уровня лептина в сыворотке 0003292
Задержка менархе

Задержка начала первого периода

0012569
Дистрофические ногти

Плохое формирование ногтей

0008391
Дистрофический ноготь

Плохое формирование ногтей.

0001810
Одышка при физической нагрузке 0002875
Женский гипогонадизм 0000134
Высокое небо

Приподнятое небо

Увеличенная небная высота

[ более ]
0000218
Высокий голос 0001620
Вывих бедра

Вывих бедра

Вывих бедра

[ более ]
0002827
Гипоплазия мужских наружных половых органов

Маленькие наружные половые органы самца

Недоразвитие мужских половых органов

[ более ]
0000050
Резистентность к инсулину

Организм не реагирует на инсулин

0000855
Отсутствие эластичности кожи 0100679
Диастолическая дисфункция левого желудочка 0025168
Низкочастотная нейросенсорная тугоухость 0008573
Узкая спинка носа

Уменьшение ширины спинки носа

Зажатый нос

Тонкая спинка носа

[ более ]
0000418
Узкий кончик носа

Узкий кончик носа

Кончик носа, узкий

Кончик носа, защемленный

Защемленный кончик носа

Защемленный кончик носа

Тонкий кончик носа

Тонкий кончик носа

[ более ]
0011832
Очаговая алопеция

Пятнистое облысение

0002232
Относительная макроцефалия

Относительно большая голова

0004482
Ретрогнатия

Отступающий подбородок

Отступающая нижняя челюсть

Слабый подбородок

Слабая челюсть

[ более ]
0000278
Мелкие орбиты

Уменьшение глубины глазниц

Неглубокие глазницы

[ более ]
0000586
Короткая уздечка языка 0000200
Шаркающая походка

Перетасованная прогулка

0002362
5–29% людей имеют эти симптомы
Отсутствие брови

Нарушение развития бровей

0002223
Аортальная регургитация 0001659
Кальциноз аортального клапана 0004380
Стеноз аортального клапана

Сужение аортального клапана

0001650
Аваскулярный некроз

Отмирание костей из-за снижения кровоснабжения

0010885
Окклюзия сонной артерии

Закупорка сонной артерии

0012474
Выпуклая спинка носа

Клювовидный нос

Клювовидный выступ

Нос с горбинкой

Деформация носа Полли клюв

[ более ]
0000444
Помутнение роговицы 0007957
Цианоз

Посинение кожи

0000961
Задержка прорезывания зубов

Отсроченное извержение

Задержка прорезывания зубов

Задержка прорезывания зубов

Извержение, отсроченное

Позднее прорезывание зубов

Позднее прорезывание зубов

[ более ]
0000684
Скученность зубов

скученные зубы

Стоматологическая переполненность

Скученность зубов

[ более ]
0000678
Кожная атрофия

Дегенерация кожи

0004334
Высокочастотная нейросенсорная тугоухость 0001757
Боль в бедре 0030838
Гипермеланотическая макула

Гиперпигментные пятна

0001034
Гипертония 0000822
Гиподонтия

Нарушение развития от одного до шести зубов

0000668
Ретинированный зуб 0011079
Внутричерепное кровоизлияние

Кровотечение внутри черепа

0002170
Жесткость соединения

Тугой сустав

Жесткие суставы

[ более ]
0001387
Ограничение подвижности в области голеностопного сустава 0010505
Ограниченное движение бедра 0008800
Ограниченное движение плеча 0006467
Ограниченная подвижность запястья

Ограниченное движение запястья

0006248
Потеря ресниц

Ресницы выпали

Отсутствующие ресницы

[ более ]
0011457
Митральная регургитация 0001653
Митральный стеноз 0001718
Кальцификация митрального клапана 0004382
Инфаркт миокарда

Острое сердечно-сосудистое заболевание

0001658
Ночной лагофтальм

Веки остаются открытыми ночью

Неспособность закрыть веки ночью

[ более ]
0030002
Остеоартрит

Дегенеративное заболевание суставов

0002758
Остеолитические дефекты дистальных фаланг кистей 0009839
Папула 0200034
Сохранение временных зубов

Отсроченная потеря молочных зубов

Невыпадение молочных зубов

Сохранившиеся молочные зубы

[ более ]
0006335
Прогрессирующий акроостеолиз ключицы 0000905
Завиток ушной раковины 0009904
Феномен Рейно 0030880
Снижение минеральной плотности костей

Низкая плотность и масса костей

0004349
Короткий подбородок

Уменьшилась высота подбородка

Короткая нижняя треть лица

[ более ]
0000331
Короткие ключицы

Короткая ключица

0000894
Транзиторная ишемическая атака

Мини инсульт

0002326
Обструкция верхних дыхательных путей 0002781
Гипертрофия желудочков 0001714
1–4% людей имеют эти симптомы
Стенокардия 0001681
Изъязвление роговицы 0012804
Систолическая дисфункция левого желудочка 0025169
Легочная артериальная гипертензия

Повышение артериального давления в сосудах легких

0002092
Процент людей, у которых есть эти симптомы, недоступны через HPO
Алопеция

Выпадение волос

0001596
Аутосомно-доминантное наследование 0000006
Аутосомно-рецессивный тип наследования 0000007
Застойная сердечная недостаточность

Сердечная недостаточность

Сердечная недостаточность

Сердечная недостаточность

[ более ]
0001635
Генерализованный остеопороз 0040160
Задержка роста

Замедленный рост

Дефицит роста

Задержка роста

Замедление роста

Плохой рост

Замедленный рост

[ более ]
0001510
Скуловое уплощение

Скуловое уплощение

0000272
Ретрузия средней зоны лица

Уменьшенный размер средней части лица

Дефицит средней части лица

Недоразвитие средней части лица

[ более ]
0011800
Остеолиз

Разрушение кости

0002797
Преждевременный атеросклероз 0004416
Преждевременный атеросклероз коронарных артерий

Преждевременная ишемическая болезнь сердца

0005181

Прогерия — обзор | Темы ScienceDirect

2.

5 Синдром прогерии Хатчинсона-Гилфорда

Синдром прогерии Хатчинсона-Гилфорда (HGPS) представляет собой прогероидный синдром, впервые описанный Джонатаном Хатчинсоном в 1886 г. и Гастингсом Гилфордом в 1897 г. [73]. Однако более подробно этот синдром был описан в 2003 г., когда была открыта молекулярная основа заболевания [73, 74].

Несмотря на то, что пациенты с HGPS рождаются с нормальным внешним видом и массой тела, клинические симптомы появляются в течение 12 мес и быстро прогрессируют [75]. Лучше всего описанной характеристикой пациентов с HGPS является развитие возрастных заболеваний, таких как сердечно-сосудистые патологии, выступающие поверхностные вены, кожные осложнения и алопеция.Кроме того, у этих людей наблюдаются нарушения роста, липодистрофия, аномалии суставов и остеолиз [75]. Это заболевание вызывается однонуклеотидной заменой в гене LMNA , кодирующем ядерные ламиновые белки А-типа [73, 74]. Дифференциальный альтернативный сплайсинг генерирует ламиновые белки А-типа, наиболее распространенными из которых являются ламины А и С; однако мутантный LMNA приводит к аберрантному сплайсингу, который приводит к делеции 50 аминокислотных остатков из С-концевой области преламина А [73, 74, 76]. Этот аберрантный сплайсинг производит мутантный белок, называемый «прогерин», который накапливается в фарнезилированной форме, влияя на организацию ядра, динамику хроматина, эпигенетическую регуляцию и экспрессию генов, вызывая нестабильность генома, преждевременное старение и разрушение теломер [74, 76].

Было замечено, что прогерин модифицирует состав и механические свойства ядерной пластинки, что связано с аномальной ядерной морфологией [74, 76]. Это происходит из-за высокого сродства прогерина к ядерной оболочке и иммобилизации ламинов А-типа в ядерной пластинке, индуцированной прогерином.Кроме того, высокие уровни фосфорилирования γh3AX являются индикатором активированного ответа на повреждение ДНК и клеточного накопления повреждений ДНК [74, 76]. Кроме того, клетки HPGS демонстрируют снижение выживаемости и пролиферации, помимо чувствительности к DSB и замедленному набору репарационных белков [74, 76].

Среди белков, участвующих в этом нарушении рекрутирования, есть компоненты комплекса MRN, которые имеют решающее значение для HR [76]. Кроме того, другим дефектом репарации ДНК, наблюдаемым в клетках HPGS, является неправильная локализация XPA в DSB, что может быть связано с отсроченной активацией белков репарации ДНК, таких как комплекс MRN [76, 77].Таким образом, взаимодействие между молекулярными путями HGTS и молекулярными механизмами, связанными с ATM, а также белками, связанными с NER, такими как XPA, может привести к AT.

Прогерия — обзор | ScienceDirect Topics

Патофизиология синдрома Хатчинсона-Гилфорда Прогерия

Известно, что HGPS является сегментарным заболеванием старения, поскольку присутствуют не все признаки физиологического старения (Ullrich and Gordon, 2015). Пациенты с HGPS обычно страдают алопецией, тяжелым атеросклерозом, аномалиями костей и суставов и потерей подкожного жира.Эти дефекты появляются в тканях, происходящих из мезенхимальных клонов. Вероятно, это связано с тем, что мезенхимальные стволовые клетки человека (hMSC) демонстрируют высокую экспрессию прогерина, как это наблюдается в hMSC, полученных из HGPS-индуцированных плюрипотентных стволовых клеток (iPSC) (Zhang et al. , 2011). Такие органы, как почки, печень, легкие и пищеварительный тракт, обычно не проявляют прогероидных признаков у пациентов с HGPS (Ullrich and Gordon, 2015; Kieran et al., 2007). Пациенты с HGPS также демонстрируют нормальные когнитивные способности, вероятно, потому, что нейроны экспрессируют миР-9, которая может подавлять экспрессию ламина А и, следовательно, снижать экспрессию прогерина (Jung et al., 2012).

Пациенты с HGPS в основном выглядят нормальными при рождении с нормальным весом и чертами лица (Ullrich and Gordon, 2015). Прогероидные черты быстро развиваются в течение года. Эта задержка может быть связана с тем, что LMNA не экспрессируется в эмбриональных клетках, и может потребоваться время, чтобы прогерин накопился в достаточной степени, чтобы придать прогероидные черты (Constantinescu et al., 2006). Пациенты с HGPS начинают терять волосы на черепе в течение года после рождения и, в конечном итоге, теряют все волосы на теле. Кожные аномалии являются самым ранним проявлением, которое можно наблюдать у пациентов с HGPS. Таким образом, это может помочь в диагностике заболевания, поскольку в настоящее время только 54% ​​пациентов с HGPS сообщили о клиническом диагнозе HGPS на первом году жизни (Rork et al., 2014). Учитывая тяжесть HGPS и быстрое развитие прогероидных признаков, кожные проявления можно использовать в качестве индикатора для диагностики HGPS. Наиболее распространенным кожным признаком являются склеродермоидные изменения, преимущественно в области живота и двусторонних нижних конечностей. У некоторых больных на участках склеродермоидных изменений может наблюдаться гипо- и гиперпигментация.Выступающие поверхностные вены также присутствуют у пациентов с HGPS; они являются результатом потери подкожного жира, а вены кожи головы легко видны при выпадении волос (Rork et al., 2014).

Другим серьезным дефектом HGPS являются аномалии костей и суставов (Gordon et al., 2011). Такие особенности, как тонкие ребра, короткие и дистрофические ключицы и акроостеолиз, обычно встречаются у пациентов с HGPS. У них низкая плотность костной ткани, а деминерализация особенно выражена на концах длинных костей. При аномалиях суставов присутствуют остеоартрит и натяжение связок сустава.Еще одной заметной особенностью пациентов с HGPS являются их черепно-лицевые дефекты, включая ретрогнатию, микрогнатию, выпуклые глаза и клювовидный нос (Ullrich and Gordon, 2015). У них снизилась скорость набора веса и роста (Gordon et al., 2007). Поэтому они кажутся маленькими и легкими. Другие незначительные дефекты включают аномалии зубов, аномалии среднего уха и т. д. (Domingo et al., 2009; Guardiani et al., 2011).

Пациенты с HGPS имеют среднюю продолжительность жизни 14,6 лет, и большинство из них умирают от инсульта или инфаркта миокарда, что является результатом преждевременного атеросклероза, прогрессирующего на протяжении всей их жизни (Ullrich and Gordon, 2015).Отличительной чертой атеросклероза при HGPS является резкая потеря VSMC (Stehbens et al., 1999; Olive et al., 2010). ГМК обычно присутствуют в медиальном слое сосудистой стенки. У пациентов с HGPS в сосудистой стенке выражено истощение ГМКС, а их место занимают протеогликаны и коллаген. Повышение жесткости стенок артерий и аномально эхоплотные стенки сосудов могут быть выявлены в результате утолщения фиброзного матрикса. В большинстве СГМК у пациентов с HGPS наблюдалось накопление прогерина, локализованное в ядерной оболочке, и они начинали стареть раньше при культивировании in vitro (Olive et al., 2010). Потеря VSMC также может быть причиной сосудистых аномалий в печени, почках и селезенке, наблюдаемых у пациентов с HGPS (Stehbens et al., 2001). Сосудистые дефекты и уменьшение количества крови также приводят к головным болям, мышечной слабости или судорогам у пациентов с HGPS (Ullrich and Gordon, 2015). До сих пор нет лекарства от HGPS, и лечение пациентов в основном направлено на улучшение фенотипов заболевания и облегчение боли.

Прогерия | Воробей

Обзор

Прогерия (pro-JEER-e-uh), также известная как синдром Хатчинсона-Гилфорда, представляет собой чрезвычайно редкое прогрессирующее генетическое заболевание, вызывающее быстрое старение детей, начиная с первых двух лет жизни.

Дети с прогерией обычно выглядят нормальными при рождении. В течение первого года начинают проявляться признаки и симптомы, такие как медленный рост и выпадение волос.

Проблемы с сердцем или инсульты являются конечной причиной смерти большинства детей с прогерией. Средняя продолжительность жизни ребенка с прогерией составляет около 13 лет. Некоторые с этим заболеванием могут умереть раньше, а другие могут жить дольше, даже до 20 лет.

Лекарства от прогерии не существует, но продолжающиеся исследования показывают некоторые перспективы лечения.

Симптомы

Обычно в течение первого года жизни рост ребенка с прогерией заметно замедляется, но двигательное развитие и интеллект остаются нормальными.

Признаки и симптомы этого прогрессирующего заболевания включают характерный внешний вид:

  • Замедленный рост, рост и вес ниже среднего
  • Узкое лицо, маленькая нижняя челюсть, тонкие губы и крючковатый нос
  • Голова непропорционально большая для лица
  • Выпученные глаза и неполное смыкание век
  • Выпадение волос, включая ресницы и брови
  • Истонченная, пятнистая, морщинистая кожа
  • Видимые вены
  • Высокий голос

Признаки и симптомы также включают проблемы со здоровьем:

  • Тяжелое прогрессирующее заболевание сердца и кровеносных сосудов (сердечно-сосудистые)
  • Затвердевание и уплотнение кожи туловища и конечностей (похожее на склеродермию)
  • Замедленное и аномальное формирование зубов
  • Некоторая потеря слуха
  • Потеря подкожного жира и потеря мышечной массы
  • Аномалии скелета и хрупкие кости
  • Жесткие соединения
  • Вывих бедра
  • Резистентность к инсулину

Когда обращаться к врачу

Прогерию обычно выявляют в младенчестве или раннем детстве, часто при регулярных осмотрах, когда у ребенка впервые появляются характерные признаки преждевременного старения.

Если вы заметили у своего ребенка изменения, которые могут быть признаками и симптомами прогерии, или у вас есть какие-либо опасения по поводу роста или развития вашего ребенка, запишитесь на прием к детскому врачу.

Причины

Мутация одного гена вызывает прогерию. Ген, известный как ламин А (LMNA), вырабатывает белок, необходимый для удержания центра (ядра) клетки вместе. Когда этот ген имеет дефект (мутацию), вырабатывается аномальная форма белка ламина А, называемая прогерином, которая делает клетки нестабильными.Это, по-видимому, приводит к процессу старения прогерии.

В отличие от многих генетических мутаций, прогерия редко передается по наследству. Мутация гена — редкое, в большинстве случаев случайное явление.

Другие подобные синдромы

Существуют и другие прогероидные синдромы, передающиеся по наследству. Эти наследственные синдромы вызывают быстрое старение и сокращение продолжительности жизни:

  • Синдром Видемана-Раутенштрауха, , также известный как неонатальный прогероидный синдром, начинается в утробе матери с признаками и симптомами старения, проявляющимися при рождении.
  • Синдром Вернера, , также известный как прогерия взрослых, начинается в подростковом возрасте или в раннем взрослом возрасте, вызывая преждевременное старение и состояния, типичные для пожилого возраста, такие как катаракта и диабет.

Факторы риска

Нет известных факторов, таких как образ жизни или экологические проблемы, которые повышают риск развития прогерии или рождения ребенка с прогерией. Прогерия встречается крайне редко. Для родителей, у которых был один ребенок с прогерией, шансы рождения второго ребенка с прогерией составляют от 2 до 3 процентов.

Осложнения

У детей с прогерией обычно развивается сильное уплотнение артерий (атеросклероз). Это состояние, при котором стенки артерий — кровеносных сосудов, которые переносят питательные вещества и кислород от сердца к остальным частям тела, — становятся жесткими и утолщаются, что часто ограничивает кровоток.

Большинство детей с прогерией умирают от осложнений, связанных с атеросклерозом, в том числе:

  • Проблемы с кровеносными сосудами, питающими сердце (сердечно-сосудистые проблемы), приводящие к сердечному приступу и застойной сердечной недостаточности
  • Проблемы с кровеносными сосудами, которые снабжают головной мозг (цереброваскулярные проблемы), приводящие к инсульту

Другие проблемы со здоровьем, часто связанные со старением, такие как артрит, катаракта и повышенный риск развития рака, обычно не развиваются как часть течения прогерии.

Диагностика

Врачи могут заподозрить прогерию на основании признаков и симптомов, характерных для синдрома. Генетический тест на мутации LMNA может подтвердить диагноз прогерии.

Тщательный медицинский осмотр вашего ребенка включает:

  • Измерение роста и веса
  • Нанесение измерений на график кривой нормального роста
  • Проверка слуха и зрения
  • Измерение основных показателей жизнедеятельности, включая артериальное давление
  • Поиск видимых признаков и симптомов, типичных для прогерии

Не стесняйтесь задавать вопросы.Прогерия — очень редкое заболевание, и, вероятно, вашему врачу потребуется собрать больше информации, прежде чем определять следующие шаги по уходу за вашим ребенком. Ваши вопросы и проблемы могут помочь вашему врачу составить список тем для исследования.

Лечение

Лекарства от прогерии не существует, но регулярный мониторинг заболеваний сердца и кровеносных сосудов (сердечно-сосудистых) может помочь контролировать состояние вашего ребенка.

Во время визитов к врачу вес и рост вашего ребенка измеряют и наносят на график нормальных значений роста.Врач может порекомендовать дополнительные регулярные обследования, в том числе электрокардиограммы и осмотры зубов, зрения и слуха, для проверки изменений.

Определенные методы лечения могут ослабить или отсрочить появление некоторых признаков и симптомов. Лечение зависит от состояния и симптомов вашего ребенка. К ним могут относиться:

  • Низкие дозы аспирина. Ежедневная доза может помочь предотвратить сердечные приступы и инсульт.
  • Другие лекарства. В зависимости от состояния вашего ребенка врач может назначить другие лекарства, такие как статины для снижения уровня холестерина, препараты для снижения артериального давления, антикоагулянты для предотвращения образования тромбов и препараты для лечения головной боли и судорог.
  • Физиотерапия и трудотерапия. Эти методы лечения могут помочь при тугоподвижности суставов и проблемах с тазобедренными суставами, чтобы помочь вашему ребенку оставаться активным.
  • Питание. Питательные, высококалорийные продукты и добавки могут помочь поддерживать адекватное питание.
  • Стоматологическая помощь. Проблемы с зубами часто встречаются при прогерии. Рекомендуется консультация детского стоматолога, имеющего опыт лечения прогерии.

Возможное лечение в будущем

Текущие исследования направлены на то, чтобы понять прогерию и определить новые варианты лечения.Некоторые области исследований включают:

  • Изучение генов и течения болезни, чтобы понять, как она прогрессирует. Это может помочь определить новые методы лечения.
  • Изучение способов профилактики болезней сердца и сосудов.
  • Проведение клинических испытаний на людях с использованием препаратов, известных как ингибиторы фарнезилтрансферазы (ИФТ), таких как лонафарниб, которые были разработаны для лечения рака, но могут быть эффективны для лечения прогерии, помогая прибавлять в весе и повышая гибкость кровеносных сосудов.
  • Тестирование других препаратов для лечения прогерии.

Образ жизни и домашние средства

Вот несколько шагов, которые вы можете предпринять дома, чтобы помочь своему ребенку:

  • Убедитесь, что ваш ребенок получает достаточное количество жидкости. Обезвоживание может быть более серьезным у детей с прогерией. Следите за тем, чтобы ваш ребенок пил много воды, особенно во время болезни, при активности или в жаркую погоду.
  • Обеспечьте частое питание небольшими порциями. Поскольку питание и рост могут быть проблемой для детей с прогерией, давайте ребенку более частые приемы пищи небольшими порциями, это может помочь увеличить потребление калорий.Добавьте здоровую, высококалорийную пищу и закуски или добавки по мере необходимости.
  • Обеспечьте возможность регулярной физической активности. Проконсультируйтесь с врачом вашего ребенка, чтобы узнать, какие занятия подходят для вашего ребенка.
  • Приобретите для ребенка амортизирующую обувь или вставки для обуви. Потеря жировых отложений в ногах может вызвать дискомфорт.
  • Используйте солнцезащитный крем. Используйте солнцезащитный крем широкого спектра действия с SPF не менее 15. Обильно наносите солнцезащитный крем и наносите повторно каждые два часа или чаще, если ваш ребенок плавает или потеет.
  • Убедитесь, что ваш ребенок в курсе всех прививок. Ребенок с прогерией не подвергается повышенному риску заражения, но, как и все дети, подвержен риску заражения инфекционными заболеваниями.
  • Предоставлять возможности для обучения и общения. Прогерия не повлияет на интеллект вашего ребенка, поэтому он или она сможет посещать школу на соответствующем возрасту уровне. Может потребоваться некоторая адаптация к размеру и способностям.
  • Сделать адаптацию. Возможно, вам придется внести некоторые изменения дома, чтобы ваш ребенок обрел независимость и чувствовал себя комфортно. Это может включать изменения в доме, чтобы ваш ребенок мог дотянуться до таких предметов, как краны или выключатели света, одежда со специальными застежками или нестандартных размеров, а также дополнительные набивки для стульев и кроватей.

Помощь и поддержка

Информация о том, что у вашего ребенка прогерия, может быть эмоционально разрушительной. Внезапно вы знаете, что ваш ребенок сталкивается со многими трудными проблемами и укороченной продолжительностью жизни.Для вас и вашей семьи преодоление расстройства требует значительных физических, эмоциональных и финансовых ресурсов.

Некоторые полезные ресурсы включают в себя:

  • Сеть поддержки. Ваша медицинская команда, семья и друзья могут стать ценной частью вашей сети поддержки. Кроме того, спросите своего врача о группах самопомощи или психотерапевтах в вашем районе. Ваш местный отдел здравоохранения, публичная библиотека и надежные источники в Интернете могут помочь в поиске ресурсов.
  • Группы поддержки. В группе поддержки вы будете с людьми, которые сталкиваются с проблемами, похожими на ваши. Если вы не можете найти группу поддержки прогерии, вы можете найти группу для родителей детей с хроническими заболеваниями.
  • Другие семьи, страдающие прогерией. Исследовательский фонд прогерии может помочь вам связаться с другими семьями, борющимися с прогерией.
  • Терапевты. Если группа не для вас, может быть полезно поговорить с терапевтом или священником.

Как помочь ребенку справиться с болезнью

Если у вашего ребенка прогерия, он или она также, вероятно, будут чувствовать себя все более непохожими на других по мере прогрессирования заболевания. Со временем страх и горе, вероятно, будут усиливаться по мере того, как растет осознание того, что прогерия сокращает продолжительность жизни. Вашему ребенку понадобится ваша помощь, чтобы справиться с физическими изменениями, особыми приспособлениями, реакцией других людей и, в конечном счете, с концепцией смерти.

У вашего ребенка могут возникнуть трудные, но важные вопросы о его или ее состоянии, духовности и религии.Ваш ребенок может также задавать вопросы о том, что произойдет в вашей семье после его или ее смерти. У братьев и сестер могут быть такие же вопросы.

Для таких разговоров с ребенком:

  • Попросите своего врача, терапевта или священника помочь вам подготовиться.
  • Рассмотрите мнение или рекомендации друзей, которых вы встретили в группах поддержки, которые поделились этим опытом.
  • Говорите открыто и честно со своим ребенком, его или ее братьями и сестрами и подбадривайте их, что совместимо с вашей системой убеждений и соответствует возрасту ребенка.
  • Узнайте, когда вашему ребенку или его братьям и сестрам может быть полезно поговорить с терапевтом или священником.

Подготовка к приему

Вполне вероятно, что ваш семейный врач или педиатр вашего ребенка заметит признаки и симптомы прогерии во время регулярных осмотров. После оценки вашего ребенка могут направить к специалисту по медицинской генетике.

Вот некоторая информация, которая поможет вам подготовиться к встрече.

Что вы можете сделать

Чтобы подготовиться к встрече, составьте список:

  • Любые признаки и симптомы, которые испытывает ваш ребенок, и как долго.
  • Ключевая медицинская информация о вашем ребенке, , включая недавние болезни, любые заболевания, а также названия и дозы любых лекарств, витаминов, трав или других добавок.
  • Вопросы вы хотите задать врачу.

Некоторые основные вопросы, которые следует задать врачу, могут включать:

  • Что, вероятно, вызывает признаки и симптомы у моего ребенка?
  • Существуют ли другие возможные причины?
  • Какие анализы нужны моему ребенку?
  • Доступны ли методы лечения этого состояния?
  • Каковы осложнения этого состояния?
  • Подвержены ли другие мои дети или члены семьи повышенному риску этого состояния?
  • Проводятся ли клинические испытания, на которые мой ребенок может иметь право?
  • Вы рекомендуете моему ребенку обратиться к специалисту?
  • Как я могу найти другие семьи, которые справляются с этим заболеванием?

Чего ожидать от вашего врача

Ваш врач, скорее всего, задаст вам ряд вопросов. Будьте готовы ответить на них, чтобы зарезервировать время для обсуждения моментов, на которых вы хотите сосредоточиться.

  • Когда вы впервые заметили, что что-то может быть не так?
  • Какие признаки и симптомы вы заметили?
  • Были ли у вашего ребенка диагностированы какие-либо заметные заболевания или состояния? Если да, то чем лечили?
  • Как поживает ваша семья?

Контент из клиники Майо Обновлено:
© 1998-2022 Фонд медицинского образования и исследований Мэйо (MFMER).Все права защищены. Условия эксплуатации

Браузер не поддерживается! Этот веб-сайт будет предлагать ограниченную функциональность в этом браузере. Мы поддерживаем только последние версии основных браузеров, таких как Chrome, Firefox, Safari и Edge.

×

От неизвестного к первому одобренному FDA лечению

«Я хочу, чтобы вы познакомились со мной. Это моя жизнь. Прогерия является частью этого. Это не главная его часть.”

Так 15-летний Сэм Бернс представил номинированный на «Оскар» документальный фильм HBO 2013 года «Жизнь согласно Сэму».

Фильм направлен на повышение осведомленности о синдроме прогерии Хатчинсона-Гилфорда, редком смертельном генетическом заболевании, вызывающем преждевременное старение. В нем рассказывается о вдохновляющем путешествии надежды и стойкости Сэма и его родителей. Он также документирует науку и пропаганду, которые в конечном итоге привели к первому одобренному FDA лечению прогерии, которое было одобрено в конце прошлого года.

Аарон Винсент Элкаим | Предоставлено Фондом Прогерия

Лонафарниб является первым препаратом, одобренным Управлением по санитарному надзору за качеством пищевых продуктов и медикаментов для лечения редкого заболевания прогерии.

20 ноября Управление по санитарному надзору за качеством пищевых продуктов и медикаментов одобрило лонафарниб под торговой маркой Zokinvy. В исследованиях лонафарниб, ингибитор фарнезилтрансферазы, увеличивал продолжительность жизни пациентов с прогерией в среднем на 2,5 года.

«Это обнадеживает, поскольку устанавливает стандарт лечения пациентов с прогерией, в то время как мы и другие исследователи прогерии изучаем еще более совершенные терапевтические средства, ведущие к излечению», — сказал Майк Эрдос, научный сотрудник Национального института исследований генома человека при Национальном институте здравоохранения. .

Генетика и биохимия

Младенцы, рожденные с прогерией, сначала кажутся здоровыми. Но они начинают стареть в 10 раз быстрее, чем обычно. В возрасте до 1 года прибавка в весе замедляется, волосы начинают истончаться, а затем полностью выпадают, суставы могут затвердевать, а кости ослабевать. Со временем сосуды закупориваются, а соединительная ткань твердеет. Многие пациенты умирают от инфаркта или инсульта, не дожив до 15 лет.

Международный регистр пациентов Фонда исследований прогерии в настоящее время идентифицирует 131 ребенка, живущего с прогерией во всем мире. По оценкам фонда, в мире может быть до 250 пациентов, которым еще не поставили диагноз.

Прогерия вызывается накоплением прогерина, аномально усеченной формы белка ламина А. Единственная мутация в гене LMNA активирует редко используемый альтернативный сайт сплайсинга, что приводит к делеции части белка (50 аминокислот, если быть точным). Мутация является аутосомно-доминантной; однако он не обнаруживается у родителей и, вероятно, возникает спонтанно в зародышевой клетке.

Ламин А является одним из ключевых структурных белков, образующих прочную липидно-белковую основу, которая скрепляет ядерную мембрану каждого клеточного ядра. Обычно ламин А подвергается посттрансляционной модификации, в результате чего он сначала фарнезилируется и карбоксиметилируется, после чего происходит ферментативное расщепление концевых 50 аминокислот, включая фарнезильную группу.

Однако при прогерии в укороченном белке отсутствует вышеупомянутый сайт расщепления, что приводит к накоплению постоянно фарнезилированного, нерасщепленного ламина А (прогерина) на ядерной мембране, что дестабилизирует ядерную мембрану.

Шон Файн | Предоставлено Фондом Прогерия

Лесли Гордон и Скотт Бернс стали соучредителями Исследовательского фонда прогерии после того, как у их сына Сэма обнаружили прогерию. Сэм рассказал, на что похожа жизнь с прогерией, в документальном фильме HBO «Жизнь согласно Сэму». Умер от осложнений болезни в возрасте 17 лет в 2014 году.

Семейное дело

Доктор Лесли Гордон — педиатр-исследователь из Университета Брауна и врач Бостонской детской больницы.Возможно, ее самая важная репутация: она мать Сэма Бернса.

«Когда Сэму поставили диагноз, мы бросили все и попытались найти ресурсы. То, что мы обнаружили, было обескураживающим», — сказал Гордон. «Мы не знали причину, мутацию. Было мало исследований, не было финансирования, не было лечения, и таким семьям, как мы, некуда было обратиться за информацией».

Чтобы восполнить этот пробел, Гордон вместе со своим мужем, доктором Скоттом Бернсом, также детским врачом, основала Исследовательский фонд Прогерия в 1999 году, всего через год после того, как их сыну поставили диагноз.

Национальные институты здравоохранения

Фрэнсис С. Коллинз был директором Национального института здоровья с тех пор, как он был назначен президентом Бараком Обамой в 2009 году. До этого он руководил Национальным институтом исследования генома человека и руководил проектом «Геном человека».

Фонд создал международный регистр пациентов, создал банк клеток и тканей для предоставления материалов для исследований, запустил программу финансирования исследований и создал консорциум по исследованию прогерии, состоящий из ученых со всего мира.Одним из экспертов, присоединившихся к консорциуму, был врач и генетик Национального института здравоохранения Фрэнсис С. Коллинз.

С 1993 по 2008 год Коллинз был директором NHGRI. В это время он руководил проектом «Геном человека», кульминацией которого стало секвенирование генома человека в 2003 году.

В том же году исследовательская группа Коллинза, Лесли Гордон и другие сотрудники опубликовали статью, в которой впервые описали генетическую основу прогерии — они определили загадочный сайт сплайсинга в гене LMNA как вызывающий прогерию. Соавторы создали трансгенную модель мыши, экспрессирующую человеческий ген прогерина. Мышиная модель успешно воспроизводит дефекты сердечно-сосудистой системы и другие особенности заболевания.

«Мы понятия не имели, что обнаружение мутации гена сделает то, что она сделала для нас, но мы знали, что это очень, очень важно», — сказал Гордон PLOS Blogs в 2012 году.

Гордон намеревался способствовать сотрудничеству и возглавил начало исследования естественной истории прогерии в Бостонской детской больнице, чтобы лучше понять прогрессирование заболевания у этих детей, что в конечном итоге привело к интервенционным клиническим испытаниям для тестирования перспективных лекарств для лечения прогерии.

Перепрофилирование лекарств

Фарнезильная группа, любящая липиды, постоянно присоединенная к прогерину, заставляет молекулу прилипать к внутренней ядерной мембране. Это приводит к утолщению ламины, изменению организации хроматина, повреждению ДНК, укорочению теломер и митохондриальной дисфункции, следовательно, быстрому преждевременному старению, наблюдаемому у молодых пациентов.

Поскольку фарнезильная группа в прогерине является преобладающим токсичным ингредиентом, исследователи сосредоточились на лечении, чтобы блокировать фарнезилирование прогерина, чтобы предотвратить его прикрепление к ядерной мембране.Сначала было показано, что лекарства работают в культивируемых клетках. Затем модель мыши Коллинза оказалась жизненно важным инструментом для демонстрации их эффективности: симптомы у мышей улучшились после лечения некоторыми ингибиторами фарнезилтрансферазы.

По счастливой случайности исследователи из Schering-Plough, теперь Merck, в течение десяти лет работали с ингибиторами фарнезилтрансферазы в качестве потенциального средства для лечения рака головного мозга у детей, и компания бесплатно поставляла лонафарниб во время клинических испытаний прогерии, начиная с 2007 года.«Нам повезло, потому что в течение 10 лет проводились фармацевтические исследования по разработке лекарства, которое мы просили перенести в область прогерии», — сказал Гордон Национальному общественному радио в 2012 году.

Позже небольшая биофармацевтическая компания Eiger обратилась к Merck по поводу адаптации лонафарниба для лечения инфекции, вызванной вирусом гепатита дельта, еще одного серьезного редкого заболевания. Затем Эйгер начал сотрудничество с исследовательским фондом Progeria в 2018 году.

Лесли Гордон, который является медицинским директором фонда, сказал, что результаты 2011 года, показывающие, что лонафарниб значительно улучшил скорость артериальной пульсовой волны пациентов, являющуюся предиктором сердечно-сосудистого риска, стали переломным моментом.Она была ведущим автором этой статьи в журнале Proceedings of the National Academy of Sciences.

Ее сын был одним из первых детей с прогерией, получивших препарат.

«Эта история станет примером генетического заболевания во многих, если не во всех школьных курсах по генетике человека», — сказал Эрдос из NHGRI.

Будущие направления

Хотя лонафарниб облегчает сердечно-сосудистые симптомы прогерии и увеличивает продолжительность жизни почти на 20%, он не облегчает другие симптомы, такие как отсутствие подкожного жира, выпадение волос, задержка роста и контрактуры суставов.

У исследователей, разрабатывающих лекарства второго поколения, есть несколько направлений: низкомолекулярные ингибиторы, нацеленные на прогерин, РНК-терапевтические препараты, предотвращающие выработку прогерина, и редактирование генома для исправления мутации на уровне ДНК.

Разработка первого препарата для лечения прогерии подчеркивает важность фундаментальных исследований, сотрудничества между учеными и клиницистами и, прежде всего, тесного участия групп защиты интересов пациентов.

Гордон подчеркнул, что темпы исследований редких заболеваний и всего остального быстро растут.«За последние 20 лет технологии шагнули вперед семимильными шагами, — сказала она. «То, чего мы могли достичь за месяцы и годы, теперь возможно за недели».

Сэм скончался в возрасте 17 лет в 2014 году от осложнений прогерии, но оставил после себя любовь, надежду и вдохновение. «Я ставил себя перед вами не для того, чтобы вы чувствовали себя плохо из-за меня», — сказал он в фильме. «Я встал перед тобой, чтобы дать тебе понять, что тебе не нужно чувствовать себя плохо из-за меня».

Синдром Хатчинсона-Гилфорда прогерия объяснили тем, что ютубер Адалия Роуз умерла в возрасте 15 лет

Адалия Роуз Уильямс, 15-летняя ютубер, родившаяся с редким генетическим заболеванием под названием прогерия, умерла, как подтвердила ее семья.

В заявлении, размещенном в Facebook и Instagram, семья сообщила, что Роуз скончалась вечером 12 января 2022 года и что ее наконец-то «освободили от этого мира».

Роуз собрала почти три миллиона подписчиков на своем канале YouTube, на котором она документировала свою жизнь и борьбу со своим заболеванием.

Семья, которая недавно переехала в Сан-Антонио, штат Техас, из Остина, заявила в заявлении: «Она тихо вошла в это и тихо уехала, но ее жизнь была далека от этого.Она тронула МИЛЛИОНЫ людей и оставила самый большой след во всех, кто ее знал. Она больше не испытывает боли и теперь танцует под любимую музыку. Я бы очень хотел, чтобы это не было нашей реальностью, но, к сожалению, это так.»

«Мы хотим сказать спасибо всем, кто любил и поддерживал ее. Спасибо всем ее врачам и медсестрам, которые ГОДЫ работали, чтобы сохранить ее здоровье. Теперь семья хотела бы оплакать эту огромную потерю наедине».

Что такое прогерия?

Прогерия, также известная как синдром Хатчинсона-Гилфорда Прогерия, или сокращенно HGPS, является очень редким генетическим заболеванием, которое, по сути, приводит к старению детей. быстро.

Дети с этим заболеванием кажутся здоровыми при рождении, но обычно начинают проявлять признаки быстрого биологического старения в течение первых двух лет жизни.

По данным Кливлендской клиники, это очень редкое заболевание, которым страдает только один из 20 миллионов человек во всем мире. Прогерия одинаково часто встречается у мальчиков, как и у девочек.

Заболевание вызвано мутацией в одном гене, известном как ламин А (LMNA), который создает белок, необходимый для удержания центра или ядер клеток вместе.

Когда этот ген мутирован, он производит аномальную форму белка LMNA, называемого прогерином, который делает клетки нестабильными и приводит к быстрому старению, наблюдаемому при прогерии.

Нет известных факторов риска — окружающей среды, образа жизни или других, — которые могут увеличить риск развития прогерии или рождения ребенка с этим заболеванием. В отличие от многих генетических заболеваний, прогерия не передается по наследству. На самом деле, по данным клиники Майо, шансы родителей родить второго ребенка с этим заболеванием составляют около 2-3 процентов.

Признаки и симптомы заболевания обычно появляются на первом году жизни, так как рост ребенка значительно замедляется, а моторное и интеллектуальное развитие остаются нормальными.

Основные признаки и симптомы прогрессирующего заболевания включают: замедление роста, приводящее к снижению роста и веса ниже среднего; суженное лицо, с небольшой нижней челюстью, тонкими губами и крючковатым носом; голова непропорционально большая по сравнению с лицом; выпуклые глаза и невозможность полностью сомкнуть веки; выпадение волос, в том числе ресниц и бровей; истончение, пятнистость и морщинистость кожи; видимые вены; и высокий голос.

Заболевание обычно сопровождается рядом проблем со здоровьем, включая тяжелое прогрессирующее заболевание сердца и кровеносных сосудов; уплотнение и уплотнение кожи на некоторых участках тела; аномальное формирование зубов; некоторая потеря слуха; потеря жира, который находится под кожей, а также мышечной массы; скелетные аномалии и хрупкие кости; жесткие суставы; и вывих бедра.

По данным клиники Майо, средняя продолжительность жизни ребенка с прогерией составляет около 13 лет, хотя некоторые люди умирают раньше, а другие доживают до 20 лет.Осложнения, связанные с сердечно-сосудистыми заболеваниями, являются наиболее частой причиной смерти людей, страдающих прогерией.

В настоящее время нет лекарства от прогерии, хотя Управление по санитарному надзору за качеством пищевых продуктов и медикаментов США одобрило первое в истории лечение этой болезни в 2020 году, которое обеспечивает некоторое улучшение в одной или нескольких областях состояния.

Николь Герьеро, Адалия Роуз и Кэнди Джонсон на выставке ipsy Gen Beauty в конференц-центре Лос-Анджелеса, 25 марта 2018 года, Лос-Анджелес, Калифорния. По словам семьи, Роуз скончалась 12 января 2022 года. Вивьен Киллилеа / Getty Images для ipsy

Мутантная форма ламина А, вызывающая прогерию Хатчинсона-Гилфорда, является биомаркером клеточного старения в коже человека

Abstract

Синдром прогерии Хатчинсона-Гилфорда (HGPS, OMIM 176670) — редкое заболевание, характеризующееся ускоренным старением и ранней смертью, часто от инсульта или ишемической болезни сердца. 90% случаев HGPS несут мутацию LMNA G608G (GGC>GGT) в экзоне 11 LMNA, , активирующую сайт донора сплайсинга, что приводит к продукции доминантно-негативной формы белка ламина А, обозначаемого как прогерин.Скрининг 150 биопсий кожи здоровых лиц (от новорожденных до 97 лет) показал, что сходное событие сплайсинга происходит in vivo на низком уровне в коже в любом возрасте. В то время как мРНК прогерина остается низкой, белок с возрастом накапливается в коже в подмножестве дермальных фибробластов и в нескольких терминально дифференцированных кератиноцитах. Прогерин-положительные фибробласты локализуются вблизи базальной мембраны и в сосочковом слое дермы молодой взрослой кожи; однако их количество увеличивается, и в коже пожилых людей они достигают глубоких слоев ретикулярной дермы.Наши результаты показывают, что экспрессия прогерина является биомаркером нормального клеточного старения и потенциально может быть связана с терминальной дифференцировкой и старением у пожилых людей.

Образец цитирования: McClintock D, Ratner D, Lokuge M, Owens DM, Gordon LB, Collins FS, et al. (2007) Мутантная форма ламина А, вызывающая прогерию Хатчинсона-Гилфорда, является биомаркером клеточного старения кожи человека. ПЛОС ОДИН 2(12): е1269. https://doi.org/10.1371/журнал.pone.0001269

Академический редактор: Альфред Левин, Университет Флориды, США

Получено: 5 октября 2007 г.; Принято: 10 ноября 2007 г .; Опубликовано: 5 декабря 2007 г.

Это статья с открытым доступом, распространяемая в соответствии с условиями декларации Creative Commons Public Domain, которая предусматривает, что после помещения в общественное достояние эта работа может свободно воспроизводиться, распространяться, передаваться, изменены, построены или иным образом использованы кем-либо в любых законных целях.

Финансирование: Эта работа была поддержана Исследовательским фондом Progeria, Фондом Ирвинга и грантами NIH K01AR048594 и RO1AG025302 (для KD), NCI R01CA114010 (для DMO), а также внутренней программой Национального института исследования генома человека. (в ФСК).

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Введение

Ламины А- и В-типа представляют собой белки промежуточных филаментов, которые составляют основные компоненты ядерной пластинки, филаментной сети, образующей интерфейс между внутренней ядерной мембраной и хроматином [1]. Ламины А и С, основные изоформы ламинов А-типа, экспрессируются во всех дифференцированных клетках позвоночных [2] и транслируются с альтернативно сплайсированных транскриптов гена LMNA . В отличие от одного гена LMNA , существует два гена ламина В-типа: ген LMNB1 кодирует белок ламина B1 [3], [4], а LMNB2 кодирует два белковых продукта альтернативного сплайсинга: ламин B2 и ламин В3, [5], [6]. Ламины В-типа экспрессируются на протяжении всего развития, и один или несколько ламинов В-типа присутствуют во всех типах клеток [7]–[9]

Ламины

расположены в ядерной пластинке и по всей нуклеоплазме [10], [11], где они, по-видимому, играют фундаментальную роль в форме, целостности и функции ядра, а также в репликации ДНК и транскрипции РНК [12].Ламин А и ламин В модифицируются в их карбоксиконцевом блоке –CAAX посредством серии посттрансляционных модификаций. Модификации включают последовательное фарнезилирование цистеина в C-концевом мотиве CaaX (C, цистеин; а, алифатический; X, любая аминокислота) с последующим протеолитическим расщеплением ааХ-концевого трипептида и метилированием фарнезилированный цистеин [13]. В то время как ламины В-типа остаются постоянно фарнезилированными, преламин А (предшественник зрелого ламина А) подвергается вторичному расщеплению оставшихся 15 С-концевых остатков (аминокислоты 647–661) с образованием зрелого ламина А, теряя при этом свой фарнезил. модификация [13], [14].Ферментом, ответственным за эти последовательные протеолитические расщепления, является цинк-металлопротеиназа ZMSPTE24, для которой ламин А является единственным известным субстратом у млекопитающих [15].

Мутации в LMNA связаны с 12 различными заболеваниями, обычно называемыми ламинопатиями, и затрагивают различные ткани, включая мышцы, периферические нервы, жировую, костную и кожную ткани. Эти расстройства демонстрируют различные клинические фенотипы, связанные с такими признаками, как миопатия, кардиомиопатия, липодистрофия, невропатия и преждевременное старение [16]–[18].Двумя наиболее известными примерами синдрома ускоренного старения у людей являются синдром прогерии Хатчинсона-Гилфорда (HGPS, «детская прогерия») и синдром Вернера (WS, «прогерия взрослых»). В то время как большинство случаев WS были вызваны мутациями в геликазе WRN [19], у подмножества пациентов с WS не обнаруживаются мутации в локусе WRN (атипичный WS), но обнаруживаются гетерозиготные аминокислотные замены в области гептадного повтора ламина А. 20]–[22].

Синдром прогерии Хатчинсона-Гилфорда (HGPS, OMIM 176670) — редкое спорадическое заболевание с частотой 1 случай на 4–8 млн живорождений, состоящее из фенотипа преждевременного старения с быстрым замедлением роста в детстве [18].Внешний вид при рождении и масса тела при рождении обычно нормальные, но рост обычно замедляется к годовалому возрасту [23]. Фенотипический внешний вид состоит из следующего: низкий рост, скульптурный нос, алопеция, выступающие вены на голове, потеря подкожного жира и дистрофия ногтей. Кроме того, у пациентов с HGPS обнаруживаются скелетные аномалии, которые могут отражать недостаточность остеогенеза, главным образом в конечностях, нижнечелюстную и черепную дисплазию с дезорганизованным ростом, деформации зубных рядов и тяжелый остеолиз [24] [25]. Распространенными причинами смерти у пациентов с HGPS в течение второго десятилетия жизни являются хронические состояния, наиболее распространенные у пожилых людей, особенно ишемическая болезнь сердца и инсульт из-за распространенного атеросклероза [26].

Почти 90% субъектов, страдающих HGPS, несут мутацию de novo G608G (GGC>GGT) в экзоне 11 LMNA, [22], [27], [28]. Это изменение одного нуклеотида активирует криптический донорный сайт сплайсинга, что приводит к делеции 3′-концевых 150 нуклеотидов экзона 11 мРНК, вызывая внутреннее усечение на 50 аминокислот вблизи карбоксильного конца преламина А [28].Укороченный ламин А, называемый прогерином, лишен аминокислот с 607 по 656 преламина А, но сохраняет СААХ-бокс [22], [27], [28]. Поскольку сайт эндопротеолитического расщепления для ZMPSTE24 потерян в мутантном белке, прогерин остается постоянно фарнезилированным, вызывая его тесную связь с ядерной оболочкой и вызывая многочисленные аномалии ядерной оболочки [29], [30]. Эта модификация, по-видимому, также влияет на динамическое состояние прогерина в ламине [31], [32].

Клетки, полученные от людей с HGPS и субъектов с патологиями, напоминающими HGPS, такими как атипичная прогерия, синдром Вернера (WS), рестриктивная дермопатия (RD) и нижнечелюстная дисплазия (MAD), по-видимому, имеют общую черту: накопление преламина A, либо как полноразмерный белок преламин А или различные укороченные формы преламина А [14].При всех этих заболеваниях преламин А или мутантный преламин А остается фарнезилированным и накапливается в ядерном компартменте по мере увеличения клеточной генерации [29], [30], [33]. Персистенция фарнезилированной формы, по-видимому, является ключевым элементом, ответственным за тяжелые ядерные аномалии и дефекты в организации гетерохроматина, митозов, репликации ДНК, транскрипции и репарации [34]–[37].

Недавно было обнаружено, что редкие фибробласты, культивированные у пожилых людей, демонстрируют ядерные фенотипы, идентичные фенотипам клеток HGPS [38]. Интересно, что в то время как эти клетки экспрессировали транскрипты мРНК прогерина на едва обнаруживаемых уровнях [38], долгосрочные культуры содержали несколько аномальных ядер, которые были явно положительными с анти-прогерин-специфическим антителом [39]. Эти наблюдения показывают, что прогерин также экспрессируется в нормальных клетках. Предположительно, криптический донорный сайт сплайсинга в экзоне 11 LMNA активируется мутацией HGPS, но нормальная последовательность способна функционировать сходным образом при некоторых обстоятельствах, по крайней мере, в долгосрочной культуре.

Для дальнейшего изучения биологической значимости экспрессии прогерина у здоровых людей и ее связи с нормальным старением мы проследили пространственно-временной характер экспрессии прогерина в коже человека в любом возрасте. Здесь мы приводим новые данные, указывающие на то, что прогерин экспрессируется и накапливается in vivo при нормальном старении.

Результаты

Обнаружение прогерина in vivo у здоровых людей

Используя кожу человека в качестве модельной системы, мы исследовали, экспрессируется ли прогерин в коже здоровых людей. В Дерматологической клинике Колумбийского университета было взято 150 биопсий кожи крайней плоти новорожденных и здоровых людей, включая равное количество женщин и мужчин в возрасте от 22 до 97 лет. Биопсии были взяты из разных участков тела (таблица 1). Используя одноэтапную полимеразную цепную реакцию с обратной транскрипцией (ОТ-ПЦР), мы провели скрининг препаратов тотальной РНК, выделенных из биоптатов кожи. Праймеры в экзоне 9 и экзоне 12, описанные ранее [38], в первую очередь амплифицируют ламин А дикого типа; однако второстепенный фрагмент, сходный по размеру с транскриптом HGPS, был обнаружен в 50 биоптатах, примеры которых показаны на рисунке 1А.Поразительно, что уровни амплифицированного короткого продукта оставались низкими во всех образцах, и никаких возрастных различий не наблюдалось. Было обнаружено, что секвенирование короткого продукта кДНК, полученного из препарата РНК 93-летнего донора, идентично последовательности кДНК прогерина (рис. 1В), демонстрируя, что транскрипт прогерина, ранее идентифицированный как аберрантный продукт ламина А в HGPS, может представлять собой истинную физиологическую изоформу ламина А. Другой минорный фрагмент кДНК, мигрирующий чуть выше продукта прогерина, был обнаружен во всех образцах кожи и идентифицирован как дельта-10-изоформа ламина А [40].

Рисунок 1. Экспрессия прогерина в коже человека.

A, ОТ-ПЦР-анализ клеток HGPS и биоптатов кожи человека указанного возраста, праймеры, амплифицирующие транскрипты дикого типа и прогерина. B, прямое секвенирование короткой части экзона 11 ламина A дикого типа (LMNA) и транскриптов прогерина от HGPS и 93-летних субъектов. C, Вестерн-блот-анализ белка, выделенного из биоптатов кожи указанного возраста, с антителами против прогерина 972S9, против ламина A/C и против актина.

https://дои.org/10.1371/journal.pone.0001269.g001

Повсеместное присутствие низкого уровня мРНК прогерина в коже человека также предполагает, что белок, если он присутствует, будет экспрессироваться на очень низком уровне. Ранее мы создали кроличье поликлональное антитело, специфичное к ламину A G608G (прогерин) [30]. Этот предыдущий поликлональный антипрогерин не обнаруживал прогерин в нормальной ткани, и, чтобы исключить возможность того, что антитело имеет низкую аффинность или что распознанный эпитоп может быть замаскирован, мы создали кроличье моноклональное антитело, используя тот же пептид, что и антиген, как описано. в материалах и методах [30].Были иммунизированы три кролика. Сыворотка кролика 972 специфически распознавала белок прогерин и не давала сигнала с ламином А-типа, включая преламин А (данные не показаны). Лимфоциты, полученные из селезенки, выделенные из кролика 972, использовали для создания гибридом (Epitomics, Inc.; Burlingame, CA, USA). Один клон, 972S9, был выбран на основе его специфической реакции на прогерин и использован в этом исследовании. Мы проверили 40 биопсий кожи разного возраста на экспрессию прогерина с помощью вестерн-блоттинга, и, как показано в репрезентативном блоте, небольшое количество белка прогерина присутствовало в образцах кожи, полученных от пожилых людей (рис. 1С). Прогерин не был обнаружен в белковых экстрактах, полученных из молодой взрослой кожи в наших экспериментальных условиях, но низкие уровни экспрессии были четко обнаружены в образцах, полученных из старой кожи, и, по-видимому, немного увеличивались с увеличением хронологического возраста донора (рис. 1C).

Нормальные фибробласты, сверхэкспрессирующие прогерин, резюмируют клеточный фенотип HGPS

Мы установили первичные культуры фибробластов из биоптатов кожи здоровых людей в разном возрасте (таблица 1).Первичные культуры фибробластов получали двумя разными способами: либо путем роста эксплантата, либо путем ферментативной диссоциации дермы [41]. Анализы непрямой иммунофлуоресценции проводили с моноклональными антителами против прогерина на культурах фибробластов при раннем удвоении популяции (PPD). Культуры HGPS ниже 25 PPD показали, что 27% ядер были прогерин-позитивными. В первичных культурах фибробластов здоровых людей несколько ядер показали положительное окрашивание (рис. 2А). Независимо от метода, использованного для их создания, культуры, полученные от молодых субъектов (от 22 до 30 лет), показали менее 0.01% прогерин-положительного окрашивания, в то время как культуры, полученные от пожилых людей, показали в среднем от 0,3% до 0,8% прогерин-положительных ядер на ранних стадиях PPD. Прогерин-положительные клетки от нормальных людей показали ядерные аномалии, подобные наблюдаемым в фибробластах HGPS (рис. 2А). Ядерные пузыри, инвагинации ядерной оболочки, двуядерные клетки и большие ядра, напоминающие аномальный выход из клеточного цикла, наблюдались во всех культурах, полученных от пожилых людей, как недавно сообщалось [39].

Рисунок 2. Экспрессия прогерина в первичных культурах дермальных фибробластов.

A, Иммунофлуоресцентная микроскопия первичных кожных фибробластов от субъекта HGPS и здоровых лиц указанного возраста с кроличьим моноклональным антителом против прогерина. B, Иммунофлуоресцентное обнаружение прогерина в HGADFN 127 (индивидуум HGPS) и DR118 (86-летний индивидуум) на поздних стадиях PPD. C, Вестерн-блот-анализ экстрактов ядерных белков, полученных из культур фибробластов. HGADFN 127 (HGPS) при PPD 20 и DR118 (86-летняя женщина) при PPD 15 и 30, соответственно, были иммунопреципитированы с антипрогериновым mAb 972S9 и соответствующим Вестерн-блоттинг проводили с тем же антителом.

https://doi.org/10.1371/journal.pone.0001269.g002

Когда культуры фибробластов подвергались серийному пассированию до конца срока их жизни, клетки HGADFN 127 (HGPS) прекращали рост, когда они достигали примерно 40–45 PPD. в условиях нашей культуры. Анализы непрямой иммунофлуоресценции с антипрогериновым кроличьим mAb 972S9 в культурах HGPS показали в среднем 27% прогерин-позитивных ядер при ранних PPD, тогда как ближе к поздним PPD (выше 35) почти 90% клеток были прогерин-позитивными (рис. 2B). ).Когда аналогичные исследования были проведены с нормальными культурами фибробластов, мы заметили, что количество клеток, положительно меченных антителами против прогерина, немного увеличивалось с возрастом клеток in vitro. В качестве примера, культура фибробластов DR118, полученная от 86-летней женщины, подвергалась мониторингу с помощью непрямой иммунофлуоресценции с mAb против прогерина и показала в среднем 0,4% прогерин-позитивных клеток в молодых культурах. Это среднее значение увеличилось до 0,8% в поздних культурах (PPD от 30 до 35). Вестерн-блот-анализ экстрактов общего белка, выделенных из первичных культур фибробластов, полученных от взрослых и пожилых людей, не показал сигнала прогерина при зондировании с антипрогериновым mAb, в то время как прогерин был легко обнаружен в клеточных экстрактах общего количества HGPS на ранних стадиях PPD (данные не показаны).Ранее мы сообщали, что прогерин накапливается в фибробластах HGPS в зависимости от клеточного возраста [30]. Чтобы дополнительно проверить, могут ли нормальные фибробласты накапливать прогерин аналогично аналогу HGPS, мы провели анализы иммунопреципитации с mAb против прогерина с использованием препарата ядерного экстракта. Иммунопреципитацию прогерина проводили на выделенных препаратах ядер в среднем из 6×10 6 нормальных клеток пожилых людей на ранних и поздних ППД (рис. 2С). Вестерн-блот-анализы иммунопреципитированных материалов снова исследовали с помощью mAb против прогерина. Как показано на рисунке 2C, низкое количество прогерина может быть обнаружено на поздних PPD в репрезентативной культуре фибробластов, DR118, которая была получена от 86-летней женщины (рис. 2C).

В совокупности эти результаты показывают, что низкие уровни белка прогерина присутствуют в коже пожилых людей, а также в первичных культурах дермальных фибробластов, полученных от этой популяции субъектов.Важно отметить, что прогерин, по-видимому, накапливался в нормальных культурах фибробластов в зависимости от клеточного возраста, но оставался относительно низким по сравнению с количеством прогерина, накапливающимся в культурах HGPS [29], [30].

Профилирование белка прогерина in vivo в биоптатах кожи, полученных от HGPS и здоровых людей, с использованием моноклонального антитела против прогерина

Чтобы получить представление о функциональном влиянии изоформы прогерина, мы исследовали биопсии кожи человека, чтобы определить клеточное распределение прогерина in vivo . В срезах кожи, полученных от 9-летнего субъекта с HGPS (HGADFN143), мы ранее показали, что прогерин был локализован в ядрах сосудистых клеток и в ядрах по всей дерме [30]. Используя моноклональные антипрогериновые антитела, мы повторно проанализировали срезы того же образца HGPS. Прогерин был обнаружен в ядрах дермы, кровеносных сосудах, мышце, выпрямляющей волосы, и клетках, окружающих потовые железы (рис. 3А). Кроме того, прогерин был обнаружен в ядрах кератиноцитов в самых верхних слоях эпидермиса и локализован в виде толстого ободка на ядерной оболочке.Это распределение указывает на то, что подмножество терминально дифференцированных кератиноцитов накапливает прогерин в HGPS (Fig. 3A).

Рисунок 3. Локализация прогерина in situ на срезах кожи человека, полученных от субъекта с HGPS и от здоровых людей.

A, срезы кожи HGPS, иммуноокрашенные антителами против прогерина (prog), антителами против ламина A (LMNA) или антителами против α-актина гладких мышц (αSMA) и контрастно окрашенными ДНК-окрашиванием (dapi). Обозначены морфологические образования: эпидермис (ep), дерма (de), потовые железы (SG), капилляр (c), мышца, выпрямляющая волоски (a), и волосяной фолликул (h).B — срезы крайней плоти новорожденных, иммуномеченые антителами против прогерина или αSMA. C. Срезы кожи груди 22- и 46-летних женщин, обработанных антипрогерином и ламином А. Указаны соответствующие двойные или тройные объединенные сигналы.

https://doi.org/10.1371/journal.pone.0001269.g003

Поскольку низкие уровни мРНК прогерина были обнаружены в препаратах общей мРНК кожи в любом возрасте (рис. 1А), а низкие количества белка были обнаружены в коже пожилых людей экстракты (рис.1C), мы предположили, что прогерин будет присутствовать на низком уровне или только в нескольких клетках. Мы провели иммуногистохимию срезов, полученных из крайней плоти новорожденных, и шестидесяти биоптатов кожи с разных участков тела (таблица 1) у субъектов в возрасте от 22 до 93 лет. Репрезентативные закономерности локализации прогерина показаны на рисунках 3 и 4. Крайняя плоть новорожденных не проявляла сигнала с mAb против прогерина, в то время как все ядра демонстрировали положительный сигнал с антителами против ламина A (рис. 3C, панель LMNA). Мы отметили, что верхняя часть дермы на серийных срезах крайней плоти была сильно васкуляризирована; многочисленные сосудистые петли были помечены антителами против α-актина гладких мышц (αSMA) (рис.3Б). Скрининг пяти биоптатов крайней плоти не выявил прогерина ни в одном отделе кожи. Срезы кожи молочной железы 22-летней женщины показали несколько прогерин-позитивных ядер вблизи базальной мембраны и в сосочковом слое дермы (рис. 3С). В срезах кожи молочной железы 46-летней женщины было обнаружено большее количество прогерин-позитивных ядер, рассеянных по папиллярной дерме (рис. 3С).

Срезы лба 69-летнего мужчины показали прогерин-положительные ядра в основном в верхних слоях дермы (рис.4А). Срезы кожи со лба 93-летней женщины показали высокую плотность прогерин-позитивных ядер в верхней и нижней части дермы (рис. 4В). Аналогичная картина распределения прогерина была обнаружена в срезах кожи с разных участков тела (рис. 4С), включая руки (60 лет), ноги (85 лет) и волосистую часть головы (90 лет). Прогерин был обнаружен как сильное окрашивание ядерной оправы в фибробластах, расположенных в верхнем, среднем и глубоком отделах дермы у пожилых людей (рис. 4B и 4C), в то время как у молодых людей несколько фибробластов, накапливающих прогерин, были локализованы в папиллярной дерме близко к базальная мембрана.С возрастом количество положительных клеток увеличивалось в верхних слоях дермы и постепенно распространялось все глубже, создавая градиент прогерин-позитивных фибробластов от базальной мембраны к ретикулярной дерме. Кожа, полученная как с участков, подвергшихся воздействию солнца, так и с участков, не подвергавшихся воздействию, имела сходное распределение прогерин-позитивных фибробластов (рис. 3 и 4).

Рисунок 4. Накопление прогерина в срезах биопсии кожи человека пожилого возраста.

A, Срез кожи лба 69-летнего человека, зондированный антителами против прогерина и контрастно окрашенный дапи. Столбики соответствуют 100 и 50 мкм соответственно. B, Срез кожи лба от 93-летнего донора. С. Срезы кожи с разных участков тела, как указано, исследовали с помощью антител против прогерина и ламина А (LMNA). Пруток, 50 мкм. Обозначаются объединенные изображения.

https://doi.org/10.1371/journal.pone.0001269.g004

Прогерин был обнаружен в субпопуляции терминально дифференцированных кератиноцитов в некоторых биоптатах кожи, взятых у пожилых людей

В подавляющем большинстве протестированных здесь биоптатов здоровой кожи прогерин не был обнаружен в эпидермисе, как показано на рисунках 3–4.Однако в некоторых биоптатах кожи, взятых у лиц в возрасте от 70 до 95 лет, в эпидермисе был обнаружен положительный сигнал прогерина. Репрезентативные примеры срезов кожи, демонстрирующих прогерин-положительный сигнал в эпидермисе, показаны на рисунке 5. Когда прогерин был обнаружен в эпидермисе пожилых людей, только несколько кератиноцитов на срез были положительно помечены антипрогериновыми моноклональными антителами в самых верхних слоях эпидермиса и сигнал никогда не был таким ярким, как у дермальных фибробластов (рис. 5). Срезы кожи 76- и 95-летних женщин показали наибольшее количество положительно меченых кератиноцитов в зернистом слое эпидермиса (рис. 5). Однако прогерин-позитивные кератиноциты не были равномерно распределены по всей длине эпидермиса на срезах, а были локализованы в пределах небольшой площади. В большинстве срезов кожи пожилых людей спорадически наблюдали от одного до трех кератиноцитов в самом верхнем слое эпидермиса, как показано на срезе кожи 86-летнего мужчины (рис.5). В этих терминально дифференцированных клетках прогериновый сигнал был локализован в виде ободкообразной структуры на периферии ядра (Fig. 5). В целом сигнал прогерина был слабым по сравнению с сильным сигналом, полученным в дермальных фибробластах.

Рисунок 5. Обнаружение прогерина в подмножестве терминально дифференцированных кератиноцитов.

Левые панели соответствуют окрашиванию моноклональными антителами против прогерина срезов кожи, полученных от лиц указанного возраста. Правые панели соответствуют объединенному сигналу сигналов дапи и прогерина. Квадрат указывает на увеличенную область эпидермиса. ep обозначает эпидермис, а de — дерму.

https://doi.org/10.1371/journal.pone.0001269.g005

Эти результаты указывают на то, что прогерин накапливается в терминально дифференцированных кератиноцитах, локализованных в слоях ближе к поверхности кожи. Кроме того, прогерин-положительные кератиноциты демонстрировали окрашивание толстого ядерного края, что снова напоминает окрашивание, наблюдаемое у прогерин-положительных кератиноцитов из срезов кожи HGPS (рис.3А). Поскольку только очень немногие кератиноциты из верхнего эпидермиса были помечены антипрогериновым антителом, мы не могли исключить возможность маскирования эпитопов, которое часто встречается при обнаружении ламина. Мы использовали разные методы фиксации в сочетании с разными процедурами пермеабилизации, но окрашивание оставалось неизменным (данные не показаны). Распределение и локализация нескольких прогерин-позитивных кератиноцитов соответствовали наблюдениям за срезами кожи пациента с HGPS (рис. 3А). Как и в кератиноцитах HGPS, нормальные кератиноциты окончательно дифференцировались, что определялось их расположением в самом верхнем слое зернистого слоя [42]. Кроме того, эти прогерин-положительные кератиноциты демонстрировали идентичное окрашивание в виде ободка на периферии ядерной оболочки. В то время как прогерин-положительный сигнал спорадически обнаруживался в кератиноцитах межфолликулярной дермы, в различных эпидермальных придатках и сосудистой системе сигнал не обнаруживался независимо от участка тела или возраста донорского образца в наших экспериментальных условиях.

Обсуждение

Эти данные впервые показывают, что спорадическое использование скрытого сайта сплайсинга в экзоне 11 LMNA происходит in vivo в нормальных клетках, однако этот сайт гораздо более активен в клетках HGPS, несущих LMNA Мутация G608G. Транскрипты мРНК прогерина были обнаружены на очень низком уровне во всех образцах кожи здоровых людей и оставались довольно постоянными во всех возрастах (рис. 1). Аналогичное наблюдение было ранее сообщено с использованием культур фибробластов, полученных от здоровых людей [38].

В то время как мРНК прогерина может быть обнаружена на одинаковых уровнях с помощью анализа ОТ-ПЦР во всех образцах тканей, белок, по-видимому, накапливается с возрастом. Вестерн-блот-анализ позволил обнаружить низкие уровни прогерина в образцах кожи пожилых людей (рис. 1С), но белок был ниже предела обнаружения в молодых образцах. В биоптатах кожи молодых людей прогерин либо отсутствовал, либо присутствовал только в небольших количествах, так как не определялся методом непрямой иммунофлюоресценции (рис.3). С возрастом, сопровождающимся изменениями дермального компартмента (такими как дезорганизованная соединительная ткань), прогерин накапливается в клетках кожи, но ограничивается определенными типами клеток, в первую очередь дермальными фибробластами и окончательно дифференцированными кератиноцитами. Таким образом, прогерин-позитивные клетки не были случайно распределены в коже (рис. 3-5). В дерме прогерин-позитивные фибробласты сначала появляются на базальной мембране, а с возрастом их количество увеличивается и распространяется по всей дерме (рис.3 и 4).

Дермальные фибробласты являются основным типом клеток дермы и представляют собой гетерогенную популяцию клеток, основанную на различиях в потенциале пролиферации и синтезе белков внеклеточного матрикса [43]. Наши результаты показывают, что популяция прогерин-позитивных фибробластов может характеризовать возможный фенотип терминальной дифференцировки дермальных фибробластов in vivo . В поддержку этого наблюдения наши результаты показывают, что прогерин-позитивные клетки не распределяются в дерме случайным образом, а появляются возрастным образом на базальной мембране и постепенно распространяются по всему дермальному компартменту (рис.3 и 4). Более того, в то время как большое количество прогерин-позитивных клеток было обнаружено в биоптатах кожи пожилых людей, лишь некоторые из них были обнаружены в соответствующих культурах фибробластов (рис. 2), что позволяет предположить, что прогерин-позитивные клетки могли достичь терминальной стадии. остановку роста и, таким образом, не могли размножаться в культуре. Однако в культурах на поздних пассажах их количество несколько увеличивалось, что свидетельствует о накоплении прогерина в клетках, вступивших в стадию терминальной дифференцировки или старения.

Мы и другие ранее сообщали, что накопление прогерина в клетках HGPS происходит в зависимости от клеточного возраста [29], [30]. Более того, накопление прогерина оказывает негативное влияние на ход клеточного цикла и вызывает снижение миграции фибробластов HGPS [30], [39]. В целом эти данные указывают на то, что прогерин-позитивные фибробласты in vivo могут определять субпопуляцию фибробластов, достигших терминальной дифференцировки и/или старения.

Эпидермис представляет собой самообновляющийся многослойный эпителий, в основном состоящий из кератиноцитов, которые проходят сложную и динамичную программу терминальной дифференцировки на протяжении всей жизни [44]. Этот процесс начинается, когда пролиферирующие кератиноциты базального слоя перемещаются вверх к супрабазальным слоям и постепенно приобретают способность последовательно экспрессировать специфические генные продукты, необходимые для дифференцировки [45]. Терминально дифференцированные кератиноциты зернистого слоя находятся в переходной стадии на пути к формированию ороговевшего слоя эпидермиса [44]. Этот переход сопровождается элиминацией всех органелл, включая ядра, и изменением функций цитоплазмы.Эти клеточные события позволяют производить самый внешний эпидермальный слой, состоящий из уплощенных, лишенных ядер, мертвых ороговевших клеток (корнеоцитов), которые обеспечивают барьерную функцию кожи [44]. Поразительно, но именно в этом переходном эпителиальном слое прогерин появляется в небольшом подмножестве кератиноцитов. Эти клетки не только достигли конечной дифференциации, но и вот-вот вытеснят свои ядра, и поэтому их можно считать достигшими конца своей жизни. Такая терминальная дифференцировка и переходные стадии между ядерными и энуклеированными клетками должны подразумевать не только важную перестройку ядра, но также должны подразумевать крупномасштабную реорганизацию генома, направленную на выключение экспрессии генов, которая больше не требуется. Такое ремоделирование состава ядерной ламины и изменения в эпигенетических метках гетерохроматина для подавления экспрессии генов и общей организации хроматина д. синергетически и активно участвовать в установках исключения ядра. Мы предполагаем, что во время этой последней стадии терминальной дифференцировки кератиноциты должны были достичь конца своей продолжительности жизни in vivo и могут рассматриваться как стареющие клетки [46], [47].

Репликативное старение представляет собой перманентное состояние остановки пролиферации [48].Терминальная дифференцировка определяет клетки, которые навсегда выходят из клеточного цикла в процессе приобретения функциональной специализации. Обе клеточные стадии имеют некоторые общие свойства, включая стабильную остановку клеточного цикла, уплощенную и увеличенную морфологию, увеличение цитоплазматических ферментативных пузырьков и изменения в конденсации хроматина и в паттернах экспрессии генов [49], [50].

Прогерин связан с патогенезом HGPS и оказывает токсическое ядерное действие, поскольку он постоянно остается фарнезилированным [18]. Клетки, полученные от субъектов с HGPS, демонстрируют дисморфические ядра со значительными изменениями формы ядра, включая инвагинации ядерной оболочки, утолщение ядерной пластинки, потерю периферического гетерохроматина и скопление ядерных пор [29], [30]. Изменения в составе белков ламины, по-видимому, ответственны за разрушение и потерю периферического хроматина в клетках HGPS и связаны с нарушением эпигенетических гистоновых маркеров и нестабильностью генома [34].

Наши результаты расширяют эти предыдущие исследования, показывая динамические изменения в составе ядерной ламины с включением «возрастной» ламиновой изоформы прогерина в процессе дифференцировки кератиноцитов in vivo .Мы предполагаем, что, аналогично процессу, который происходит в клетках HGPS, накопление прогерина в ядерной пластинке в нормальных клетках способствует делокализации кластеров гетерохроматина вдали от ядерной периферии, тем самым способствуя крупномасштабной деконденсации генома. допускают геномную реорганизацию. Эта реорганизация необходима для обеспечения терминальной дифференцировки и/или старения. Наконец, связь между накоплением прогерина и терминальной дифференцировкой и/или старением в нормальных клетках предполагает, что в контексте клеток HGPS накопление прогерина может вызвать аномальную дифференцировку и раннее старение, что приведет к преждевременному истощению пула митотических клеток с потенциалом обновления от ткани и вызывают клинические последствия, характерные для старческого возраста.

Поскольку прогерин, по-видимому, является биомаркером клеточного старения для дермальных фибробластов и кератиноцитов здоровых людей in vivo , мы пришли к выводу, что HGPS действительно может быть полезной моделью, с помощью которой можно больше узнать о нормальном старении. Терапевтические стратегии, уже протестированные на клетках HGPS, такие как ингибиторы фарнезилтрансферазы, могут быть даже полезны для предотвращения нормального старения и, возможно, замедления прогрессирования других возрастных патологий.

Материалы и методы

Производство и характеристика кроличьего моноклонального антитела G608G против ламина А

Рамка считывания аминокислотной последовательности ламина A G608G была определена ранее [27], [51].Чтобы создать специфическое антитело G608G против ламина А, мы выбрали короткий пептид, перекрывающий область, где произошла внутренняя делеция из 50 аминокислот в мутантной последовательности G608G ламина А, как описано ранее [30]. Трех кроликов иммунизировали пептидом по стандартному протоколу, выполненному Covance ImmunoTechnologies (Денвер, Пенсильвания, США). Преиммунные и иммунные сыворотки характеризовали вестерн-блоттингом и непрямой иммунофлуоресценцией на клетках HGPS и контрольных фибробластах. Сыворотка кролика 972 специфически распознавала белок прогерин и не давала сигнала с ламином А-типа или преламином А.Селезенка кролика Covance 972 была отправлена ​​в компанию Epitomics, Inc (Берлингейм, Калифорния, США). Лимфоциты выделяли из селезенки и проводили слияние в соответствии со стандартным протоколом Epitomics. Отбирали положительные гибридомы, и супернатанты первичных клонов и последующих субклонов подвергали скринингу с помощью вестерн-блоттинга и анализа непрямой иммунофлуоресценции с использованием контроля и дермальных фибробластов HGPS, обработанных или необработанных FTI, как описано ранее [30]. Один клон, 972S9, был выбран на основе его специфической реакции на прогерин и использован в этом исследовании.

Срезы биопсии кожи человека и первичные культуры дермальных фибробластов

Биопсия нормальной кожи и крайняя плоть новорожденного были получены в дерматологической клинике в соответствии с советом по этике исследований в области здравоохранения Колумбийского университета. Биопсии взяты из разных участков тела и были получены от равного количества мужчин и женщин. Регистрировали пол, возраст и местонахождение тела каждого донора (таблица 1). Биоптаты кожи заливали в среду Optimum Cooling Temperature (O.C. T.) и криоконсервированные для срезов тканей. Готовили серийные срезы замороженной кожи толщиной 6 мкм и хранили при температуре -80°C. Кроме того, небольшие кусочки были быстро заморожены в жидком азоте во время их сбора для выделения мРНК и белков. Первичные культуры дермальных фибробластов были созданы с использованием культуры эксплантов или ферментативного расщепления кожи, как описано ранее [41].

Вкратце, ткань кожи промывали в PBS и инкубировали в течение ночи в растворе Dispase II при 4°C. Эпидермис и дерму механически разделяли и получали первичные культуры HDF с использованием эксплантатов или методов ферментативного расщепления дермы.Для культивирования эксплантов кожную часть кожи промывали в PBS с добавлением пенициллина и стрептомицина, разрезали на мелкие кусочки и распределяли на чашке для культивирования. Добавляли культуральную среду DMEM с добавлением 15% эмбриональной бычьей сыворотки. Рост фибробластов начался с 3 по 7 день; кусочки кожи удаляли через неделю и культуры выращивали до 70% слияния. Для культур HDF, полученных путем ферментативной диссоциации кожи, кусочки кожи переносили в раствор коллагеназы I (Worthington Biochemical) в концентрации 200 единиц/мл 1× PBS, включая 0. 3 мМ CaCl 2 . Кусочки выдерживали при 37°С при встряхивании от 1 до 4 часов, пока они не переваривались. Затем раствор с фрагментами дермы разбавляли в 5 раз полной средой DMEM (15% FBS, 1% пенициллин-стрептомицин, 1% L-глутамин), пропускали через клеточный фильтр 70 мкм (BD Falcon) и центрифугировали. Осадок клеток ресуспендировали в полной среде, клетки высевали, выращивали до 70-80% слияния и криоконсервировали при -80°C.

Биопсия кожи HGPS и клетки дермальных фибробластов

Дермальные фибробласты, полученные от пациентов с HGPS, несущих мутацию LMNA G608G (HGADFN001, HGADFN003 и HGADFN127), выращивали, как описано ранее [30].Исследовательский фонд Progeria любезно предоставил клетки HGPS и замороженные срезы кожи, полученные из биопсии кожи 9-летнего донора с HGPS, несущего мутацию LMNA G608G (HGADFN143).

Одноэтапная обратная транскрипция/полимеразная цепная реакция (RT-PCR)

Суммарная РНК была выделена из кусочков биопсии кожи с использованием набора для выделения РНК, рекомендованного производителем (QIAGEN). 1 мкг РНК из каждого образца подвергали одноэтапной ОТ-ПЦР (OneStep RT-PCR, QIAGEN) с использованием праймеров, расположенных в экзонах 9 и 12 ламина А (прямой праймер: 5′ GGCTGCGGGAACAGC 3′ и обратный праймер: 5′ CTGGCAGGTCCC 3′), описанный ранее [38], вместе с праймерами, расположенными в изоформе β-актина человека (прямой: CCCAGCACAATGAAGATCAA и обратный GTGTAACGCAACTAAGTCAT) в качестве внутреннего контроля.50 мкл реакционной смеси подвергали обратной транскриптазе в течение 30 минут при 50°С, после чего проводили стадию активации ПЦР при 95°С в течение 15 минут. Условия ПЦР составляли 35 циклов, каждый из которых состоял из 30-секундной денатурации при 94°С, 30-секундного отжига при 55°С и 30-секундной полимеризации при 72°С. 15 мкл реакционной смеси анализировали на 2% агарозном геле и окрашивали бромистым этидием.

Непрямая иммунофлуоресценция

Первичные культуры дермальных фибробластов пациентов и контрольной группы обрабатывали для непрямой иммунофлуоресценции, как описано ранее [51]. Были приобретены мышиные антитела против ламина A Jol4 (Serotec) или клон 133A2 (abcam), антитела против ламина A/C 131C3 (abcam) и антитела против α-актина гладкой мускулатуры человека, клон 1A4 (DakoCytomation). Вторичные антитела представляли собой аффинно очищенные козьи или ослиные IgG-антитела Alexa Fluor 488 (Molecular Probes) и Cy3-конъюгированные IgG-антитела (Jackson ImmunoResearch Laboratories). Все образцы также были контрастно окрашены DAPI (Sigma-Aldrich).

Иммуногистохимию проводили на замороженных срезах размером 6 мкм, фиксированных метанолом/ацетоном (1V/1V) при -20°C в течение 10 минут и промытых в PBS, затем заблокированных в PBS-буфере, содержащем 3% BSA, 10% нормальной козьей сыворотки и 0.3% Triton X-100 на 30 минут и 1 час в том же буфере без Triton X-100. Предметные стекла инкубировали с моноклональным антителом против прогерина в течение 1 часа. После 6 промывок в блокирующем буфере предметные стекла инкубировали с аффинно очищенными ослиными антителами IgG, конъюгированными с Су3, против кроличьих. Предметные стекла промывали в блокирующем буфере и в PBS, затем помещали в среду для заливки Vectashield (Vector Inc.)

.

Вестерн-блот анализ

Ткани кожи экстрагировали буфером для цитоскелета (CSK) (100 мМ NaCl, 300 мМ сахарозы, 10 мМ PIPES (pH 6.8), 3 мМ MgCl 2 , 0,5% тритон Х-100) и ингибиторы протеазы (Roche) в течение 15 минут на льду. Кусочки кожи измельчали ​​и гомогенизировали с помощью PowerGen 125 (Fisher Scientific) в буфере CSK. Нерастворимый материал расщепляли в буфере PBS, содержащем 100 мкг/мл ДНКазы I и 100 мкг/мл РНКазы А (Sigma), в течение 20 минут при 20°С; после центрифугирования оставшийся осадок ресуспендировали в буфере для образцов Лэммли (BioRad) и кипятили 5 минут при 95°С. Равные количества экстрактов были загружены параллельно на 7.5% полиакриламидный гель. После разделения электрофорезом белки переносили на нитроцеллюлозные мембраны и инкубировали с блокирующим буфером, как описано ранее [30]. Мембраны инкубировали с первичными антителами (Ab 972S9, антитело против ламина A/C, любезно предоставленное доктором Н. Чаудхари, антитело против актина (Sigma)), промывали и затем инкубировали с соответствующим вторичным антителом, связанным с пероксидазой хрена (Jackson Иммуноисследовательские лаборатории). Белки визуализировали с помощью системы детекции усовершенствованной хемилюминесценции (Amersham Pharmacia Biotech).

Вестерн-блот-анализ экспрессии прогерина в нормальных культурах фибробластов, полученных от 86-летней женщины, был выполнен после иммунопреципитации экстракта ядер, приготовленного из раннего (PPD 15) и позднего удвоения популяции (от 30 до 35 PPD). Ядра выделяли из осадка нормальных клеток, содержащего в среднем 6×10 6 клеток, и из осадка клеток HGPS, содержащего 2×10 6 клеток на ранней стадии PPD (ниже 25), в буфере А (10 мМ HEPES ( рН 7,9), 1,5 мМ MgCl 2 , 10 мМ KCL) с добавлением таблетки коктейля ингибитора протеазы (Roche Applied Science).После 10-минутной инкубации на льду препарат гомогенизировали путем 25 ударов с последующим 10-минутным центрифугированием при 800g при 4°С. Осадки ядер ресуспендировали в буфере RIPA с добавлением ингибиторов протеазы, кратковременно обрабатывали ультразвуком на льду и центрифугировали при 4°C. Экстракты инкубировали с 10 мкг очищенного 972S9 IgG (кроличьего моноклонального антитела к прогерину) в течение 4 часов при 4°С; Добавляли 30 мкл сефарозы протеина А, уравновешенной в буфере RIPA, и экстракты инкубировали еще час при 4°С.После четырех промывок в буфере RIPA и двух промывок в PBS осадки IP ресуспендировали в 50 мкл буфера для образцов Laemmli (BioRad), разделяли на гелях SDS-PAGE и переносили на нитроцеллюлозу. Вестерны зондировали кроличьим mAb 972S9 против прогерина и дополнительно обрабатывали, как описано выше.

Благодарности

Мы хотели бы поблагодарить доктора Х. Башира, Х. Кима, К. Цао, А. Энгельгарда, А. Пантелеева и К. Джаходу за стимулирующие дискуссии.

Авторские взносы

Задумал и спроектировал эксперименты: К.Д.Выполнены опыты: КД ДМ МЛ. Проанализированы данные: ФК КД ДМ ДР ЛГ. Предоставленные реагенты/материалы/инструменты для анализа: FC KD DM DR DO LG. Написал статью: КД. Прочее: Оказала важную помощь в доработке рукописи: LG DR FC.

Каталожные номера

  1. 1. Aebi U, Cohn J, Buhle L, Gerace L (1986) Ядерная пластинка представляет собой сеть филаментов промежуточного типа. Природа (Лондон) 323: 560–564.
  2. 2. Хатчинсон С.Дж., Уорман Х.Дж. (2004) Ламины типа А: хранители сомы? Биология клеток природы 6: 1062–1067.
  3. 3. Lin F, Worman HJ (1995)Структурная организация гена человека (LMNB1), кодирующего ядерный ламин B1. Геномика 27: 230–236.
  4. 4. Виднер К.Л., Макнейл Дж.А., Лин Ф., Уорман Х.Дж., Лоуренс Дж.Б. (1996)Хромосомное присвоение генов белков ядерной оболочки человека LMNA, LMNB1 и LBR путем флуоресцентной гибридизации in situ. Геномика 32: 474–478.
  5. 5. Furukawa K, Hotta Y (1993) Клонирование кДНК ламина B3, специфичного для зародышевых клеток, из сперматоцитов мыши и анализ его функции путем эктопической экспрессии в соматических клетках. Журнал EMBO 12: 97–106.
  6. 6. Робер Р.А., Вебер К., Осборн М. (1989)Дифференциальное время экспрессии ядерного ламина A/C в различных органах эмбриона мыши и молодого животного: исследование развития. Развитие 105: 365–378.
  7. 7. Benevente R, Krohne G, Franke W (1985) Специфическая для клеточного типа экспрессия белков ядерной пластинки во время развития xenopus laevis. Ячейка 41: 177–190.
  8. 8. Stick R, Hausen P (1985) Изменения в составе ядерной пластинки во время раннего развития Xenopus laevis.Ячейка 41: 191–200.
  9. 9. Lenher CF, Stick R, Eppenberger HM, Nigg EA (1987)Дифференциальная экспрессия белков ядерного ламина во время развития цыплят. Журнал клеточной биологии 105:
  10. 10. Бриджер Дж. М., Килл И. Р., О’Фаррелл М., Хатчинсон С. Дж. (1993) Внутренние ламиновые структуры в ядрах G1 дермальных фибробластов человека. Журнал клеточной науки 104: 297–306.
  11. 11. Hozak P, Sasseville AMJ, Raymond Y, Cook PR (1995) Ламиновые белки образуют внутренний нуклеоскелет, а также периферическую пластинку в клетках человека. Журнал клеточной науки 108: 635–644.
  12. 12. Shumaker DK, Kuczmarski ER, Goldman RD (2003)Нуклеоскелет: ламины и актин играют важную роль в основных ядерных функциях. Текущее мнение по клеточной биологии 15: 358–366.
  13. 13. Синенский М., Фантл К., Трухильо МТМ, Купфер А. и др. (1994) Путь процессинга преламина А. Journal of Cell Science 107: 61–67.
  14. 14. Young SG, Meta M, Yang A, Fong LG (2006) Фарнезилирование преламина А и прогероидные синдромы.Журнал биологической химии 281: 39741–39745.
  15. 15. Corrigan DP, Kuszczak D, Rusinol AE, Thewke DP, Hrycyna CA, et al. (2005) Эндопротеолитическая обработка преламина А in vitro с помощью рекомбинантного Zmspte24. Биохимический журнал 129–138.
  16. 16. Ранкин Дж., Эллард С. (2006)Ламинопатии: клинический обзор. Клиническая генетика 70: ​​261–274.
  17. 17. Worman HJ, Bonne G (2007) «ламинопатии»: широкий спектр заболеваний человека. Experimental Cell Research 313: 2121–2133.
  18. 18. Capell BC, Collins FS (2006)Ламинопатии человека: генетически ошибочные ядра. Nature Review Genetics 7: 940–952.
  19. 19. Yu CE, Oshima J, Fu YH, Wijsman EM, Hisama F, et al. (1996) Позиционное клонирование гена синдрома Вернера. Наука 272: 258–262.
  20. 20. Csoka AB, Cao H, Sammak JP, Constantinescu D, Schatten GP, ​​et al. (2004)Новые мутации гена ламина A/C (LMNA) при атипичных прогероидных синдромах. Журнал медицинской генетики 41: 304–308.
  21. 21. Пласилова М., Чаттопадьяй С., Пал П., Шауб Н.А., Бюхнер С.А. и соавт. (2004)Гомозиготная миссенс-мутация в гене ламина A/C вызывает аутосомно-рецессивный синдром прогерии Хатчинсона-Гилфорда. Журнал медицинской генетики 41: 609–614.
  22. 22. Cao H, Hegele RA (2003) LMNA мутирует при прогерии Хатчинсона-Гилфорда (MIM 176670), но не при прогероидном синдроме Видемана-Раутенштрауха (MIM 264090). Журнал генетики человека 48: 271–274.
  23. 23.Brown WT, Kieras FJ, Houck GE, Dutkowski R, Jenkins EC (1985) Сравнение взрослых и детских прогерий: синдром Вернера и синдром Хатчинсона-Гилфорда. Передовая экспериментальная медицинская биология 190: 229–244.
  24. 24. Fernandez FP, Mc Laren AT, Slowie DF (1992) Отчет о случае прогерии Хатчинсона-Гилфорда с особым упором на ортопедические проблемы. Европейский журнал детской хирургии 2: 378–382.
  25. 25. Суини К.Дж., Вайс А.С. (1992)Гиалуроновая кислота при прогерии и старческом фенотипе? Геронтология 38: 139–152.
  26. 26. Brown WT (1992) Прогерия: модель болезни человека ускоренного старения. Американский журнал клинического питания 55: 1222S–12124S.
  27. 27. Де Сандре-Джованноли А., Бернар Р., Кау П., Наварро С., Амиэль Дж. и др. (2003) Усечение Lamin A в прогерии Хатчинсона-Гилфорда. Наука 300: 2055.
  28. 28. Эрикссон М., Браун В.Т., Гордон Л.Б., Глинн М.В., Сингер Дж. и др. (2003)Рекуррентные точечные мутации de novo в ламин-А вызывают синдром прогерии Хатчинсона-Гилфорда. Природа (Лондон) 423: 293–298.
  29. 29. Goldman RD, Shumaker DK, Erdos MR, Eriksson M, Goldman AE, et al. (2004)Накопление мутантного ламина А вызывает прогрессивные изменения в ядерной архитектуре при синдроме прогерии Хатчинсона-Гилфорда. Труды Национальной академии наук 101: 8963–8968.
  30. 30. МакКлинток Д., Гордон Л.Д., Джабали К. (2006)Ламин А, мутантный по прогерии Хатчинсона-Гилфорда, в первую очередь нацелен на сосудистые клетки человека, что обнаруживается с помощью антитела G608G против ламина А.Труды Национальной академии наук 103: 2154–2159.
  31. 31. Даль К.Л., Скаффиди П., Ислам М.Ф., Йод А.Г., Уилсон К.Л. и др. (2006) Отличительные структурные и механические свойства ядерной пластинки при синдроме прогерии Хатчинсона-Гилфорда. Труды Национальной академии наук 103: 10271–10276.
  32. 32. Delbarre E, Tramier M, Coppey-Moisan M, Gaillard C, Courvalin J-C, et al. (2006) Усеченный преламин А при синдроме прогерии Хатчинсона-Гилфорда изменяет сегрегацию гомополимеров ламина А-типа и В-типа. Молекулярная генетика человека 15: 1113–1122.
  33. 33. Наварро С.Л., Кадинанос Дж., Де Сандре-Джованноли А., Бернар Р., Курье С. и др. (2005) Потеря ZMPSTE24 (FACE-1) вызывает аутосомно-рецессивную рестриктивную дермопатию и накопление предшественников ламина А. Молекулярная генетика человека 14: 1503–1513.
  34. 34. Шумейкер Д.К., Дешат Т., Кольмайер А., А.Адам С.А., Божовский М.Р. и соавт. (2006)Мутантный ламин А приводит к прогрессивным изменениям эпигенного контроля при преждевременном старении.Труды Национальной академии наук 103: 8703–8708.
  35. 35. Toth JI, Yang SH, Qiao X, Beigneux AP, Gelb MH, et al. (2005)Блокирование протеинфарнезилтрансферазы улучшает форму ядер в фибробластах людей с прогероидными синдромами. Труды Национальной академии наук 102: 12873–12878.
  36. 36. Capell BC, Erdos MR, Madigan JP, Fiordalisi JJ, Varga R, et al. (2005) Ингибирование фарнезилирования прогерина предотвращает характерное ядерное пузырение синдрома прогерии Хатчинсона-Гилфорда. Труды Национальной академии наук 102: 12879–12884.
  37. 37. Лю Б., Ван Дж., Чан К.М., Цзя В.М., Дэн В. и др. (2005)Нестабильность генома при преждевременном старении на основе ламинопатии. Природная медицина 11: 780–785.
  38. 38. Scaffidi P, Misteli T (2006)Зависимые от ламина А ядерные дефекты при старении человека. Наука 312: 1059–1063.
  39. 39. Cao K, Capell B, Erdos MR, Djabali K, Collins FS (2007)Изоформа белка ламина A, сверхэкспрессированная при синдроме прогерии Хатчинсона-Гилфорда, препятствует митозу в прогерии и нормальных клетках.Труды Национальной академии наук 104: 4949–4954.
  40. 40. Machiels BM, Zorenc AHG, Endert JM, Kuijpers HJH, Van Eys GJJM и др. (1996) Альтернативный продукт сплайсинга гена ламина A/C не имеет экзона 10. Journal of Biological Chemistry 271: 9249–9253.
  41. 41. Wang H, Van Blitterswijk CA, Bertrand-de Hass M, Schuurman AH, Lamme EN (2004)Улучшенная ферментативная изоляция фибробластов для создания аутологичных заменителей кожи. Биология развития клеток in vitro 40: 268–277.
  42. 42. Fuchs E (1995)Кератины и кожа. Ежегодный обзор биологии развития клеток 11: 123–153.
  43. 43. Соррелл Дж. М., Каплан А. И. (2004) Неоднородность фибробластов: больше, чем глубоко в коже. Журнал клеточной науки 117: 667–675.
  44. 44. Fuchs E (1990)Эпидермальная дифференциация: самое необходимое. Журнал клеточной биологии 111: 2807–2814.
  45. 45. Volz A, Korge BP, Compton JC, Ziegler A, teinert PM, et al. (2003)Физическое картирование функционального кластера генов эпидермальной дифференцировки на хромосоме 1 q21.Геномика 18: 92–93.
  46. 46. Campisi J (2001)Клеточное старение как механизм подавления опухоли. Тенденции в клеточной биологии 11: 27–31.
  47. 47. Campisi J (2005) Стареющие клетки, подавление опухоли и старение организма: хорошие граждане, плохие соседи. Ячейка 120: 513–522.
  48. 48. Фунаяма Р., Исикава Ф. (2007)Клеточное старение и структура хроматина. Хромосома.
  49. 49. Francastel C, Schubeler D, Martin DI, Groudine M (2000)Ядерная компартментализация и активность экспрессии генов.Nature Reviews Молекулярная клеточная биология 1: 137–143.
  50. 50. Нарита М., М. Нунез С., Херд Э., Нарита М., Лин А.В., Хирн С.А. и соавт. (2003) Rb-опосредованное образование гетерохроматина и молчание генов-мишеней E2F во время клеточного старения. Ячейка 113: 703–716.
  51. 51. Paradisi M, McClintock D, Boguslavsky RL, Pedicelli C, Worman HJ, et al. (2005)Кожные фибробласты при синдроме прогерии Хатчинсона-Гилфорда с мутацией ламина A G608G имеют дисморфические ядра и гиперчувствительны к тепловому стрессу.Центральная клеточная биология BioMed 6: 27.
.

Добавить комментарий

Ваш адрес email не будет опубликован.