Средства для нормализации микрофлоры кишечника: Препараты для восстановления микрофлоры кишечника

Содержание

Кефир улучшает микрофлору кишечника. Научное доказательство

Подпись к фото,

Доктор Майкл Мозли выяснил, что же на самом деле влияет на наши кишки

Может ли пища, которую мы употребляем, улучшить состояние нашего кишечника? Доктор Майкл Мозли решил разобраться, какие продукты и напитки эффективнее улучшают микрофлору.

Кишечный микробиом - то есть тот разнообразный набор бактерий, который населяет наши кишки, - стал в последнее время популярной научной темой.

Практически каждый день можно наткнуться на заголовок, утверждающий, что микробиом, оказывается, воздействует на наше здоровье каким-то новым, еще более удивительным образом - будь то похудение, настроение или же наша способность сопротивляться инфекциям.

Поэтому неудивительно, что супермаркеты и магазины здоровой пищи, учитывая этот возросший интерес к нашей внутренней экосистеме, стали продавать разнообразные пищевые продукты и биологически активные добавки, содержащие живые микрокультуры - пробиотики, которые якобы могут улучшить здоровье наших кишок. Но так ли это на самом деле?

Чтобы это выяснить программа "Верьте мне, я доктор!" ("Trust me, I'm A Doctor") решила провести эксперимент в шотландском городе Инвернесс с помощью местного отделения Национальной службы здравоохранения (NHS Highland) и 30 добровольцев и ученых, собранных со всей страны.

Три группы

Автор фото, Science Photo Library

Подпись к фото,

Одна из важнейших молочнокислых бактерий - Lactobacillus casei, которую можно обнаружить как у нас во рту, так и в кишках

Мы разделили наших добровольцев на три группы и попросили каждую из них в отдельности испробовать на себе в течение четырех недель какой-нибудь один способ из тех, которые вроде бы должны улучшать наш микробиом.

Первая наша группа стала пить продающийся в продуктовых магазинах пробиотический напиток из разряда тех, которые, как правило, содержат одну или две бифидобактерии, способных пережить путешествие через кислотную среду в желудке и попасть непосредственно в кишки.

Вторая группа перешла на кефир, производящийся методом обычного брожения и содержащий набор бактерий и дрожжей.

Третья группа должна была есть еду, богатую инулином - природным полисахаридом, являющимся биологически активной добавкой, пребиотиком.

Пребиотики - это вещества, которые питают "хорошие" бактерии, уже живущие в нашем кишечнике, а инулин содержится в таких продуктах, как топинамбур (земляная груша), корень цикория, лук, чеснок и лук-порей.

Стакан кефира вместо?

Автор фото, iStock

Подпись к фото,

Земляная груша является полезным пребиотиком

В конце своего эксперимента мы обнаружили удивительную вещь.

У группы, которая пила пробиотический напиток, немного прибавилось бактерии, которая хорошо влияет на поддержание веса - Lachnospiraceae, хотя эти изменения были статистически незначимы.

Две другие группы продемонстрировали более заметные изменения.

Группа, употреблявшая пищу, богатую пребиотиком, серьезно нарастила присутствие в кишечнике того типа бактерии, которая хорошо влияет на состояние нашего кишечника, - этот же результат показывали исследования других ученых.

Однако самое большое изменение произошло у той группы, которая пила кефир.

У добровольцев из этой группы резко выросла колония лактобактерий, которые, как мы знаем, оказывают положительное воздействие на наш кишечник и помогают в таких случаях, как непереносимость лактозы и диарея туриста (понос, который может возникнуть у человека при смене климата, воды и еды - то есть при столкновении с непривычными микробами).

"Ферментированные [подвергнутые процессу брожения] продукты в своей основе довольно кислые, поэтому эти микробы должны были эволюционировать с тем, чтобы приспособиться к подобного рода обстановке и выдерживать кислотную среду, - поясняет доктор Пол Коттер из научно-исследовательского центра Teagasc в городе Корк, который помогал нам в наших изысканиях. - Именно поэтому они проходят сквозь желудок и могут повлиять на формирование среды в кишечнике".

Автор фото, iStock

Подпись к фото,

Да, в Британии продается кефир, хотя и не на каждом шагу

Где брать?

Мы решили продолжить изучение ферментированных продуктов и напитков, чтобы понять, на чем именно следует остановить свой выбор, если вы хотите улучшить свою кишечную среду.

С помощью доктора Коттера и ученых Роухэмптонского университета мы отобрали целый ряд приготовленных дома или купленных в магазине продуктов и напитков, подвергнутых процессу брожения, и отослали их в лабораторию.

Разница получилась колоссальная: тогда как многие продукты, изготовленные дома или же сделанные традиционным методом брожения, действительно содержали большое количество бактерий, некоторые промышленно произведенные продукты почти никаких полезных бактерий не содержали.

"Обычно коммерческие продукты должны проходить процесс пастеризации уже после приготовления, чтобы их обезопасить и продлить срок годности, а это убивает бактерии, но с приготовленными в домашних условиях этого не случается", - поясняет доктор Коттер.

Так что, если вы хотите улучшить работу кишечника и пополнить свой микробиом благотворными бактериями, то лучше всего покупать те продукты, которые приготовлены традиционным способом или же вовсе делать их самим.

Как восстановить микрофлору кишечника • Причины, симптомы и признаки нарушения микрофлоры

Миллиарды полезных бактерий, живущих в ЖКТ человека, делают незаметную, но нужную работу. От чего возникает дисбактериоз и можно ли восстановить микрофлору кишечника?

«Миллиарды» – это не преувеличение, а преуменьшение. Биологи подсчитали, что в кишечнике здорового человека проживает примерно 50 триллионов микроорганизмов. Хотя человек может жить с нарушениями микрофлоры ЖКТ или даже при полном ее отсутствии, это считается отклонением от нормы. Также нежелателен дисбаланс между разными микроорганизмами или преобладание патогенных видов. Поэтому важно поддерживать здоровье кишечника и его обитателей – и речь здесь не столько о лечении, сколько о правильном питании и образе жизни.

Что такое микрофлора кишечника

Микрофлора кишечника – это совокупность всех микроорганизмов, которые живут в ЖКТ здорового человека. При этом в желудке их намного меньше, поскольку кислая среда неблагоприятна для большинства бактерий. Большая часть микрофлоры сосредоточена в тонком и толстом кишечнике. В основном это – лактобациллы, бифидобактерии и бактероиды. Полезные бактерии в кишечнике помогают организму усвоить питательные вещества, которые не переварились в желудке. Кроме этого, микрофлора кишечника тренирует иммунную систему человека

Причины нарушения микрофлоры кишечника

В очень редких случаях микрофлора кишечника исчезает полностью. Гораздо чаще врачи сталкиваются с уменьшением количества нужных видов микроорганизмов и ростом патогенной флоры. Произойти это может по нескольким причинам:

  • пищевое или химическое отравление;
  • хронические заболевания ЖКТ;
  • инфекционное заболевание;
  • лечение антибиотиками или иными подавляющими микрофлору препаратами.

Это состояние врачи называют дисбактериозом или дисбиозом кишечника. Важно понимать, что это не самостоятельная болезнь, а синдром. Поэтому правильнее лечить первопричину, а не сам дисбактериоз.

Симптомы и признаки нарушения микрофлоры кишечника

Даже сегодня микрофлора кишечника изучена недостаточно. Например, ученые до сих пор не могут ответить на вопрос: почему нарушение ее состава у одних людей протекает тяжело, а у других – бессимптомно и без ухудшения самочувствия. Так или иначе, предположить нарушение микрофлоры ЖКТ можно по следующим клиническим проявлениям:

  • боль или чувство распирания в животе;
  • диарея и/или метеоризм;
  • ухудшение аппетита.

Диагностировать нарушение микрофлоры кишечника сложно, поскольку у каждого человека она уникальна. Поэтому врач будет в первую очередь искать причину дисбактериоза, а именно – заболевание, которое могло к этому привести.

Как восстановить микрофлору кишечника народными средствами

К сожалению, достоверных исследований, которые бы показали действенность альтернативной медицины в данном случае, нет. Нормализовать микрофлору кишечника можно лишь опосредованно: улучшая качество жизни. Речь идет не только о правильном питании, но и о физических активностях, отказе от вредных привычек и др. В частности, рацион с высоким содержанием растительных волокон (фрукты, овощи, злаки) благоприятно влияет на микрофлору кишечника, поскольку некоторые бактерии питаются клетчаткой.

Восстановление микрофлоры после антибиотиков

После приема некоторых лекарств (в частности, антибиотиков) в микрофлоре кишечника может наблюдаться дисбаланс. Например, место убитых лекарствами лактобактерий могут занять грибковые культуры или протеи, на которых антибиотики не действуют. Непосредственного лечения, позволяющего быстро восстановить микрофлору кишечника, современная медицина предложить не может. Чаще всего микрофлора приходит в норму самостоятельно, через некоторое время после отмены антибиотиков. Как долго придется ждать? Как правило, несколько недель. По результатам анализов врач дополнительно может назначить средства, подавляющие патогенную флору (например, противогрибковые препараты).

К сожалению, широко рекламируемые пробиотики и препараты с лакто– и бифидобактериями не имеют доказанной эффективности. Проблема в том, что полезные микроорганизмы невозможно доставить туда, где они нужны, живыми. Так, двенадцатиперстная кишка человека содержит агрессивные пищеварительные ферменты, которые убивают большинство микроорганизмов. Поэтому до кишечника «полезные бактерии в капсулах» просто не доходят.

Какие продукты восстанавливают микрофлору кишечника

Важно понимать, что какими бы полезными не были продукты, в кишечник они попадают в полностью переваренном состоянии. И однозначно говорить, например, что кефир улучшает микрофлору за счет содержания полезных бактерий, не совсем верно. Поэтому после отравления, диареи или иного расстройства ЖКТ необходимо, в первую очередь, снизить нагрузку на организм, придерживаясь определенной диеты.

Вот пример лечебного питания, назначаемого при заболеваниях кишечника:
 

Можно Нельзя
Сухари из белого хлеба (без добавления сахара, соли и специй) Сдобные мучные изделия, черный хлеб, пирожные
Супы на обезжиренном бульоне или овощном отваре Наваристые мясные бульоны, грибные супы
Нежирные сорта мяса и птицы в виде отварных и паровых блюд Жирное мясо и рыбу, жареные блюда, колбасы, соленая рыба и икра
Каши на воде (рис, греча, овсянка, манка) Перловка, макароны, бобовые
Творог и кисломолочные продукты Цельное молоко и сливки
Свежие или печеные фрукты без кожуры (в том числе в виде пюре) Фрукты и овощи, содержащие много грубой клетчатки (капуста, морковь, груши, абрикосы)
Кисели, желе, отвар шиповника, разбавленные ягодные соки Газированные напитки, алкоголь, кофе


Несмотря на то, что сырые фрукты и овощи надо вводить в меню аккуратно, полностью отказываться от них нельзя. Помимо содержания необходимых витаминов, клетчатка стимулирует перистальтику, что может уберечь от запора. А вот отвары лечебных трав без рекомендации врача принимать не стоит.

Читайте также: 
Идеи для быстрого и здорового перекуса
Как правильно выбрать хороший мед
Кролик с овощами: рецепт для пароварки

Какие продукты помогут восстановить микрофлору кишечника

Эксперты назвали продукты, которые справляются с восстановлением микрофлоры кишечника лучше, чем лекарственные препараты.

В нашем кишечнике находится миллионы бактерий, и не все из них полезные. В результате различных заболеваний в микрофлоре кишечника образуются вредоносные микроорганизмы, которые нарушают его работу и усугубляют самочувствие.

Нарушение микрофлоры может вызывать не только неправильное питание или прием антибиотиков. Врачи утверждают, что в результате таких заболеваний, как онкология, астма, колит, экзема, сахарный диабет и даже рассеянный склероз, кишечник дает сбой.

Следим за рационом

Если вы хотите, чтобы проблема перестала вас беспокоить, то обязательно включите в свое меню продукты, содержащие клетчатку, пектин. Как отмечают гастроэнтерологи, эти вещества особой питательно ценности не имеют, но без них невозможна здоровая работа пищеварения. Налегаем на овощи, фрукты, зерна. Пектин – прекрасный субстрат для «хороших» бактерий. Он в большом количестве содержится в черной смородине, свекле, яблоках, сливах, абрикосах, крыжовнике и тыкве. Если нет возможности приобрести эти продукты, то прекрасной альтернативой станет натуральная пастила без сахара. Она эффективнее аптечных пробиотиков.

Нужна кислая среда

Поддержать микрофлору кишечника поможет квашеная капуста. Она содержит уйму молочнокислых бактерий Lactobacillaceae, которыми охотно делится с желудком и кишечником.

А брусника и клюква хороши и в квашеном, и в свежем виде. Кислая среда, которую создают ягоды в кишечнике, губительна для патогенных микроорганизмов. Кроме того, в них огромное количество пектина, который помогает жить и размножаться «хорошим» бактериям.

На что наложить табу

Чтобы восстановление микрофлоры прошло намного эффективнее, вам придется отказаться от многих продуктов, с высоким содержанием быстрых углеводов. Любителям мучного и сладкого, особенно в период восстановления микрофлоры, придется наложить на них табу. Гастроэнтерологи предостерегают, что именно плохим бактериям, которые мешают работе кишечника, очень нравятся булочки, печенья и пирожные. Откажите им в этом удовольствии.

Ранее «Кубанские новости» рассказывали о том, какие продукты необходимы при сахарном диабете.

Как восстановить микрофлору кишечника с помощью питания и лекарственных препаратов?

В кишечнике каждого человека обитает около 50 триллионов разнообразных микроорганизмов, без которых пищеварительный тракт не смог бы полноценно выполнять свою основную функцию – усваивать питательные вещества из продуктов. Общий вес этих маленьких «жильцов» может достигать 3 кг, все они образуют кишечную микрофлору.


У здорового человека микрофлора состоит из 1% условно-патогенных микроорганизмов, среди которых дрожжеподобные грибки, стафилококки и клостридии. Остальные 99% совершенно безвредны. К ним относят бифидо- и лактобактерии, кишечные палочки, энтерококков, аэробов. Если баланс микроорганизмов отклоняется в сторону вредных, и их численность начинает превышать положенный 1%, а популяция полезных бактерий сокращается, значит у человека развивается дисбактериоз.

Внимание! Нарушение микрофлоры кишечника возникает по многочисленным причинам. Основные – затяжной прием слабительных, гормональных, антибактериальных препаратов, неправильное питание, диеты и голодания, болезни эндокринной системы, снижение иммунитета, оперативные вмешательства, частые стрессы и депрессии, переутомления, вредные привычки, последствия самостоятельной чистки организма.
Очень важно поддерживать микрофлору кишечника. С этими задачами справляется комплекс пробиотиков Эльбифид - Essential Probiotics, который поддерживает баланс естественной микрофлоры кишечника, ответственной за качество иммунного ответа и гармонизацию работы пищеварительной системы.

Cтоит также обратить ваше внимание на Бифидогенный бальзам - Сибирский прополис Агатовый, который также плодотворно влияет на естественный баланс микрофлоры кишечника, стимулируя её рост. Улучшенная формула бальзама содержит ещё больше лактулозы и сибирских целебных трав.


Лекарственная терапия

При выраженном дисбактериозе микрофлору кишечника восстанавливают медикаментозным способом. Самостоятельно принимать препараты нельзя, поскольку можно еще сильнее усугубить ситуацию. Следует обратиться к врачу, который подберет наиболее подходящий метод лечения дисбактериоза и лекарственные средства. Могут быть назначены:

  • антибиотики – показаны только в запущенных случаях для устранения вредной флоры;
  • пребиотики – для создания благоприятных условий для жизни полезных микроорганизмов;
  • пробиотики – живые микроорганизмы, аналогичные тем, которые обитают в здоровом кишечнике;
  • симбиотики – для заселения кишечника полезными бактериями и создания подходящих условий для их жизнедеятельности;
  • ферменты – для улучшения процесса переваривания пищи.


На какое средство падет выбор врача, зависит от симптоматики у больного. При диарее назначаются пробиотики, при задержке стула – пребиотики, при непостоянном стуле – симбиотики.

Питание

Микрофлору помогают восстановить некоторые продукты и народные средства. Соблюдение правильного питания – одно из важнейших условий для эффективного лечения дисбактериоза. Именно грамотно подобранные продукты позволяют наладить пищеварение, избавиться от проблем со стулом и снабдить организм недостающими микроорганизмами и витаминами.

При задержке стула рекомендовано употребление чернослива, свеклы, отрубей, семян льна, овсяной каши. При диарее – цветной капусты, печеных яблок, моркови, риса, приготовленных на пару рыбных и мясных блюд. При метеоризме – легкие бульоны, картофель, омлеты. Исключить в последнем случае придется бобовые, молоко, сладости и выпечку.

Ощутить комфорт и лёгкость в желудке благодаря уникальной композиции сибирских трав вам поможет Фиточай из диких трав № 5 (Комфортное пищеварение) из серии Baikal Tea Collection. Ромашка, курильский чай, подорожник и володушка нормализуют работу пищеварительной системы и восстанавливают микрофлору кишечника.

В качестве перекуса можно использовать Питательный коктейль Ванильная лукума - Yoo Gо, богатый витаминами, аминокислотами и полезными жирами. Каждая порция - это полноценный полезный перекус, наполненный пищевыми волокнами, омега-3 ПНЖК, белком и L-карнитином. Сбалансированный состав обеспечивает организм жизненно важными нутриентами и помогает сохранить ощущение сытости долгое время.

Внимание! Для восстановления кишечной микрофлоры в домашних условиях все равно придется принимать пребиотики и пробиотики. Первые можно получить из чеснока, лука, банана, спаржи, отрубей. Вторые – из кефира и натурального йогурта. Обоими компонентами организм можно снабдить с помощью пищевых добавок.

При дисбактериозе полезно употреблять в пищу паровые овощи, запеченные фрукты, некислые соки, легкие супы, молочные и кисломолочные продукты, цельнозерновые крупы, миндаль. Можно включить в рацион нежирные сорта мяса и рыбы, зачерствелый белый хлеб, отруби, галеты. Под строгим запретом – жирные сорта мяса и рыбы, копчености, соленые, острые, маринованные, кислые продукты, жареные блюда, консервы, мороженое, мучные и кондитерские изделия, концентрированные бульоны, шоколад, перловка, соуса, крепкий чай и кофе, бобовые, грибы, алкоголь.

Диетическое питание при нарушении микрофлоры | Bifiform ru

В диетологии и гастроэнтерологии в зависимости от вида заболевания, степени тяжести его проявления и длительности процесса существуют лечебные диеты с различным набором продуктов и степенью их кулинарной обработки. Диета необходима для того, чтобы обеспечить пациенту щадящий режим питания 1. Но врач, наблюдающий пациента, обязательно обращает внимание на то, насколько долго его подопечный бывает ограничен в потреблении ряда полезных продуктов, и при возможности расширяет диету.

Первый принцип организации терапевтического питания – обеспечение пациента полноценным питанием (речь идет о витаминах, минералах, белках, углеводах и жирах) и энергией в необходимых ему количествах.

Второй принцип – объем съедаемого и возможность пациента усвоить этот объем еды должны быть сбалансированы.

Третий – следует обязательно учитывать общее воздействие назначенной диеты на организм пациента.

Четвертый – обязательно следует использовать различные диетические прописи, в которых предложен щадящий, тренировочный и разгрузочный рационы.

Пятый – в режиме приема пищи на день важно точно обозначить время – распределить часы завтраков, обедов, ужинов, промежутки между ними.

Шестое правило – составление терапевтического рациона питания непременно должно быть индивидуально ориентированным, в нем следует учесть местные и национальные особенности, тип конституции человека, сопутствующие заболевания.

Для диетолога при расчете суточного количества калорий важны параметры, касающиеся возраста, пола, конституции больного, характеристики, предписанного ему режима.

В случае увеличения энергопотерь, например, во время инфекционных заболеваний, после тяжелой травмы или хирургического вмешательства, для того, чтобы восполнить дефицит калорий, их количество увеличивают иногда вдвое.

Расчет оптимального соотношения «питательные вещества – калории», которое необходимо пациенту в сутки, выглядит следующим образом:

  • 14% калорий дают белки;

  • 30% получают, благодаря жирам;

  • 56% должны приносить углеводы.
     

Если составлять рацион без учета этих требований, то эффект от воздействия сопутствующей терапии может быть снижен и могут развиться дополнительные нарушения [2].

Белки животного и растительного происхождения пациент должен получать в одинаковых долях. Но всегда есть исключения: например, при некоторых заболеваниях почек следует снизить количество белка, но при этом организм должен получать незаменимые аминокислоты хотя бы в минимальном количестве. Если этого не обеспечить, то следствием будет развитие белковой недостаточности.

Организм человека нуждается в ежедневном поступлении жиров, углеводов, витаминов, минеральных веществ.

В случае некоторых болезней необходимо восполнять потерю организмом полезных веществ, в количестве, превышающем физиологические нормы.

Для восстановления баланса микрофлоры кишечника важно насытить рацион питания продуктами, которые в значительном количестве содержат клетчатку и пектины. Это такие продукты как злаки, фрукты, овощи. Ограничение потребления сладких, мучных и копченых продуктов питания – обязательное условия для восстановления здоровья кишечника.

Неоценима польза кисломолочных продуктов (кефир, йогурт, ацидофиллин, простокваша), содержащих лактобактерии, которые, активно подавляя процессы гниения в кишечнике, восстанавливают баланс его микрофлоры. С их помощью можно привести в норму баланс кишечных микроорганизмов, усилить иммунную защиту, расщепить углеводы, помочь в синтезе витаминов К и группы В2. Включение в диету круп и хлеба грубого помола способствует нормализации стула, восстановлению активной моторики кишечника и функций слизистой ЖКТ. Существуют состояния организма, когда баланс микрофлоры нарушается достаточно глубоко: частые стрессовые ситуации, перенесенные инфекции, смена климата и характера питания, прием антибиотиков. И тогда приема молочнокислых продуктов и соблюдения режима питания бывает недостаточно. В таких ситуациях на помощь могут прийти пробиотические комплексы, содержащие живые полезные бактерии, такие как пробиотики Бифиформ.

Но перед приемом любого средства или в случае ухудшения вашего состояния всегда нужно проконсультироваться с врачом!

Диетическое питание, став нормой жизни, зачастую позволяет избежать многих проблем со здоровьем в будущем. Грамотный рацион будет профилактикой многих заболеваний, а не лекарством от них. Сейчас диетическое питание – это не только еда для людей с проблемами пищеварения, а следование принципам здорового образа жизни, повышающее ее качество.

Недаром греческое слово «диета» (греч.δίαιτα) означает образ жизни, режим питания.

  1. The Nutrition Source Healthy Eating Plate & Healthy Eating Pyramid \2017 The President and Fellows of Harvard College

  2. The dilatory supplement pyramid

PP-BIF-RUS-0327

Пре- и пробиотики для здорового пищеварения

В педиатрической практике детские пребиотики и пробиотики назначают для достижения лечебной и профилактической цели. Лекарства имеют схожие названия, но характеризуются некоторыми отличиями в своем воздействии на пищеварительный тракт. Пробиотики и пребиотики назначают для восстановления активности органов ЖКТ. При наличии показаний, препараты этой группы рекомендуют принимать детям, начиная с первых дней жизни. Назначение дает педиатр, неонатолог, гастроэнтеролог или инфекционист, что зависит от вида нарушения пищеварения, первопричины развития такового. 

 

Что такое пробиотики и пребиотики

 

Пробиотики – это препараты, необходимые для нормального функционирования незрелого детского пищеварительного тракта. Они заселяют кишечник микрофлорой извне, обеспечивают временный эффект, не всегда совместимы с эндогенной микрофлорой. Всего 10% от принятой дозировки пробиотиков достигает кишечника, преодолевая кислотность желудочного сока и ферменты пищеварительного тракта. Состав – живые клетки полезной микрофлоры кишечника. 

Пребиотики стимулируют рост естественной кишечной микрофлоры, содержат компоненты, которые служат пищей для полезных микроорганизмов, присутствующих в органах ЖКТ. Попадая в пищеварительный тракт, вещества этой лекарственной группы не перевариваются. Они депонируются внутри кишечника, характеризуются более стойким клиническим и бактериологическим эффектом. 

Пребиотики выполняют такие действия:

  • Способствуют очищению стенок кишечника от патогенной слизи.
  • Ускоряют процесс размножения кишечной микрофлоры. 
  • Способствуют регенерации стенок кишечника. 
  • Предотвращают развитие запора, невзирая на первопричину такового. 
  • Удерживают кислотность желудка в норме.
  • Купируют процесс размножения, роста патогенных микроорганизмов (холерных вибрионов, сальмонелл). 
  • Нормализуют кишечную перистальтику. 

Действуя совместно, пробиотики и пребиотики для детей представляют ценность относительно восстановления пищеварения и нормализации общего состояния здоровья. 
Пробиотики усиливают барьерную функцию кишечника. Они модифицируют токсические компоненты, которые продуцируют патогенные микроорганизмы. Пробиотики изменяют уровень кислотности в кишечнике, создают неблагоприятные условия для активности болезнетворных возбудителей.

 

Виды пробиотиков

 

Пробиотики для детей до года и детей постарше классифицируются по поколениям: 
1.    Препараты 1 поколения: в эту группу входят варианты, содержащие бактерии только одного вида – лакто- или бифидобактерии. 
2.    Препараты 2 поколения: к этой категории относятся варианты, изготовленные на основе споровых бактерий и дрожжеподобных грибков, хотя эти микроорганизмы нетипичны для кишечника. 
3.    Препараты 3 поколения: в этой группе находятся средства, которые содержат одновременно несколько вариантов полезных бактерий. 
4.    Препараты 4 поколения: к этой категории пробиотиков относятся варианты, закрепленные на сорбенте. 
5.    Препараты 5 поколения: современные средства, способствующие восстановлению кишечной микрофлоры. Содержат соединения, которые служат кормом для полезных бактерий. 

Также в педиатрической практике пробиотики классифицируют с учетом их состава. Он может содержать бактерию Escherichia Coli, энтерококки, дрожжеподобные грибки, лактобактерии, бифидобактерии, сахаромицеты. 

Пробиотики разделяются в зависимости от формы выпуска. Лекарства этого вида изготавливают в виде капсул, раствора или порошка, предназначенного для приготовления суспензии. Также существуют детские молочные смеси, содержащие пробиотики и пребиотики. Такое питание можно употреблять новорожденным до 1 года, которые страдают нарушениями пищеварения, сопряженными с развитием дисбактериоза. 

 

Показания к назначению пробиотиков и пребиотиков детям

 

Прием пробиотиков назначают в тех случаях, когда возникли следующие состояния:

  • Запор, вызванный нарушением кишечной микрофлоры. 
  • Глистная инвазия.
  • Пищевая аллергия.
  • Кишечная инфекция.
  • Отравление.
  • Колит (воспаление толстой кишки).
  • Энтерит (поражение тонкой кишки). 

Также препараты этой группы назначают в рамках детского лечения от анемии, ферментопатии, синдрома раздраженного кишечника. Пробиотики восстанавливают защитные силы организма, выполняют выраженное иммуномодулирующее действие. Лекарства, насыщенные полезными бактериями, хорошо восстанавливают кишечную микрофлору, пострадавшую вследствие длительной и/или интенсивной терапии антибиотиками. В педиатрической практике назначают детское питание с пробиотиками и пребиотиками или рекомендуют прием полезных бактерий в виде препаратов. 

 

Пробиотики и пребиотики для новорожденных

 

Для восстановления кишечной микрофлоры у детей, специалисты назначают такие препараты:

  • Ротабиотик-бэби. Прием этого средства рекомендован в тех случаях, когда нужно выбрать наиболее подходящие пробиотики для кишечника для детей до года. Лекарство изготовлено с добавлением экстракта ромашки лекарственной и фенхеля. Также в составе присутствуют живые лакто- и бифидобактерии. Свойства препарата – нормализующее (кишечную микрофлору), антисептическое, ветрогонное (способствует безболезненному отхождению газов). 
  • Бифиформ Бэби. Хороший препарат, действие которого направлено на устранение дисбактериоза у малышей с аллергией на лактозу. Имеет форму маслянистого раствора, в крышке флакона находится порошок с полезными бактериями. Упаковка с препаратом дополняется мерной пипеткой, предназначенной для точного расчета разовой дозировки. Состав средства – бифидобактерии, молочнокислый стрептококк. Лимонная кислота, сахар, подсолнечное масло, красители, ароматизаторы – отсутствуют. Бифиформ Бэби входит в группу пробиотиков 5 поколения, его назначают для лечения малышей, начиная с первых дней жизни. 
  • Нормофлорин. Биодобавка обладает выраженным терапевтическим эффектом. Входит в список эффективных пробиотиков, поскольку восстанавливает кишечную микрофлору, нарушенную вследствие воспаления органов пищеварительного тракта. Новорожденным это средство следует принимать по 0,5 ч. л., 3 раза в сутки. Детям до 6 лет Нормофлорин нужно употреблять принимать по 1 ч. л.
  • Линекс детский. Имеет форму капсул, содержит бифидо- и лактобактерии, а также вещества, которые стимулируют процесс их размножения. Средство можно принимать одновременно с антибиотиками, поскольку на фоне антибактериального лечения всегда нарушается кишечная микрофлора. Средство относится к группе пробиотиков 3 поколения. 
  • Колибактерин. Купирует активность патогенной микрофлоры, улучшает функцию органов пищеварительного тракта. Препарат не используют в педиатрической практике, когда возраст малыша не превышает полугода. Колибактерин относится к пробиотикам 1 поколения. 
  • Энтерол. Средство предназначено для приема детьми старше 1 года, содержит сахаромицеты. Имеет положительные отзывы, характеризуется терапевтической эффективностью в отношении устранения детской диареи, что объясняется уникальным составом препарата. Если возраст малыша не превышает 3 лет, Энтерол нужно принимать по 1 пакетику в сутки, на протяжении 3-5 дней. 
  • Хилак Форте. Полезный препарат, действие которого направлено на восстановление кишечной микрофлоры, улучшение состояния пищеварения. Средство выпускают в форме раствора. Приятный вишневый вкус консистенции предотвращает потенциально возможные неудобства, связанные с нежеланием малыша проходить лечение. Показания к назначению – кандидоз кишечника, сальмонеллез, отравление. Лекарство рассчитано на прием 3 раза в сутки, по 15-30 капель, если терапию проходит новорожденный, и по 20-40 капель, когда кишечную микрофлору нужно восстановить детям до 6 лет. 
  • Максилак Бэби. Синбиотик, который содержит 9 полезных пробиотических бактерий и пребиотик. Максилак Бэби можно принимать детям старше 4 месяцев. Средство имеет форму гранул, предназначенных для приготовления суспензии. Средняя продолжительность курса – 10 дней, за 1 день можно принимать не более 2 пакетиков препарата (зависит от возраста малыша). 
  • Лактобаланс. Пробиотик предназначен для приема детьми старше 3 лет. Содержит бифидо- и лактобактерии. Препарат следует принимать по 1 капсуле, продолжительность употребления средства зависит от причины, по которой назначен этот вид лечения. Особенность Лактобаланса заключается в грамотном, безопасном составе пробиотика. Он не содержит производные казеина и молока, что делает средство приемлемым для употребления в тех случаях, когда у малыша непереносимость лактозы. 
  • Бифидум БАГ. Средство предназначено для употребления детьми, начиная с первого дня жизни. Быстро устраняет кишечные колики и другие проблемы, связанные с пищеварением. Состав пробиотика – автолизат дрожжей, бифидобактерии, аминокислоты, анаэробные микроорганизмы. Бифидум БАГ можно принимать при расстройстве пищеварения, которое вызвано аллергией, поскольку препарат не содержит лактозу, казеин, синтетические добавки. Новорожденным пробиотик назначают по 2 мл в сутки для лечения, по 1 мл – для профилактики. Для детей до 6 лет оптимальная дозировка – от 2 до 10 мл. 
  • Аципол Малыш. Препарат назначают для восстановления процесса пищеварения, устранения диареи, нормализации дефекации. Дополнительное свойство – уменьшение степени выраженности симптомов пищевой аллергии у ребенка. Средство характеризуется комплексным составом, который представлен высокой концентрацией бифидо- и лактобактерий. Аципол Малыш не содержит лактозы, глютена. Препарат имеет форму раствора, разовую и суточную дозировку нужно рассчитывать по каплям. Средний терапевтический курс – 2 недели, но на этот показатель влияет возраст малыша и причина, по которой назначен прием пробиотиков. 

Конкретный пробиотик и пребиотик может назначить педиатр. Он учтет возраст ребенка, причину появления проблем с пищеварением, степень их выраженности и стадию развития, особенности состояния детского организма. Важно не прекращать терапевтический курс при первичном улучшении состояния здоровья малыша – нужно пройти полный курс лечения. 

 

Правила приема пробиотиков для детей

 

Чтобы восстановить кишечную микрофлору и достичь терапевтического эффекта, препараты с полезными бактериями и детские смеси с пробиотиками нужно принимать правильно:

  • Прием препарата не должен противоречить особенностям состояния детского организма. 
  • Пробиотики противопоказано запивать горячей водой, поскольку при высокой температуре каждый полезный микроорганизм лекарства погибает. 
  • Лечебный продукт допустимо употреблять от 1 до 6 раз, что зависит от особенностей принимаемого средства.
  • Пробиотик должен соответствовать возрасту малыша. 
  • Во время курса восстановления кишечной микрофлоры, родителям нужно контролировать стул ребенка. Это позволит оценить эффективность проводимого лечения, пользу конкретного средства. 
  • Для закрепления терапевтического эффекта, детский рацион также нужно наполнить продуктами, насыщенными пробиотиками. 
  • Когда малыш проходит курс, направленный на восстановление кишечной микрофлоры, в его рацион нельзя вводить новые продукты, в случае с питанием новорожденных – прикормы. 
  • Самые полезные пробиотики – те, которые содержат живые культуры. 

Родителям нужно понимать, что если ребенок проходит курс восстановления кишечной микрофлоры, рацион должен быть максимально легким – переедание противопоказано. 

Пробиотики и пребиотики – это уникальные препараты, которые гарантированно восстанавливают кишечную микрофлору, независимо от причины ее нарушения. Несмотря на положительные свойства этих средств, их нельзя принимать без получения назначения от специалиста. 

Нормализуем работу кишечника

15 мая 2020 г.

Кишечник человека населяют сотни видов различных микроорганизмов, которые отвечают за защиту его слизистой, переваривание пищи и усвоение полезных веществ. Для правильной работы кишечника необходимо, чтобы в нём поддерживался баланс “хороших” и “плохих” бактерий – своих и чужеродных.

Баланс этих бактерий легко нарушить при неправильном питании, приёме антибиотиков, стрессах и некоторых диетах. При возникновении дисбаланса в кишечной флоре патогенные бактерии атакуют иммунную систему, проникая в организм и вызывая изменения.

Нарушения иммунитета могут выражаться по-разному: от акне и частых простуд до тяжелейших заболеваний, способных навредить человеку. Нормализовать работу кишечника могут помочь различные препараты, которые стоит подбирать в зависимости от ситуации.

За микрофлору кишечника отвечают бифидобактерии.

Эти микроорганизмы отвечают за такие важные функции как: синтез витаминов, пищеварение, абсорбирование желчных кислот и холестерина, предупреждение запоров и поносов, стимуляция иммунных реакций.

Одним из источников бифидобактерий является Симбиоз Альфлорекс, он поможет вам восстановить микрофлору кишечника и нормализовать пищеварение.

БАДы в помощь для восстановления микрофлоры кишечника после приёма антибиотиков.

В процессе приёма некоторых препаратов (например, антибиотиков) полезные бактерии погибают, баланс нарушается и микрофлора кишечника страдает. Это выливается в неприятные последствия в виде запоров или диареи.

Для устранения этих последствий есть несколько БАДов, которые себя хорошо зарекомендовали на рынке.

Если вы не любите глотать таблетки, для вас подойдёт Витастронг Флориоза в удобной форме саше.

Если форма выпуска для вас не принципиальна, то на ваш выбор:

  • Линекс Форте, успевший зарекомендовать себя среди покупателей;
  • Аципол Актив с приятным грушевым вкусом, где один флакон рассчитан на один приём.

Микрофлора кишечника у малышей.

К сожалению, малыши также могут столкнуться с дисбалансом в кишечнике. Восстановить бифидобактерии в этом случае поможет Бифиформ бэби. Также многие педиатры назначают Аципол малыш в удобной форме капель, который содержит в себе и лакто- и бифидобактерии.

С расстройством кишечника могут сталкиваться и малыши, и взрослые, поэтому в целях удобства и экономии есть возможность приобрести нужные препараты сразу в необходимых объёмах для всей семьи.

Не забывайте проверять противопоказания и консультироваться с лечащим врачом по поводу принимаемых препаратов!

ИМЕЮТСЯ ПРОТИВОПОКАЗАНИЯ. ПЕРЕД ПРИМЕНЕНИЕМ НЕОБХОДИМО ПРОКОНСУЛЬТИРОВАТЬСЯ СО СПЕЦИАЛИСТОМ

Кишечные бактерии в здоровье и болезнях

Abstract

Новая эра в медицинской науке началась с осознания критической роли «забытого органа», кишечной микробиоты, в здоровье и болезнях. Центральным в этом полезном взаимодействии между микробиотой и хозяином является способ, которым бактерии и, скорее всего, другие микроорганизмы, содержащиеся в кишечнике, общаются с иммунной системой хозяина и участвуют в различных метаболических процессах, приносящих взаимную пользу хозяину и микробу.Появление высокопроизводительных методологий и разработка сложных аналитических систем облегчили подробное описание состава микробных компонентов кишечника человека, как никогда раньше, и теперь позволяют проводить сравнения между состоянием здоровья и различными заболеваниями. Хотя последний подход все еще находится в зачаточном состоянии, уже получены некоторые важные сведения о том, как микробиота может влиять на ряд болезненных процессов как внутри, так и за пределами кишечника.Эти открытия также закладывают основу для разработки терапевтических стратегий, которые могут изменить микробиоту (например, за счет использования пробиотиков). Хотя эта область является многообещающей, необходимы более качественные испытания пробиотиков, пребиотиков и других подходов, изменяющих микробиоту при расстройствах пищеварения, а также лабораторные исследования механизмов их действия.

Ключевые слова: Флора кишечника, микробиота, пробиотики, кишечные бактерии, микробный метаболизм, иммунология слизистых оболочек

Во многом благодаря быстрому развитию аналитических методов в микробиологии, молекулярной биологии и биоинформатике истинное разнообразие населяющих микроорганизмов желудочно-кишечный тракт человека (вместе именуемый микробиотой кишечника человека) раскрывается, и его вклад в гомеостаз здоровья и патогенез болезней оценивается ().Как следствие, изучение экологии кишечника превратилось в одну из самых активных и захватывающих областей биологии и медицины. Именно в этом контексте теперь необходимо рассматривать маневры по изменению или модификации микробиоты либо посредством диетических модификаций, либо путем введения антибиотиков, пробиотиков или пребиотиков.

Таблица 1

Важные гомеостатические функции кишечной микробиоты

1. Метаболическая роль
  • Спасает калории

  • Производит короткоцепочечные жирные кислоты

  • Производит аргинин

  • Синтезирует витамин К и фолиевую кислоту

  • Участвует в метаболизме лекарств (например, активирует 5-аминосалициловую кислоту из сульфасалазина)

2.Деконъюгация желчных кислот
3. Предотвращение колонизации патогенами
4. Иммунологические эффекты
  • Стимулирует выработку иммуноглобулина А

  • Стимулирует противовоспалительные цитокины и подавляет 4 0005 0005

  • 22

    22

    Индуцирует регуляторные Т-клетки

Нормальная кишечная микробиота: важный фактор здоровья

Основные определения и развитие микробиоты

Термин микробиота предпочтительнее старого термина «флора», поскольку последний не работает для учета многих небактериальных элементов (например, архей, вирусов и грибов), которые, как теперь известно, являются нормальными обитателями кишечника.Учитывая относительно большее понимание роли бактерий, существующее в настоящее время, по сравнению с другими составляющими микробиоты в здоровье и болезнях, кишечные бактерии будут в центре внимания этого обзора. Внутри микробиоты желудочно-кишечного тракта человека существует сложная экосистема, состоящая примерно из 300-500 видов бактерий, включающая почти 2 миллиона генов (микробиом). 1 Действительно, количество бактерий в кишечнике примерно в 10 раз превышает количество всех клеток в организме человека, а совокупный бактериальный геном намного больше, чем геном человека.

При рождении весь кишечник бесплоден; Кишечник младенца сначала заселяется материнскими бактериями и бактериями окружающей среды во время рождения и продолжает заселяться через кормление и другие контакты. 2 Факторы, которые, как известно, влияют на колонизацию, включают гестационный возраст, способ родоразрешения (вагинальные роды или вспомогательные роды), диету (грудное молоко или смесь), уровень санитарии и воздействие антибиотиков. 3 , 4 Кишечная микробиота новорожденных характеризуется низким разнообразием и относительным преобладанием типов Proteobacteria и Actinobacteria ; после этого микробиота становится более разнообразной с появлением доминирования Firmicutes и Bacteroidetes , которые характеризуют микробиоту взрослых особей. 5 - 7 К концу первого года жизни микробный профиль каждого младенца различен; к 2,5 годам микробиота по составу полностью напоминает микробиоту взрослого человека. 8 , 9 Этот период созревания микробиоты может быть критическим; из ряда источников накапливаются данные о том, что нарушение микробиоты в раннем младенчестве может быть решающим фактором проявления болезни в более позднем возрасте.Отсюда следует, что вмешательства, направленные на микробиоту в более позднем возрасте, могут быть в буквальном смысле слишком запоздалыми и потенциально обреченными на провал.

В младенчестве состав микрофлоры кишечника остается относительно постоянным до более позднего возраста. Хотя было заявлено, что состав флоры каждого человека настолько уникален, что его можно использовать в качестве альтернативы снятию отпечатков пальцев, совсем недавно в микробиоме взрослого человека были описаны 3 различных энтеротипа. 10 Среди этих различных энтеротипов преобладают Prevotella , Ruminococcus и Bacteroides соответственно, и их внешний вид не зависит от пола, возраста, национальности и индекса массы тела. Считается, что микробиота остается стабильной до старости, когда наблюдаются изменения, возможно, связанные с изменениями в физиологии пищеварения и диете. 11 - 13 Действительно, Клаессон и его коллеги смогли выявить четкие корреляции у пожилых людей не только между составом микробиоты кишечника и диетой, но и со статусом здоровья. 14

Регуляция микробиоты

Из-за нормальной перистальтики кишечника (перистальтика и мигрирующий двигательный комплекс) и антимикробного действия желудочной кислоты, желчи, секрета поджелудочной железы и кишечника, желудка и проксимального отдела тонкой кишки, хотя, конечно, не стерильны, они содержат относительно небольшое количество бактерий у здоровых людей. 15 Интересно, что недавно из желудка человека были выделены комменсальные организмы с пробиотическими свойствами. 16 Микробиология терминального отдела подвздошной кишки представляет собой переходную зону между тощей кишкой, содержащей преимущественно аэробные виды, и плотной популяцией анаэробов в толстой кишке. Количество бактериальных колоний может достигать 10 9 колониеобразующих единиц (КОЕ) / мл в терминальном отделе подвздошной кишки непосредственно проксимальнее илеоцекального клапана, с преобладанием грамотрицательных микроорганизмов и анаэробов. При попадании в толстую кишку концентрация бактерий и разнообразие кишечной флоры резко меняются.Могут быть обнаружены концентрации 10 12 КОЕ / мл или более, которые состоят в основном из анаэробов, таких как Bacteroides , Porphyromonas , Bifidobacterium , Lactobacillus и Clos-tridium , причем количество анаэробных бактерий превышает численность аэробных. бактерии от 100 до 1000: 1. Преобладание анаэробов в толстой кишке отражает тот факт, что концентрация кислорода в толстой кишке очень низкая; Флора просто приспособилась к выживанию в этой враждебной среде.

На любом уровне кишечника состав флоры также демонстрирует вариации по диаметру, при этом некоторые бактерии имеют тенденцию прикрепляться к поверхности слизистой оболочки, в то время как другие преобладают в просвете. Само собой разумеется, что виды бактерий, обитающие на поверхности слизистой оболочки или в слое слизи, с наибольшей вероятностью будут участвовать во взаимодействиях с иммунной системой хозяина, тогда как те, которые населяют просвет, могут иметь большее отношение к метаболическим взаимодействиям с пищей или продуктами питания. пищеварение.Теперь очевидно, что разные бактериальные популяции могут населять эти разные домены. Однако их относительный вклад в здоровье и болезнь изучен в ограниченной степени из-за относительной недоступности околосклеродных популяций в толстой и, особенно, тонкой кишке. Однако большинство исследований микробиоты кишечника человека основано на анализе образцов фекалий, что является серьезным ограничением. Действительно, ряд исследований уже показал различия между популяциями люминальной (фекальной) и околосклеродной популяций при таких расстройствах, как воспалительное заболевание кишечника (ВЗК) и синдром раздраженного кишечника (СРК). 17 , 18

У людей на состав флоры влияет не только возраст, но также диета и социально-экономические условия. В недавнем исследовании пожилых людей взаимодействие диеты и возраста было продемонстрировано, во-первых, тесной взаимосвязью между диетой и составом микробиоты у субъектов и, во-вторых, взаимодействием между диетой, микробиотой и состоянием здоровья. 14 Следует также помнить, что неперевариваемые или непереваренные компоненты диеты могут вносить существенный вклад в метаболизм бактерий; например, большая часть увеличения объема стула в результате приема пищевых волокон происходит из-за увеличения бактериальной массы.Тонкости взаимодействия между другими компонентами диеты и микробиотой в настоящее время изучаются и, несомненно, дадут важную информацию. Например, данные, указывающие на потенциальную роль определенных продуктов бактериального метаболизма в канцерогенезе толстой кишки, уже убедительно указывают на важность взаимодействия диеты и микробиоты с заболеванием. Антибиотики, назначаемые по рецепту или содержащиеся в пищевой цепи в результате их введения животным, могут серьезно повлиять на микробиоту. 19 Раньше считалось, что эти эффекты были относительно преходящими, и полное восстановление микробиоты происходило очень скоро после завершения курса антибактериальной терапии. Однако, хотя недавние исследования подтвердили, что восстановление у многих видов происходит довольно быстро, некоторые виды и штаммы проявляют более устойчивые эффекты. 20

Взаимодействия хозяина и микробиоты

Взаимодействия кишечной комменсальной микробиоты играют фундаментальную роль в обеспечении гомеостатических функций, таких как иммуномодуляция, активация цитопротекторных генов, предотвращение и регуляция апоптоза и поддержание барьерной функции. 21 Критическая роль микробиоты в развитии функции кишечника убедительно продемонстрирована судьбой стерильного животного. 22 , 23 У этих животных затронуты не только практически все компоненты кишечной и системной иммунной системы, но и развитие эпителия, сосудистой сети, нервно-мышечного аппарата и эндокринной системы кишечника. . Тонкости взаимодействия между микробиотой и хозяином иллюстрируются исследованиями, демонстрирующими способность полисахарида, вырабатываемого бактерией Bacteroides fragilis , корректировать дефицит Т-клеток и дисбаланс Th2 / Th3 и направлять развитие лимфоидных органов. в стерильных животных. 24 Дендритные клетки кишечника, по-видимому, играют центральную роль в этих критических иммунологических взаимодействиях. 24 , 25

Как кишечная иммунная система различает друга и врага, когда дело касается бактерий, с которыми она сталкивается? 26 На уровне эпителия, например, ряд факторов может позволить эпителию переносить комменсальные (и, следовательно, пробиотические) организмы. К ним относятся маскирование или модификация ассоциированных с микробами молекулярных паттернов, которые обычно распознаются рецепторами распознавания паттернов, такими как Toll-подобные рецепторы, 27 и ингибирование воспалительного пути NFκB. 28 Ответы на комменсалы и патогены также могут заметно отличаться в пределах слизистой оболочки и системной иммунной системы. Например, было показано, что комменсалы, такие как Bifidobacterium infantis и Faecalibacterium prausnitzii , по-разному индуцируют регуляторные Т-клетки и приводят к продукции противовоспалительного цитокина интерлейкина (ИЛ) -10. 29 Другие комменсалы могут способствовать развитию Т-хелперных клеток, включая клетки T H 17, и приводить к контролируемому воспалительному ответу, который защищает от патогенов частично, по крайней мере, за счет продукции IL-17. 30 Индукция низкоуровневой воспалительной реакции (физиологического воспаления) комменсалами заставляет иммунную систему хозяина более агрессивно бороться с появлением патогена. 31

Благодаря этим и другим механизмам микробиота, как можно видеть, играет решающую роль в защите хозяина от колонизации патогенными видами. 32 Некоторые кишечные бактерии продуцируют различные вещества, от относительно неспецифических жирных кислот и пероксидов до высокоспецифичных бактериоцинов, 33 , 34 , которые могут подавлять или убивать другие потенциально патогенные бактерии, 35 в то время как некоторые штаммы продуцируют протеазы, способные денатурировать бактериальные токсины. 36

Микробиота и метаболизм

Хотя иммунологические взаимодействия между микробиотой и хозяином были подробно изучены в течение некоторого времени, только недавно истинная степень метаболического потенциала микробиоты начала проявляться. быть схваченным. Некоторые из этих метаболических функций были хорошо известны, например способность бактериальных дисахаридаз спасать неабсорбированные пищевые сахара, такие как лактоза и спирты, и превращать их в короткоцепочечные жирные кислоты (SCFA), которые затем используются в качестве источника энергии. слизистой оболочкой толстой кишки.SCFAs способствуют росту эпителиальных клеток кишечника и контролируют их пролиферацию и дифференцировку. Также в течение некоторого времени было известно, что кишечные бактерии могут продуцировать питательные вещества и витамины, такие как фолат и витамин К, деконъюгировать соли желчных кислот, 37 и метаболизировать некоторые лекарства (такие как суль-фасалазин) в просвете кишечника, тем самым высвобождая их активные части. Однако только недавно был признан полный метаболический потенциал микробиома и оценен потенциальный вклад микробиоты в метаболический статус хозяина в состоянии здоровья и в отношении ожирения и связанных с ним расстройств.Применение геномики, метаболомики и транскриптомики теперь может с огромной детальностью раскрыть метаболический потенциал данного организма. 38 - 41

В настоящее время также известно, что некоторые комменсальные организмы также производят другие химические вещества, включая нейротрансмиттеры и нейромодуляторы, которые могут изменять другие функции кишечника, такие как моторика или ощущения. 42 - 44 Совсем недавно и, возможно, наиболее удивительно, было высказано предположение, что микробиота может влиять на развитие 45 и функцию 46 центральной нервной системы, что привело к концепции ось микробиота-кишечник-мозг. 47 - 49

Кишечная микробиота при болезнях

Точно так же, как мы только сейчас начинаем понимать ключевую роль флоры в здоровье, только в самые последние годы истинные масштабы последствия нарушений во флоре или во взаимодействии между флорой и хозяином. Некоторые из этих последствий относительно очевидны. Например, когда многие компоненты нормальной флоры устраняются или подавляются курсом антибиотиков широкого спектра действия, создается сцена для других организмов, которые могут быть патогенными, чтобы вмешаться и вызвать заболевание. 1 , 2 , 32 Классическим примером этого является диарея, связанная с антибиотиками, и ее самое смертоносное проявление, колит Clostridium difficile . Считается, что подобные нарушения во флоре связаны с разрушительной формой воспаления кишечника, которая может возникать у новорожденных и особенно недоношенных: некротический энтероколит. В других ситуациях бактерии могут просто оказаться там, где их не должно быть. Если перистальтика кишечника нарушена и / или секреция кислоты из желудка резко снижена, в результате возникает среда, способствующая размножению организмов в тонкой кишке, которые обычно ограничены толстой кишкой; следствием этого является синдром избыточного бактериального роста в тонкой кишке.В других ситуациях иммунологическое взаимодействие между флорой и хозяином нарушается, и хозяин может, например, начать распознавать составляющие нормальной флоры не как друга, а как врага и может вызвать несоответствующий воспалительный ответ, который, в некоторых случаях полагают, может в конечном итоге привести к таким состояниям, как ВЗК. 1 , 2 , 32 В других ситуациях повреждение кишечного эпителия приводит к протеканию стенки кишечника и позволяет бактериям (полностью или частично) из кишечника получить доступ к подслизистым отделам или даже в большой круг кровообращения, что может вызвать катастрофический сепсис.Считается, что этот механизм объясняет многие инфекции, которые возникают, например, у тяжелобольных пациентов в отделении интенсивной терапии.

Совсем недавно качественные изменения микробиоты стали причиной патогенеза глобальной эпидемии: ожирения. 41 Было высказано предположение, что сдвиг в составе флоры в сторону популяции, в которой преобладают бактерии, которые являются более активными экстракторами абсорбируемых питательных веществ, которые затем становятся доступными для усвоения хозяином, может играть важную роль в ожирении. 41 Такие исследования основаны на применении современных технологий (геномики, метагеномики и метаболомики) для изучения флоры толстой кишки и могут выявить истинное разнообразие и метаболический профиль микробиоты, а также реальную степень изменений в заболевании. . Вместо того, чтобы предоставлять исчерпывающий обзор всех болезненных состояний, на которые может повлиять микробиота, ниже будет представлен краткий обзор текущей информации о роли микробиоты в некоторых распространенных заболеваниях / расстройствах.

Воспалительное заболевание кишечника

Существует множество доказательств, подтверждающих гипотезу о том, что эндогенная микрофлора кишечника играет решающую роль в патогенезе ВЗК, его вариантов и связанных с ними заболеваний. 50 , 51 Некоторые из этих доказательств проверены временем, например, предрасположенность ВЗК к областям с высоким числом бактерий и роль контакта с фекальным потоком в поддержании воспаления. Другие доказательства являются более свежими и включают исследования, описанные выше, которые иллюстрируют ключевую роль микробиоты в иммунных ответах хозяина и возникновении воспалительных реакций.Эти данные дополняются экспериментальными наблюдениями за способностью стратегий, модифицирующих микробиоту (например, введение пробиотиков), модулировать воспалительный ответ в экспериментальных моделях ВЗК. 52 - 58 Исследования микробиоты кишечника при ВЗК выявили количественные и качественные изменения, 59 , включая интригующее открытие в некоторых исследованиях 60 , что бактерия с противовоспалительными свойствами, F prausnitzii , у пациентов с ВЗК встречается реже, чем у здоровых людей.Важность взаимодействий микробиота-хозяин при ВЗК дополнительно подтверждается многочисленными исследованиями генетики ВЗК, которые выявили множество изменений в генах, которые кодируют молекулы, участвующие в распознавании бактерий, взаимодействии бактерий-хозяев и результирующем воспалительном каскаде. 61 На более клиническом уровне роль микробиоты подтверждается эффективностью, хотя и переменной, антибиотиков при ВЗК 62 и предположением, не всегда подтвержденным высококачественными клиническими испытаниями, о том, что ряд пробиотических организмов , включая непатогенные Escherichia coli , Saccharomyces boulardii и Bifidobacte-rium , эффективны в поддержании ремиссии и лечении легких и умеренных обострений язвенного колита. 63 - 70 Имеются некоторые предварительные данные, позволяющие предположить, что трансплантация кала, 71 , стратегия, со значительным успехом применяемая при лечении резистентной и рецидивирующей инфекции C. difficile , 72 , может быть эффективной. при язвенном колите. 73 , 74

Более убедительную клиническую иллюстрацию влияния модуляции микробиоты дает пример поучита, варианта ВЗК, который встречается в неоректуме у пациентов с язвенным колитом, перенесших полное лечение. колэктомия и процедура подвздошно-анального мешка.Здесь VSL # 3 (Sigma Tau Pharmaceuticals), пробиотический коктейль, содержащий 8 различных штаммов молочнокислых бактерий, доказал свою эффективность в первичной профилактике и поддержании ремиссии у пациентов с поучитом. В одном исследовании ремиссия сохранялась у 85% пациентов, получавших VSL # 3, по сравнению с 6% пациентов, получавших плацебо. 75

Синдром раздраженного кишечника

Разнообразные доказательства предполагают роль кишечной микробиоты в СРК 76 ().Прежде всего, это клиническое наблюдение, что СРК может развиваться у людей de novo после контакта с кишечными инфекциями и инвазиями (т. Е. Постинфекционным СРК). 77 Более спорным было предположение, что пациенты с СРК могут иметь избыточный бактериальный рост в тонком кишечнике (СИБР). 78 Более косвенные доказательства роли микробиоты можно почерпнуть из некоторых метаболических функций компонентов микробиоты. Таким образом, учитывая влияние солей желчных кислот на секрецию толстой кишки, изменения деконъюгации солей желчных кислот могут привести к изменению объема и консистенции стула.Точно так же изменения в бактериальной ферментации могут привести к изменению объема и / или состава газа. Дополнительные доказательства получены из клинического воздействия терапевтических вмешательств, таких как антибиотики, пребиотики или пробиотики, которые могут изменять или модифицировать микробиоту. Таким образом, было показано, что плохо абсорбируемый антибиотик рифаксимин (Xifaxan, Salix) облегчает симптомы СРК с преобладанием диареи, 79 и некоторых пробиотиков (B infantis 35624 [Align] [Procter & Gamble], в частности 80 ) было показано, что они оказывают существенное клиническое воздействие.Последний представляет интерес, учитывая его продемонстрированную способность модулировать системный иммунный ответ у людей. 25 , 81 Также все большее распространение получает предположение о том, что микробиота толстой кишки может демонстрировать качественные и / или количественные изменения при СРК. 82

Таблица 2

Доказательства роли кишечной флоры в синдроме раздраженного кишечника

1. Прямое свидетельство измененной микробиоты кишечника
  • Постинфекционный синдром раздраженного кишечника

  • Бактериальные бактерии тонкого кишечника избыточный рост

  • Измененная микробиота толстой кишки

2.Доказательства физиологических эффектов измененной микробиоты
3. Медиатор провоспалительного состояния
4. Терапевтическое воздействие изменения микробиоты
  • Антибиотики

  • Пробиотики

  • Пребиотики

Современные молекулярные микробиологические методы теперь применяются к этой сложной проблеме и действительно подтвердили, что пациенты с СРК, независимо от подтипа, действительно демонстрируют фекальную флору, которая явно отличается от таковой у контрольных субъектов. 83 Исследования моих коллег и меня продемонстрировали, во-первых, снижение микробного разнообразия в IBS 84 и, во-вторых, с использованием высокопроизводительного пиросеквенирования, существование различных подгрупп IBS на основе подробного исследования микробиоты. 85 На уровне филума одна из этих подгрупп напоминала контрольных субъектов, тогда как другая продемонстрировала сдвиг в относительной пропорции двух основных типов, Firmicutes, и Bacteroidetes, , а также значительные изменения на уровне видов и штаммов. 82 , 84 Приоритет этих микробных сдвигов и их способность нарушать слизистую или мионевральную функцию в стенке кишечника, влиять на ось мозг-кишечник или вызывать местные или системные иммунные ответы еще предстоит определить (). Наиболее интригующим было предположение, сделанное на основе исследований на животных, что кишечная микробиота может влиять на функцию и морфологию мозга. 49

Схема, суммирующая возможную роль микробиоты в синдроме раздраженного кишечника.Измененная микробиота в сочетании с протекающим эпителиальным барьером позволяет бактериям и / или бактериальным продуктам получать доступ к подслизистому отделу, где активируются тучные клетки и иммунные клетки (лимфоциты), высвобождая протеазы тучных клеток, хемокины и цитокины, которые могут активировать сенсорные нейроны. Это, в свою очередь, может привести к локальным рефлексам, влияющим на моторные и секреторные функции, или к усилению висцеральных ощущений в центре.

Несколько экспериментальных наблюдений обеспечивают научную основу для использования методов лечения, которые могут изменять микробиоту при СРК. 85 - 87 Таким образом, было показано, что пероральное введение B infantis 35624 ослабляет ответы на интерферон γ, фактор некроза опухоли α (TNF-α) и IL-6 после стимуляции митогена, повышая уровни в плазме крови триптофан и кинуреновая кислота и, что наиболее поразительно, снижают концентрации 5-гидроксииндолуксусной кислоты и дигидроксифенилуксусной кислоты в лобной коре и миндалине соответственно.

. 89 Хотя эти последние наблюдения могут касаться некоторых из предложенных патофизиологических механизмов, связанных с развитием симптомов при СРК, а именно иммунной активации и нарушений в оси мозг-кишечник, другие исследования показывают, что тот же штамм может также изменять периферические механизмы, связанные с СРК , например висцеральная гиперчувствительность. 90

Устраняя другую аномалию кишечника, выявленную при СРК, Цзэн и его коллеги частично отменили изменения проницаемости тонкого кишечника с помощью коктейля пробиотиков. 91 Другой организм, Lactobacillus acidophilus , как было показано, оказывает висцеральный анальгетический эффект за счет индукции μ-опиоидных и каннабиноидных рецепторов, 92 и Lactobacillus paracasei , как было показано, ослабляет гиперсонтрастность мышц кишечника на модели животных постинфекционного СРК. 93 Опять же, этот эффект был штамм-зависимым и, по-видимому, опосредован, частично, через модуляцию иммунологического ответа на первоначальную инфекцию и, частично, через прямое воздействие организма или его метаболита на кишечная мышца.В других экспериментах этот же организм был способен ослаблять индуцированную антибиотиками висцеральную гиперчувствительность у мышей. 94

Было показано, что Lactobacillus reuteri подавляет висцеральную боль, вызванную растяжением толстой кишки у крыс. 95 Было показано, что этот же пробиотический организм, имеющий клиническую значимость, легко колонизирует и индуцирует иммунный ответ в тонком кишечнике у людей. 96 Интересно, что с учетом важности биосинтеза теховой кислоты в иммунологических ответах на определенные лактобациллы, Дункер и его коллеги показали, что мутант Lactobacil-lus (приводящий к истощению липотехоиновой кислоты D-аланином) также значительно подавлял восприятие висцеральной боли у здоровых крыс без воспаления. 97

Функциональные и морфологические изменения в кишечном нервно-мышечном аппарате развиваются у мышей, инфицированных Trichinella spiralis , спустя много времени после того, как глисты были изгнаны и связанный с ним воспалительный ответ утих, что обеспечивает животную модель постинфекционного СРК. 98 , 99 L paracasei , но не другие штаммы, как было показано, ослабляет гиперсокращение мышц кишечника, снижает активацию иммунной системы, 93 и нормализует метаболический профиль мышей в этой модели. 100

Эти экспериментальные наблюдения теперь подтверждаются клиническими исследованиями пробиотиков при СРК у людей. Результаты при СРК по-прежнему варьируются для ряда организмов, таких как Lactobacillus GG, Lactobacillus plantarum , L acidophilus , Lactobacillus casei , пробиотический коктейль VSL # 3 и Bifidobacterium animalis , . , 102 для облегчения отдельных симптомов СРК (например, вздутие живота, метеоризм и запор) и только несколько продуктов, влияющих на боль и общие симптомы. 80 , 103 - 105 Прочие продукты не принесли пользы. 106 , 107

Ожирение, метаболический синдром, неалкогольная жировая болезнь печени и неалкогольный стеатогепатит

Несколько механизмов, вовлекающих микробиоту в патогенез неалкогольной жировой болезни печени (НАЖБП) и неалкогольного стеатогепатита (НАСЖ) были идентифицированы. В частности, широко исследовалась роль микробиоты в связи с диетой в патогенезе ожирения как такового. 108 , 109 Соответствующие результаты включают способность грамотрицательных анаэробов, таких как Bacteriodes thetaiotami-cron , расщеплять большинство гликозидных связей и разлагать полисахариды растений, тем самым обеспечивая хозяина от 10% до 15% его теплотворная способность. 108 - 111 Микробиота людей с ожирением, а также микробиота слепой кишки мышей ob / ob более эффективны при извлечении энергии из рациона и производстве SCFAs. 110 , 112 Кроме того, было показано, что микробиота стимулирует выработку триглицеридов в печени путем подавления ингибитора липопротеинлипазы (LPL), жирового фактора, индуцированного натощак (также известного как ангиопоэтин-подобный 4), что приводит к продолжающаяся экспрессия LPL, ключевого регулятора высвобождения жирных кислот из триглицеридов в печени. 113 Микробиота кишечника также может модулировать системный липидный метаболизм посредством модификации паттернов метаболизма желчных кислот, что также напрямую влияет на свойства эмульгирования и абсорбции желчных кислот и, таким образом, косвенно на накопление жирных кислот в печени.Микробиота также участвует в развитии инсулинорезистентности, 113 , фундаментальной аномалии метаболического синдрома, влияя на энергетический баланс, метаболизм глюкозы и слабое воспалительное состояние, которое ассоциируется с ожирением и связанными с ним метаболическими нарушениями. Его роль в метаболизме холина, 114 - 116 , а также инактивация провоспалительных цитокинов (например, TNF-α), по-видимому, важна для развития НАЖБП и прогрессирования НАСГ.Совсем недавно исследования на экспериментальных моделях показали, что дефектное / недостаточное восприятие инфламмасом и связанный с ними дисбиоз приводят к аномальному накоплению бактериальных продуктов в портальном кровотоке и способствуют прогрессированию НАЖБП / НАСГ. 117

Более фундаментальная роль SIBO была предложена при НАЖБП, способствуя как стеатозу, так и воспалению 118 , 119 (). Потенциал микробов кишечного происхождения вызывать прогрессирующий и даже смертельный стеатогепатит был признан несколько лет назад в связи с повреждением печени, осложнившим операции тощего и подвздошного шунтирования при патологическом ожирении; действительно, эта процедура предоставила ценную экспериментальную модель для изучения влияния микробиоты на заболевание печени.

Флора кишечника (микробиота) и печень. Избыточный бактериальный рост в тонком кишечнике (SIBO), присутствующий при различных заболеваниях печени, и / или измененный состав микробиоты толстой кишки приводят к усиленному высвобождению провоспалительных цитокинов. Повышенная кишечная проницаемость, также хорошо описанная при заболеваниях печени, усиливает транслокацию бактерий, эндотоксинов или провоспалительных продуктов, таких как липополисахарид (из грамотрицательных бактерий), которые достигают печени через воротную вену или, при наличии портально-системного шунтирования. , получить прямой доступ к системному кровообращению.

Модуляция кишечной микробиоты: новая стратегия профилактики и лечения колоректального рака

  • 1.

    Брей Ф., Ферлей Дж., Сурджоматарам И., Сигель Р.Л., Торре Л.А., Джемаль А. Глобальная статистика рака 2018: оценки заболеваемости и смертности GLOBOCAN во всем мире 36 видов рака в 185 странах. CA Cancer J Clin. 2018; 68: 394–424.

    Артикул Google Scholar

  • 2.

    Arnold M, Sierra MS, Laversanne M, Soerjomataram I, Jemal A, Bray F.Глобальные закономерности и тенденции заболеваемости и смертности от колоректального рака. Кишечник. 2017; 66: 683–91.

    PubMed Статья Google Scholar

  • 3.

    Паркин Д.М., Бойд Л., Уокер Л. 16. Доля рака, связанная с образом жизни и факторами окружающей среды в Великобритании в 2010 году. Br J Cancer. 2011; 105: S77 – S81.

    PubMed PubMed Central Статья Google Scholar

  • 4.

    Gill SR, Pop M, Deboy RT, Eckburg PB, Turnbaugh PJ, Samuel BS, et al. Метагеномный анализ микробиома дистального отдела кишечника человека. Наука. 2006; 312: 1355–9.

    CAS PubMed PubMed Central Статья Google Scholar

  • 5.

    Кремер Г., Зитвогель Л. Иммунотерапия рака в 2017 году: прорыв микробиоты. Nat Rev Immunol. 2018; 18: 87–88.

    CAS PubMed Статья Google Scholar

  • 6.

    Ян Й, Вэн В, Пэн Дж, Хун Л., Ян Л, Тояма Й и др. Fusobacterium nucleatum увеличивает пролиферацию клеток колоректального рака и развитие опухолей у мышей за счет активации передачи сигналов toll-подобного рецептора 4 ядерному фактору-каппаB и активации экспрессии микроРНК-21. Гастроэнтерология. 2017; 152: 851–66 e824.

    CAS PubMed Статья Google Scholar

  • 7.

    Long X, Wong CC, Tong L, Chu ESH, Ho Szeto C, Go MYY, et al.Peptostreptococcus anaerobius способствует колоректальному канцерогенезу и модулирует опухолевый иммунитет. Nat Microbiol. 2019; 4: 2319–30.

    PubMed Статья CAS Google Scholar

  • 8.

    Чанг Л., Орберг Е.Т., Гейс А.Л., Чан Дж.Л., Фу К., ДеСтефано Шилдс С.Е. и др. Токсин Bacteroides fragilis координирует проканцерогенный воспалительный каскад, воздействуя на эпителиальные клетки толстой кишки. Клеточный микроб-хозяин. 2018; 23: 421.

    CAS PubMed PubMed Central Статья Google Scholar

  • 9.

    Рубинштейн MR, Ван X, Лю В, Хао Y, Цай Г, Хан YW. Fusobacterium nucleatum способствует колоректальному канцерогенезу, модулируя передачу сигналов E-кадгерин / бета-катенин через его адгезин FadA. Клеточный микроб-хозяин. 2013; 14: 195–206.

    CAS PubMed PubMed Central Статья Google Scholar

  • 10.

    Feng Q, Liang S, Jia H, Stadlmayr A, Tang L, Lan Z, et al. Развитие кишечного микробиома по последовательности колоректальной аденомы-карциномы.Nat Commun. 2015; 6: 6528.

    CAS PubMed Статья Google Scholar

  • 11.

    Dai Z, Coker OO, Nakatsu G, Wu WKK, Zhao L, Chen Z, et al. Многокогортный анализ метагенома колоректального рака выявил измененные бактерии в популяциях и универсальные бактериальные маркеры. Микробиом. 2018; 6: 70.

    PubMed PubMed Central Статья Google Scholar

  • 12.

    Mima K, Nishihara R, Qian ZR, Cao Y, Sukawa Y, Nowak JA и др. Fusobacterium nucleatum в ткани колоректального рака и прогноз пациента. Кишечник. 2016; 65: 1973–80.

    CAS PubMed Статья Google Scholar

  • 13.

    Yu T, Guo F, Yu Y, Sun T, Ma D, Han J, et al. Fusobacterium nucleatum способствует химической устойчивости к колоректальному раку, модулируя аутофагию. Клетка. 2017; 170: 548–63 e516.

    CAS PubMed PubMed Central Статья Google Scholar

  • 14.

    Гейер М.С., Батлер Р.Н., Ховарт Г.С. Пробиотики, пребиотики и синбиотики: роль в химиопрофилактике колоректального рака? Cancer Biol Ther. 2006; 5: 1265–9.

    CAS PubMed Статья Google Scholar

  • 15.

    Mackowiak PA. Переработка Мечникова: пробиотики, микробиом кишечника и поиски долгой жизни. Фронт общественного здравоохранения. 2013; 1:52.

    PubMed PubMed Central Статья Google Scholar

  • 16.

    Миллс JP, Рао К., Янг В.Б. Пробиотики для профилактики инфекции Clostridium difficile. Курр Опин Гастроэнтерол. 2018; 34: 3–10.

    CAS PubMed PubMed Central Статья Google Scholar

  • 17.

    Piewngam P, Zheng Y, Nguyen TH, Dickey SW, Joo HS, Villaruz AE, et al. Устранение патогена пробиотической палочкой Bacillus через сигнальное вмешательство. Природа. 2018; 562: 532–7.

    CAS PubMed PubMed Central Статья Google Scholar

  • 18.

    Камада Н., Ким Ю.Г., Шам ХП, Валланс Б.А., Пуэнте Дж.Л., Мартенс Э.С. и др. Регулируемая вирулентность контролирует способность патогена конкурировать с кишечной микробиотой. Наука. 2012; 336: 1325–9.

    CAS PubMed PubMed Central Статья Google Scholar

  • 19.

    Tuomola EM, Ouwehand AC, Salminen SJ. Влияние пробиотических бактерий на адгезию возбудителей к кишечной слизи человека. FEMS Immunol Med Microbiol. 1999; 26: 137–42.

    CAS PubMed Статья Google Scholar

  • 20.

    Кампана Р., Ван Хемерт С., Баффон В. Штамм-специфические пробиотические свойства молочнокислых бактерий и их вмешательство в инвазию кишечных патогенов человека. Gut Pathog. 2017; 9: 12.

    PubMed PubMed Central Статья Google Scholar

  • 21.

    Fayol-Messaoudi D, Berger CN, Coconnier-Polter MH, Lievin-Le Moal V, Servin AL.Активность пробиотических Lactobacilli против Salmonella enterica, Serovar Typhimurium, зависит от pH, молочной кислоты и немолочной кислоты. Appl Environ Microbiol. 2005. 71: 6008–13.

    CAS PubMed PubMed Central Статья Google Scholar

  • 22.

    Гиллор О., Эцион А, Райли Массачусетс. Двойная роль бактериоцинов как анти- и пробиотиков. Appl Microbiol Biotechnol. 2008. 81: 591–606.

    CAS PubMed PubMed Central Статья Google Scholar

  • 23.

    Klaenhammer TR, Kleerebezem M, Kopp MV, Rescigno M. Влияние пробиотиков и пребиотиков на иммунную систему. Nat Rev Immunol. 2012; 12: 728–34.

    CAS PubMed Статья Google Scholar

  • 24.

    Konieczna P, Groeger D, Ziegler M, Frei R, Ferstl R, Shanahan F, et al. Введение Bifidobacterium infantis 35624 индуцирует Т-регуляторные клетки Foxp3 в периферической крови человека: потенциальная роль миелоидных и плазматических дендритных клеток.Кишечник. 2012; 61: 354–66.

    CAS PubMed Статья Google Scholar

  • 25.

    Чон С.Г., Каяма Х., Уэда Й., Такахаши Т., Асахара Т., Цуджи Х. и др. Пробиотик Bifidobacterium breve индуцирует продуцирующие IL-10 клетки Tr1 в толстой кишке. PLoS Pathog. 2012; 8: e1002714.

    CAS PubMed PubMed Central Статья Google Scholar

  • 26.

    Гадими Д., Хельвиг У., Шрезенмейр Дж., Хеллер К.Дж., де Врез М.Эпигенетический импринтинг комменсальных пробиотиков ингибирует ось IL-23 / IL-17 в модели иммунной системы слизистой оболочки кишечника in vitro. J Leukoc Biol. 2012; 92: 895–911.

    CAS PubMed Статья Google Scholar

  • 27.

    Chen L, Zou Y, Peng J, Lu F, Yin Y, Li F и др. Lactobacillus acidophilus подавляет ассоциированную с колитом активацию оси IL-23 / Th27. J Immunol Res. 2015; 2015:

  • 4.

    PubMed PubMed Central Google Scholar

  • 28.

    Sichetti M, De Marco S, Pagiotti R, Traina G, Pietrella D. Противовоспалительный эффект многоплановой пробиотической композиции (L. rhamnosus, B. lactis и B. longum). Питание. 2018; 53: 95–102.

    CAS PubMed Статья Google Scholar

  • 29.

    Miller LE, Lehtoranta L, Lehtinen MJ. Влияние бифидобактерий животных ssp. lactis HN019 на клеточную иммунную функцию у здоровых пожилых людей: систематический обзор и метаанализ.Питательные вещества. 2017; 9: 191.

    PubMed Central Статья CAS Google Scholar

  • 30.

    Роча-Рамирес Л.М., Перес-Солано Р.А., Кастанон-Алонсо С.Л., Морено Герреро СС, Рамирес Пачеко А., Гарсия Гарибай М. и др. Штаммы пробиотических лактобацилл стимулируют воспалительную реакцию и активируют макрофаги человека. J Immunol Res. 2017; 2017: 4607491.

    CAS PubMed PubMed Central Статья Google Scholar

  • 31.

    Ленуар М., Дель Кармен С., Кортес-Перес Н.Г., Лозано-Ойалво Д., Муньос-Провенсио Д., Чейн F и др. Lactobacillus casei BL23 регулирует популяции Treg и Th27 Т-клеток и снижает колоректальный рак, связанный с ДМГ. J Gastroenterol. 2016; 51: 862–73.

    CAS PubMed Статья Google Scholar

  • 32.

    Jacouton E, Michel ML, Torres-Maravilla E, Chain F, Langella P, Bermudez-Humaran LG. Выяснение связанных с иммунитетом механизмов, с помощью которых пробиотический штамм Lactobacillus casei BL23 проявляет противоопухолевые свойства.Front Microbiol. 2018; 9: 3281.

    PubMed Статья Google Scholar

  • 33.

    Chen CC, Lin WC, Kong MS, Shi HN, Walker WA, Lin CY, et al. Пероральная инокуляция пробиотиков Lactobacillus acidophilus NCFM подавляет рост опухоли как при сегментарном ортотопическом раке толстой кишки, так и вне кишечной ткани. Br J Nutr. 2012; 107: 1623–34.

    CAS PubMed Статья Google Scholar

  • 34.

    Сандерс М.Э., Бенсон А., Лебир С., Меренштейн Д.Д., Клаенхаммер Т.Р. Общие механизмы среди таксонов пробиотиков: значение для общих требований к пробиотикам. Curr Opin Biotechnol. 2018; 49: 207–16.

    CAS PubMed Статья Google Scholar

  • 35.

    Mohamadzadeh M, Pfeiler EA, Brown JB, Zadeh M, Gramarossa M, Managlia E, et al. Регулирование индуцированного воспаления толстой кишки Lactobacillus acidophilus с дефицитом липотейхоевой кислоты.Proc Natl Acad Sci USA. 2011; 108 (Приложение 1): 4623–30.

    CAS PubMed Статья Google Scholar

  • 36.

    Khazaie K, Zadeh M, Khan MW, Bere P, Gounari F, Dennis K и др. Преодоление полипоза рака толстой кишки, вызванного Lactobacillus acidophilus с дефицитом липотейхоевой кислоты. Proc Natl Acad Sci USA. 2012; 109: 10462–7.

    CAS PubMed Статья Google Scholar

  • 37.

    Soler AP, Miller RD, Laughlin KV, Carp NZ, Klurfeld DM, Mullin JM. Повышенная проницаемость плотных соединений связана с развитием рака толстой кишки. Канцерогенез. 1999; 20: 1425–31.

    CAS PubMed Статья Google Scholar

  • 38.

    Пуппа MJ, White JP, Sato S, Cairns M, Baynes JW, Carson JA. Дисфункция кишечного барьера на мышиной модели кахексии рака толстой кишки Apc (Min / +). Biochim Biophys Acta. 2011; 1812: 1601–6.

    CAS PubMed PubMed Central Статья Google Scholar

  • 39.

    Ахмад Р., Кумар Б., Чен З., Чен Х, Мюллер Д., Леле С.М. и др. Потеря экспрессии клаудина-3 индуцирует передачу сигналов IL6 / gp130 / Stat3, что способствует злокачественному развитию рака толстой кишки за счет гиперактивации передачи сигналов Wnt / бета-катенин. Онкоген. 2017; 36: 6592–604.

    CAS PubMed PubMed Central Статья Google Scholar

  • 40.

    Alvarez CS, Badia J, Bosch M, Gimenez R, Baldoma L. Везикулы внешней мембраны и растворимые факторы, высвобождаемые пробиотиком escherichia coli nissle 1917 и комменсалом ECOR63, усиливают барьерную функцию, регулируя экспрессию белков плотного соединения в эпителиальных клетках кишечника. Front Microbiol. 2016; 7: 1981.

    PubMed PubMed Central Google Scholar

  • 41.

    Зайрек А.А., Цишон С., Хелмс С., Эндерс С., Зонненборн Ю., Шмидт М.А.Молекулярные механизмы, лежащие в основе пробиотических эффектов Escherichia coli Nissle 1917, включают перераспределение ZO-2 и PKCzeta, приводящее к восстановлению плотных контактов и эпителиального барьера. Cell Microbiol. 2007; 9: 804–16.

    CAS PubMed Статья Google Scholar

  • 42.

    Ван Л., Цао Х., Лю Л., Ван Б., Уокер В.А., Акра С.А. и др. Активация рецептора эпидермального фактора роста опосредует продукцию муцина, стимулируемую p40, белком, производным от Lactobacillus rhamnosus GG.J Biol Chem. 2014; 289: 20234–44.

    CAS PubMed PubMed Central Статья Google Scholar

  • 43.

    Martin R, Chamignon C, Mhedbi-Hajri N, Chain F, Derrien M, Escribano-Vazquez U, et al. Потенциальный пробиотический штамм Lactobacillus rhamnosus CNCM I-3690 защищает кишечный барьер, стимулируя выработку слизи и цитопротекторный ответ. Научный доклад 2019; 9: 5398.

    PubMed PubMed Central Статья CAS Google Scholar

  • 44.

    Кумар М., Киссун-Сингх В., Кориа А.Л., Моро Ф., Чейди К. Смесь пробиотиков VSL # 3 уменьшает воспаление толстой кишки и улучшает барьерную функцию кишечника у мышей с дефицитом муцина Muc2. Am J Physiol Gastrointest Liver Physiol. 2017; 312: G34 – G45.

    PubMed Статья Google Scholar

  • 45.

    Кэннон Дж., Ли Т., Боланос Дж., Данцигер Л. Патогенетическая значимость Lactobacillus: ретроспективный обзор более 200 случаев. Eur J Clin Microbiol Infect Dis.2005; 24: 31–40.

    CAS PubMed Статья Google Scholar

  • 46.

    Дорон С, Снидман ДР. Риск и безопасность пробиотиков. Clin Infect Dis. 2015; 60: S129 – S134.

    PubMed PubMed Central Статья Google Scholar

  • 47.

    Hassan H, Rompola M, Glaser A, Kinsey SE, Phillips R. Систематический обзор и метаанализ, изучающий эффективность и безопасность пробиотиков у людей с онкологическими заболеваниями.Поддержка лечения рака. 2018; 26: 2503–9.

    PubMed Статья Google Scholar

  • 48.

    Ситараман Р. Прокариотический горизонтальный перенос генов в человеческом холобионте: эколого-эволюционные выводы, последствия и возможности. Микробиом. 2018; 6: 1–14.

    Артикул Google Scholar

  • 49.

    Hu Y, Yang X, Qin J, Lu N, Cheng G, Wu N, et al. Полнометагеномный анализ генов устойчивости к антибиотикам в большой когорте кишечной микробиоты человека.Nat Commun. 2013; 4: 2151.

    PubMed Статья CAS Google Scholar

  • 50.

    Сандерс М.Э., Аккерманс Л.М., Халлер Д., Хаммерман С., Хаймбах Дж. Т., Хёрманнспергер Г. и др. Оценка безопасности пробиотиков для использования человеком. Кишечные микробы. 2010; 1: 164–85.

    PubMed PubMed Central Статья Google Scholar

  • 51.

    Чанг Л., Чжан З-И, Ке Д, Цзянь-Пин И, Сяо-Куй Г.Устойчивость к антибиотикам пробиотических штаммов молочнокислых бактерий, выделенных из продаваемых пищевых продуктов и лекарств. Biomed Environ Sci. 2009; 22: 401–12.

    Артикул Google Scholar

  • 52.

    Геймонд М., Санчес Б., де лос Рейес-Гавилан К.Г., Марголлес А. Устойчивость к антибиотикам у пробиотических бактерий. Front Microbiol. 2013; 4: 202.

    PubMed PubMed Central Статья Google Scholar

  • 53.

    Якобсен Л., Уилкс А., Хаммер К., Хюис Дж., Геверс Д., Андерсен С.Р. Горизонтальный перенос плазмид устойчивости tet (M) и erm (B) от пищевых штаммов Lactobacillus plantarum к Enterococcus faecalis Jh3-2 в желудочно-кишечном тракте гнотобиотических крыс. FEMS Microbiol Ecol. 2007. 59: 158–66.

    CAS PubMed Статья Google Scholar

  • 54.

    Туми Н., Монаган А., Фаннинг С., Болтон Ди-джей. Оценка передачи устойчивости к противомикробным препаратам между молочнокислыми бактериями и потенциальными патогенами пищевого происхождения с использованием методов in vitro и скрещивания в пищевой матрице.Foodborne Pathog Dis. 2009. 6: 925–33.

    CAS PubMed Статья Google Scholar

  • 55.

    Гибсон GR, Роберфроид МБ. Диетическая модуляция микробиоты толстой кишки человека: введение в понятие пребиотиков. J Nutr. 1995; 125: 1401–12.

    CAS Статья PubMed Google Scholar

  • 56.

    Гибсон Г.Р., Хаткинс Р., Сандерс М.Э., Прескотт С.Л., Реймер Р.А., Салминен С.Дж. и др.Документ о консенсусе экспертов: Консенсусное заявление Международной научной ассоциации пробиотиков и пребиотиков (ISAPP) по определению и сфере применения пребиотиков. Нат Рев Гастроэнтерол Гепатол. 2017; 14: 491–502.

    PubMed Статья Google Scholar

  • 57.

    Гибсон Г.Р., Фуллер Р. Аспекты исследовательских подходов in vitro и in vivo, направленных на определение пробиотиков и пребиотиков для использования человеком. J Nutr. 2000; 130 (2S Доп.): 391S – 395S.

    CAS PubMed Статья Google Scholar

  • 58.

    Девульф Э.М., Кани П.Д., Клаус С.П., Фуэнтес С., Пуйларт П.Г., Нейринк А.М. и др. Понимание концепции пребиотиков: уроки двойного слепого исследовательского исследования фруктанов инулиноподобного типа у женщин с ожирением. Кишечник. 2013; 62: 1112–21.

    CAS PubMed Статья Google Scholar

  • 59.

    Azcarate-Peril MA, Ritter AJ, Savaiano D, Monteagudo-Mera A, Anderson C, Magness ST, et al.Влияние короткоцепочечных галактоолигосахаридов на микробиом кишечника людей с непереносимостью лактозы. Proc Natl Acad Sci USA. 2017; 114: E367 – E375.

    CAS PubMed Статья Google Scholar

  • 60.

    Maier TV, Lucio M, Lee LH, VerBerkmoes NC, Brislawn CJ, Bernhardt J, et al. Влияние диетического резистентного крахмала на микробиом кишечника человека, метапротеом и метаболом. MBio. 2017; 8: e01343–01317.

    CAS PubMed PubMed Central Статья Google Scholar

  • 61.

    Линдси Дж.О., Уилан К., Стэг А.Дж., Гобин П., Аль-Хасси Х.О., Реймент Н. и др. Клинические, микробиологические и иммунологические эффекты фруктоолигосахарида у пациентов с болезнью Крона. Кишечник. 2006; 55: 348–55.

    CAS PubMed PubMed Central Статья Google Scholar

  • 62.

    Вонг Дж. М., Де Соуза Р., Кендалл С. В., Эмам А., Дженкинс Д. Д.. Здоровье толстой кишки: ферментация и жирные кислоты с короткой цепью. J Clin Gastroenterol. 2006; 40: 235–43.

    CAS PubMed Статья Google Scholar

  • 63.

    Канани Р., Ди Костанцо М., Леоне Л., Педата М., Мели Р., Калиньяно А. Потенциальные положительные эффекты бутирата при кишечных и внекишечных заболеваниях. Мир Дж. Гастроэнтерол. 2011; 17: 1519.

    CAS PubMed PubMed Central Статья Google Scholar

  • 64.

    Тонг L-c WangY, Wang Z-b LiuW-y, Sun S, Li L, et al.Пропионат облегчает колит, вызванный декстрансульфатом натрия, улучшая барьерную функцию кишечника и уменьшая воспаление и окислительный стресс. Front Pharm. 2016; 7: 253.

    Google Scholar

  • 65.

    Фукуда С., Тох Х, Хасе К., Осима К., Наканиши Ю., Йошимура К. и др. Бифидобактерии могут защитить от энтеропатогенной инфекции за счет выработки ацетата. Природа. 2011; 469: 543.

    CAS PubMed Статья Google Scholar

  • 66.

    Forchielli ML, Walker WA. Роль лимфоидной ткани, связанной с кишечником, и защиты слизистой оболочки. Br J Nutr. 2005; 93: S41 – S48.

    CAS PubMed Статья Google Scholar

  • 67.

    Шоаф К., Малви Г.Л., Армстронг Г.Д., Хаткинс Р.В. Пребиотические галактоолигосахариды снижают адгезию энтеропатогенной кишечной палочки к клеткам культуры ткани. Infect Immun. 2006. 74: 6920–8.

    CAS PubMed PubMed Central Статья Google Scholar

  • 68.

    Monteagudo-Mera A, Rastall RA, Gibson GR, Charalampopoulos D, Chatzifragkou A. Механизмы адгезии, опосредованные пробиотиками и пребиотиками, и их потенциальное влияние на здоровье человека. Appl Microbiol Biotechnol. 2019; 103: 6463–72.

    CAS PubMed PubMed Central Статья Google Scholar

  • 69.

    Ито Х., Такемура Н., Сонояма К., Кавагиси Х., Топпинг Д.Л., Конлон М.А. и др. Степень полимеризации фруктанов инулиноподобного типа по-разному влияет на количество молочнокислых бактерий, иммунные функции кишечника и секрецию иммуноглобулина А в слепой кишке крысы.J. Agric Food Chem. 2011; 59: 5771–8.

    CAS PubMed Статья Google Scholar

  • 70.

    Белчева А., Ирразабал Т., Робертсон С.Дж., Стрейткер С., Моган Х., Рубино С. и др. Микробный метаболизм кишечника управляет трансформацией эпителиальных клеток толстой кишки с дефицитом MSh3. Клетка. 2014; 158: 288–99.

    CAS PubMed Статья Google Scholar

  • 71.

    Бултман С.Дж., Джобин К.Бутират микробного происхождения: онкометаболит или метаболит, подавляющий опухоль? Клеточный микроб-хозяин. 2014; 16: 143–5.

    CAS PubMed PubMed Central Статья Google Scholar

  • 72.

    Сингх В., Сан Йео Б., Чассайн Б., Сяо Х, Саха П., Ольвера Р.А. и др. Нарушение регуляции микробной ферментации растворимой клетчатки вызывает холестатический рак печени. Клетка. 2018; 175: 679–94. e622.

    CAS PubMed PubMed Central Статья Google Scholar

  • 73.

    Константинов С.Р., Койперс Э.Дж., Пеппеленбош М.П. Функциональный геномный анализ микробиоты кишечника для скрининга CRC. Нат Рев Гастроэнтерол Гепатол. 2013; 10: 741.

    CAS PubMed Статья Google Scholar

  • 74.

    Ян Ф, Полк ДБ. Характеристика растворимого белка, полученного из пробиотиков, которая раскрывает механизм профилактического и лечебного воздействия пробиотиков на воспалительные заболевания кишечника. Кишечные микробы. 2012; 3: 25–28.

    PubMed PubMed Central Статья Google Scholar

  • 75.

    Ван И, Лю Л., Мур DJ, Шен Х, Пик Р., Акра С.А. и др. Белок, производный от LGG, способствует выработке IgA за счет усиления экспрессии APRIL в эпителиальных клетках кишечника. Mucosal Immunol. 2017; 10: 373.

    CAS PubMed Статья Google Scholar

  • 76.

    Де Марко С., Сичетти М., Мурадян Д., Пиччони М., Трэйна Г., Паджиотти Р. и др.Бесклеточные пробиотические супернатанты проявляли противовоспалительную и антиоксидантную активность в отношении эпителиальных клеток кишечника человека и макрофагов, стимулированных LPS. Evid Based Complement Altern Med. 2018; 2018: 1756308.

    Артикул Google Scholar

  • 77.

    Bermudez-Brito M, Muñoz-Quezada S, Gomez-Llorente C, Matencio E, Bernal MJ, Romero F, et al. Бесклеточный супернатант культуры Bifidobacterium breve CNCM I-4035 снижает провоспалительные цитокины в дендритных клетках человека, зараженных Salmonella typhi, посредством активации TLR.PLoS ONE. 2013; 8: e59370.

    CAS PubMed PubMed Central Статья Google Scholar

  • 78.

    Гао Дж, Ли Й, Ван Й, Ху Т, Лю Л., Ян С. и др. Новый постбиотик из Lactobacillus rhamnosus GG, благотворно влияющий на барьерную функцию кишечника. Front Microbiol. 2019; 10: 477.

    PubMed PubMed Central Статья Google Scholar

  • 79.

    Чен З-И, Се И-М, Хуанг Ц-Ц, Цай Ц-Ц.Подавляющее действие пробиотика Lactobacillus на рост линии клеток карциномы толстой кишки человека HT-29. Молекулы. 2017; 22: 107.

    PubMed Central Статья CAS Google Scholar

  • 80.

    Escamilla J, Lane MA, Maitin V. Бесклеточные супернатанты от пробиотических Lactobacillus casei и Lactobacillus rhamnosus GG уменьшают инвазию клеток рака толстой кишки in vitro. Nutr Cancer. 2012; 64: 871–8.

    CAS PubMed Статья Google Scholar

  • 81.

    Кониси Х., Фудзия М., Танака Х., Уэно Н., Мориити К., Сасадзима Дж. И др. Феррихром, полученный из пробиотиков, подавляет прогрессирование рака толстой кишки через JNK-опосредованный апоптоз. Nat Commun. 2016; 7: 12365.

    CAS PubMed PubMed Central Статья Google Scholar

  • 82.

    Zackular JP, Baxter NT, Iverson KD, Sadler WD, Petrosino JF, Chen GY, et al. Микробиом кишечника модулирует онкогенез толстой кишки. MBio. 2013; 4: e00692–00613.

    PubMed PubMed Central Статья CAS Google Scholar

  • 83.

    Cao H, Xu M, Dong W, Deng B, Wang S, Zhang Y, et al. Вторичный дисбактериоз, вызванный желчными кислотами, способствует канцерогенезу кишечника. Int J Cancer. 2017; 140: 2545–56.

    CAS PubMed Статья Google Scholar

  • 84.

    Zackular JP, Baxter NT, Chen GY, Schloss PD. Манипуляции с микробиотой кишечника выявляют роль в онкогенезе толстой кишки. мСфера. 2016; 1: e00001–00015.

    PubMed Статья Google Scholar

  • 85.

    DeStefano Shields CE, Ван Меербеке SW, Хуссо Ф, Ван Х, Хусо Д.Л., Касеро Р.А. Младший и др. Снижение онкогенеза толстой кишки мышей, вызванное энтеротоксигенными Bacteroides fragilis, с использованием лечения цефокситином. J Infect Dis. 2016; 214: 122–9.

    CAS PubMed PubMed Central Статья Google Scholar

  • 86.

    Ijssennagger N, Belzer C, Hooiveld GJ, Dekker J, van Mil SW, Müller M, et al. Микробиота кишечника способствует индуцированной диетой гиперпролиферации эпителия гемом, открывая слизистый барьер в толстой кишке.Proc Natl Acad Sci USA. 2015; 112: 10038–43.

    CAS PubMed Статья Google Scholar

  • 87.

    Хаттори Н., Нива Т., Исида Т., Кобаяси К., Имаи Т., Мори А. и др. Антибиотики подавляют онкогенез толстой кишки за счет ингибирования аберрантного метилирования ДНК в модели колита с азоксиметаном и декстрансульфатом натрия. Cancer Sci. 2019; 110: 147.

    CAS PubMed Статья Google Scholar

  • 88.

    Bullman S, Pedamallu CS, Sicinska E, Clancy TE, Zhang X, Cai D, et al. Анализ персистенции Fusobacterium и ответа на антибиотики при колоректальном раке. Наука. 2017; 358: 1443–8.

    CAS PubMed PubMed Central Статья Google Scholar

  • 89.

    Тринер Д., Девенпорт С. Н., Рамакришнан С. К., Ма Х, Фрилер Р. А., Гринсон Дж. К. и др. Нейтрофилы ограничивают микробиоту, связанную с опухолями, чтобы уменьшить рост и инвазию опухолей толстой кишки у мышей.Гастроэнтерология. 2019; 156: 1467–82.

    PubMed Статья Google Scholar

  • 90.

    Сетхи В., Куртом С., Тарик М., Лавания С., Мальчиоди З., Хельмунд Л. и др. Микробиота кишечника способствует росту опухоли у мышей, модулируя иммунный ответ. Гастроэнтерология. 2018; 155: 33–37. e36.

    CAS PubMed PubMed Central Статья Google Scholar

  • 91.

    Vetizou M, Pitt JM, Daillere R, Lepage P, Waldschmitt N, Flament C, et al.Противораковая иммунотерапия путем блокады CTLA-4 зависит от микробиоты кишечника. Наука. 2015; 350: 1079–84.

    CAS PubMed PubMed Central Статья Google Scholar

  • 92.

    Сиван А., Корралес Л., Хуберт Н., Уильямс Дж. Б., Акино-Майклс К., Эрли З. М. и др. Commensal Bifidobacterium способствует противоопухолевому иммунитету и повышает эффективность против PD-L1. Наука. 2015; 350: 1084–9.

    CAS PubMed PubMed Central Статья Google Scholar

  • 93.

    Routy B, Le Chatelier E, Derosa L, Duong CP, Alou MT, Daillère R и др. Микробиом кишечника влияет на эффективность иммунотерапии на основе PD-1 против эпителиальных опухолей. Наука. 2018; 359: 91–97.

    CAS Статья PubMed Google Scholar

  • 94.

    Iida N, Dzutsev A, Stewart CA, Smith L, Bouladoux N, Weingarten RA, et al. Комменсальные бактерии контролируют реакцию рака на терапию, модулируя микросреду опухоли. Наука.2013; 342: 967–70.

    CAS PubMed PubMed Central Статья Google Scholar

  • 95.

    Ван Ф, Инь Кью, Чен Л., Дэвис ММ. Bifidobacterium может смягчать кишечную иммунопатологию в контексте блокады CTLA-4. Proc Natl Acad Sci USA. 2018; 115: 157–61.

    CAS PubMed Статья Google Scholar

  • 96.

    Zhao S, Gao G, Li W, Li X, Zhao C, Jiang T, et al.Антибиотики связаны со сниженной эффективностью терапии анти-PD-1 / PD-L1 у китайских пациентов с распространенным немелкоклеточным раком легкого. Рак легких. 2019; 130: 10–17.

    PubMed Статья Google Scholar

  • 97.

    Derosa L, Hellmann M, Spaziano M, Halpenny D, Fidelle M, Rizvi H, et al. Отрицательная связь антибиотиков с клинической активностью ингибиторов иммунных контрольных точек у пациентов с прогрессирующим почечно-клеточным и немелкоклеточным раком легкого.Энн Онкол. 2018; 29: 1437–44.

    CAS PubMed PubMed Central Статья Google Scholar

  • 98.

    Килккинен А., Риссанен Х., Клаукка Т., Пуккала Е., Хелиёваара М., Хуовинен П. и др. Использование антибиотиков предсказывает повышенный риск рака. Int J Cancer. 2008; 123: 2152–5.

    CAS PubMed Статья Google Scholar

  • 99.

    Dik VK, van Oijen MG, Smeets HM, Siersema PD.Частое использование антибиотиков связано с риском колоректального рака: результаты вложенного исследования случай – контроль. Dig Dis Sci. 2016; 61: 255–64.

    CAS PubMed Статья Google Scholar

  • 100.

    Уиллинг Б.П., Рассел С.Л., Финли ББ. Сдвиг баланса: влияние антибиотиков на взаимопонимание между хозяином и микробиотой. Nat Rev Microbiol. 2011; 9: 233.

    CAS PubMed Статья Google Scholar

  • 101.

    Цао И, Ву К., Мехта Р., Дрю Д.А., Сонг М., Лочхед П. и др. Длительный прием антибиотиков и риск колоректальной аденомы. Кишечник. 2018; 67: 672–8.

    CAS PubMed Статья Google Scholar

  • 102.

    Кириаку Д.Н., Льюис Р.Дж. Сноски по показаниям в клинических исследованиях. ДЖАМА. 2016; 316: 1818–9.

    PubMed Статья Google Scholar

  • 103.

    Smits LP, Bouter KE, de Vos WM, Borody TJ, Nieuwdorp M.Лечебный потенциал трансплантации фекальной микробиоты. Гастроэнтерология. 2013; 145: 946–53.

    PubMed Статья Google Scholar

  • 104.

    Weingarden AR, Vaughn BP. Кишечная микробиота, трансплантация фекальной микробиоты и воспалительные заболевания кишечника. Кишечные микробы. 2017; 8: 238–52.

    PubMed PubMed Central Статья Google Scholar

  • 105.

    Россхарт С.П., Вассалло Б.Г., Анджелетти Д., Хатчинсон Д.С., Морган А.П., Такеда К. и др.Микробиота кишечника диких мышей улучшает физическую форму хозяина и повышает сопротивляемость болезням. Клетка. 2017; 171: 1015–28. e1013.

    CAS PubMed PubMed Central Статья Google Scholar

  • 106.

    Ван З-К, Ян И-С, Чен Й, Юань Дж, Сунь Г, Пэн Л-Х. Патогенез кишечной микробиоты и трансплантация фекальной микробиоты при воспалительном заболевании кишечника. Мир Дж. Гастроэнтерол. 2014; 20: 14805.

    CAS PubMed PubMed Central Статья Google Scholar

  • 107.

    Управление по санитарному надзору за качеством пищевых продуктов и медикаментов. Важное предупреждение относительно использования фекальной микробиоты для трансплантации и риска серьезных побочных реакций из-за трансмиссии организмов с множественной лекарственной устойчивостью. Управление по санитарному надзору за качеством пищевых продуктов и медикаментов, Мэриленд, Мэриленд, 2019 г. https://www.fda.gov/vaccines-blood-biologics/safety-availability-biologics/important-safety-alert-regarding-use-fecal-microbiota-transplantation-and -риск-серьезные-неблагоприятные.

  • 108.

    Шварц М., Глюк М., Кун С. Норовирусный гастроэнтерит после трансплантации фекальной микробиоты для лечения инфекции Clostridium difficile, несмотря на бессимптомных доноров и отсутствие контактов с больными.Am J Gastroenterol. 2013; 108: 1367.

    PubMed Статья Google Scholar

  • 109.

    Quera R, Espinoza R, Estay C, Rivera D. Бактериемия как нежелательное явление трансплантации фекальной микробиоты у пациента с болезнью Крона и рецидивирующей инфекцией Clostridium difficile. Колит Дж. Крона. 2014; 8: 252–3.

    PubMed Статья Google Scholar

  • 110.

    Хоманн Э.Л., Анантакришнан А.Н., Дешпанде В.Случай 25-2014: мужчина 37 лет с язвенным колитом и кровавым поносом. N. Engl J Med. 2014; 371: 668–75.

    CAS PubMed Статья Google Scholar

  • 111.

    Секиров I, Russell SL, Antunes LCM, Finlay BB. Микробиота кишечника в здоровье и болезнях. Physiol Rev.2010; 90: 859–904.

    CAS PubMed Статья Google Scholar

  • 112.

    Ридаура В.К., Фейт Дж. Дж., Рей Ф. Е., Ченг Дж., Дункан А. Э., Кау А. Л. и др.Микробиота кишечника близнецов, не согласных с ожирением, модулирует метаболизм у мышей. Наука. 2013; 341: 1241214.

    PubMed Статья CAS Google Scholar

  • 113.

    Аланг Н, Келли ЧР. Увеличение веса после трансплантации фекальной микробиоты. Открытый форум Infect Dis. 2015; 2: ofv004.

    PubMed PubMed Central Статья Google Scholar

  • 114.

    Gregory JC, Buffa JA, Org E, Wang Z, Levison BS, Zhu W. и др.Передача предрасположенности к атеросклерозу при трансплантации кишечных микробов. J Biol Chem. 2015; 290: 5647–60.

    CAS PubMed Статья Google Scholar

  • 115.

    Скай С.М., Чжу В., Романо К.А., Го С.Дж., Ван З., Цзя Х и др. Микробной трансплантации кишечных комменсалов человека, содержащих CutC, достаточно для передачи повышенной реактивности тромбоцитов и потенциала тромбоза. Circ Res. 2018; 123: 1164–76.

    CAS PubMed PubMed Central Статья Google Scholar

  • 116.

    Амбалам П., Раман М., Пурама Р.К., Добл М. Пробиотики, пребиотики и профилактика колоректального рака. Best Pr Res Clin Gastroenterol. 2016; 30: 119–31.

    Артикул Google Scholar

  • 117.

    Chen Z-F, Ai L-Y, Wang J-L, Ren L-L, Yu Y-N, Xu J, et al. Пробиотики Clostridium butyricum и Bacillus subtilis улучшают онкогенез кишечника. Future Microbiol. 2015; 10: 1433–45.

    PubMed Статья CAS Google Scholar

  • 118.

    Gamallat Y, Meyiah A, Kuugbee ED, Hago AM, Chiwala G, Awadasseid A, et al. Lactobacillus rhamnosus индуцирует апоптоз эпителиальных клеток, уменьшает воспаление и предотвращает развитие рака толстой кишки на животной модели. Biomed Pharmacother. 2016; 83: 536–41.

    CAS PubMed Статья Google Scholar

  • 119.

    Kuugbee ED, Shang X, Gamallat Y, Bamba D, Awadasseid A, Suliman MA, et al. Структурные изменения микробиоты с помощью пробиотического коктейля усиливают барьер кишечника и снижают риск рака за счет передачи сигналов TLR2 в модели рака толстой кишки на крысах.Dig Dis Sci. 2016; 61: 2908–20.

    CAS PubMed Статья Google Scholar

  • 120.

    Стропила Дж., Беннетт М., Кадерни Дж., Клун И., Хьюз Р., Карлссон П.С. и др. Диетические синбиотики снижают факторы риска рака у пациентов с полипэктомией и раком толстой кишки. Am J Clin Nutr. 2007. 85: 488–96.

    CAS PubMed Статья Google Scholar

  • 121.

    Исикава Х., Акедо И., Отани Т., Сузуки Т., Накамура Т., Такеяма И. и др.Рандомизированное исследование применения пищевых волокон и Lactobacillus casei для профилактики колоректальных опухолей. Int J Cancer. 2005; 116: 762–7.

    CAS PubMed Статья Google Scholar

  • 122.

    Сангилд П.Т., Шен Р.Л., Понтоппидан П., Рат М. Животные модели индуцированного химиотерапией мукозита: актуальность и проблемы для трансляции. Am J Physiol Gastrointest Liver Physiol. 2017; 314: G231 – G246.

    PubMed Статья CAS Google Scholar

  • 123.

    Yeung C-Y, Chan W-T, Jiang C-B, Cheng M-L, Liu C-Y, Chang S-W и др. Улучшение вызванного химиотерапией кишечного мукозита пероральным введением пробиотиков на мышиной модели. PLoS ONE. 2015; 10: e0138746.

    PubMed PubMed Central Статья CAS Google Scholar

  • 124.

    Mi H, Dong Y, Zhang B, Wang H, Peter CC, Gao P, et al. Bifidobacterium infantis облегчает вызванный химиотерапией мукозит кишечника посредством регулирования Т-клеточного иммунитета у крыс с колоректальным раком.Cell Physiol Biochem. 2017; 42: 2330–41.

    CAS PubMed Статья Google Scholar

  • 125.

    Чанг К-В, Лю Си-И, Ли Х-К, Хуанг И-Х, Ли Л-Х, Чиау Дж. СК и др. Пробиотик Lactobacillus casei разновидности rhamnosus превентивно ослабляет вызванное 5-фторурацилом / оксалиплатином повреждение кишечника на модели сингенного колоректального рака. Front Microbiol. 2018; 9: 983.

    PubMed PubMed Central Статья Google Scholar

  • 126.

    Сауткотт Э., Тули К., Ховарт Дж., Дэвидсон Дж., Батлер Р. Йогурты, содержащие пробиотики, уменьшают нарушение тонкого кишечного барьера у крыс, получавших метотрексат. Dig Dis Sci. 2008; 53: 1837.

    CAS PubMed Статья Google Scholar

  • 127.

    Lin XB, Farhangfar A, Valcheva R, Sawyer MB, Dieleman L, Schieber A, et al. Роль кишечной микробиоты в развитии токсичности иринотекана и в снижении токсичности за счет пищевых волокон у крыс.PLoS ONE. 2014; 9: e83644.

    PubMed PubMed Central Статья CAS Google Scholar

  • 128.

    Li H-L, Lu L, Wang X-S, Qin L-Y, Wang P, Qiu S-P, et al. Изменение микробиоты кишечника и профилей воспалительных цитокинов / хемокинов при кишечном мукозите, вызванном 5-фторурацилом. Front Cell Infect Microbiol. 2017; 7: 455.

    PubMed PubMed Central Статья CAS Google Scholar

  • 129.

    Cui M, Xiao H, Li Y, Zhou L, Zhao S, Luo D, et al. Трансплантация фекальной микробиоты защищает от радиационной токсичности. EMBO Mol Med. 2017; 9: 448–61.

    CAS PubMed PubMed Central Статья Google Scholar

  • 130.

    Salva S, Marranzino G, Villena J, Agüero G, Alvarez S. Пробиотические штаммы Lactobacillus защищают от миелосупрессии и иммуносупрессии у мышей, получавших циклофосфамид. Int Immunopharmacol.2014; 22: 209–21.

    CAS PubMed Статья Google Scholar

  • 131.

    Мего М., Чованец Дж., Вочьянова-Андрезалова И., Конколовский П., Микулова М., Рецкова М. и др. Профилактика диареи, вызванной иринотеканом, с помощью пробиотиков: рандомизированное двойное слепое плацебо-контролируемое пилотное исследование. Дополнение Ther Med. 2015; 23: 356–62.

    PubMed Статья Google Scholar

  • 132.

    Эстерлунд П., Руотсалайнен Т., Корпела Р., Сакселин М., Оллус А., Валта П. и др. Добавка Lactobacillus при диарее, связанной с химиотерапией колоректального рака: рандомизированное исследование. Br J Рак. 2007; 97: 1028–34.

    PubMed PubMed Central Статья CAS Google Scholar

  • 133.

    Делия П., Санзотта Дж., Донато В., Фрозина П., Мессина Дж., Де Рензис С. и др. Использование пробиотиков для профилактики диареи, вызванной радиацией.Мир Дж. Гастроэнтерол. 2007; 13: 912.

    CAS PubMed PubMed Central Статья Google Scholar

  • 134.

    Demers M, Dagnault A, Desjardins J. Рандомизированное двойное слепое контролируемое исследование: влияние пробиотиков на диарею у пациентов, получавших тазовое облучение. Clin Nutr. 2014; 33: 761–7.

    PubMed Статья Google Scholar

  • 135.

    Yang Y, Xia Y, Chen H, Hong L, Feng J, Yang J и др.Эффект периоперационного лечения пробиотиками колоректального рака: краткосрочные результаты рандомизированного контролируемого исследования. Oncotarget. 2016; 7: 8432.

    PubMed PubMed Central Статья Google Scholar

  • 136.

    Лю З., Цинь Х., Ян З., Ся И, Лю В., Ян Дж. И др. Рандомизированное клиническое исследование: влияние периоперационного лечения пробиотиками на барьерную функцию и послеоперационные инфекционные осложнения при хирургии колоректального рака - двойное слепое исследование.Алимент Фарм Тер. 2011; 33: 50–63.

    CAS Статья Google Scholar

  • 137.

    Лю З.-Х, Хуанг М.-Дж., Чжан Х-З, Ван Л., Хуанг Н.-Кью, Пэн Х и др. Влияние периоперационного лечения пробиотиками на концентрацию зонулина в сыворотке и последующие послеоперационные инфекционные осложнения после хирургического вмешательства при колоректальном раке: двухцентровое и двойное слепое рандомизированное клиническое исследование. Am J Clin Nutr. 2012; 97: 117–26.

    PubMed Статья CAS Google Scholar

  • 138.

    Kotzampassi K, Stavrou G, Damoraki G, Georgitsi M, Basdanis G, Tsaousi G, et al. Схема из четырех пробиотиков снижает послеоперационные осложнения после колоректальной хирургии: рандомизированное двойное слепое плацебо-контролируемое исследование. Мир J Surg. 2015; 39: 2776–83.

    PubMed Статья Google Scholar

  • 139.

    Захаруддин Л., Мохтар Н.М., Навави КНМ, Али РАР. Рандомизированное двойное слепое плацебо-контролируемое исследование пробиотиков при послеоперационном колоректальном раке.BMC Gastroenterol. 2019; 19: 131.

    PubMed PubMed Central Статья CAS Google Scholar

  • 140.

    TAPER HS, ROBERFROID MB. Возможна адъювантная терапия рака двумя пребиотиками - инулином или олигофруктозой. Vivo. 2005; 19: 201–4.

    CAS Google Scholar

  • 141.

    Геллер Л.Т., Барзили-Рокни М., Данино Т., Йонас О.Х., Шентал Н., Нейман Д. и др. Возможная роль внутриопухолевых бактерий в опосредовании устойчивости опухоли к химиотерапевтическому препарату гемцитабину.Наука. 2017; 357: 1156–60.

    CAS PubMed PubMed Central Статья Google Scholar

  • 142.

    Viaud S, Saccheri F, Mignot G, Yamazaki T., Daillère R, Hannani D, et al. Микробиота кишечника модулирует противоопухолевые иммунные эффекты циклофосфамида. Наука. 2013; 342: 971–6.

    CAS PubMed PubMed Central Статья Google Scholar

  • 143.

    Daillère R, Vétizou M, Waldschmitt N, Yamazaki T., Isnard C, Poirier-Colame V, et al. Enterococcus hirae и Barnesiella gastinihominis способствуют терапевтическому иммуномодулирующему действию, вызванному циклофосфамидом. Иммунитет. 2016; 45: 931–43.

    PubMed Статья CAS Google Scholar

  • 144.

    Гопалакришнан В., Спенсер С., Нези Л., Рубен А., Эндрюс М., Карпинец Т. и др. Микробиом кишечника модулирует ответ на иммунотерапию против PD-1 у пациентов с меланомой.Наука. 2018; 359: 97–103.

    CAS Статья PubMed Google Scholar

  • 145.

    Скотт А.Дж., Александр Дж.Л., Меррифилд Калифорния, Каннингем Д., Джобин С., Браун Р. и др. Консенсусное заявление Международного консорциума по раковым микробиомам о роли микробиома человека в канцерогенезе. Кишечник. 2019; 68: 1624–32. gutjnl-2019-318556

    CAS PubMed PubMed Central Статья Google Scholar

  • 146.

    Crook N, Ferreiro A, Gasparrini AJ, Pesesky MW, Gibson MK, Wang B и др. Адаптивные стратегии кандидата в пробиотики E. coli Nissle в кишечнике млекопитающих. Клеточный микроб-хозяин. 2019; 25: 499–512. e498.

    CAS PubMed PubMed Central Статья Google Scholar

  • 147.

    Шин В., Ким Х.Дж. Дисфункция кишечного барьера управляет началом воспалительного взаимодействия между хозяином и микробиомом при воспалении кишечника человека на чипе.Proc Natl Acad Sci USA. 2018; 115: E10539 – E10547.

    CAS PubMed Статья Google Scholar

  • Кишечная микробиота (кишечная флора) | Inserm

    Хроническое воспалительное заболевание кишечника (ВЗК) , такое как болезнь Крона и язвенный колит , связано с неправильной активацией иммунной системы кишечника. Его начало вызвано основными генетическими факторами и факторами окружающей среды (диета, возраст и т. Д.).). В то же время улучшение симптомов у пациентов, получающих антибактериальную терапию, и разрешение воспалительных поражений кишечника у людей, кишечная стенка которых больше не контактирует с фекалиями (отведение фекалий), также указывает на роль микробиоты.

    Микробиота , несбалансированная с точки зрения провоспалительных и противовоспалительных видов бактерий и преобладающей природы определенных классов бактерий ( энтеробактерии, фузобактерии ) или редкой природы других видов ( Clostridia , Faecalibacterium ) были описаны у лиц, страдающих ВЗК.В настоящее время невозможно установить, является ли это причиной или следствием этих заболеваний, или определить, является ли дисбактериоз, стоящий за заболеванием, врожденным или результатом другого фактора окружающей среды (диета, лекарства и т. Д.). Была выдвинута привлекательная гипотеза: считается, что дисбактериоз развивается из-за влияния генетических факторов и факторов окружающей среды, но, по-видимому, играет роль в запуске, поддержании и степени тяжести воспаления, что приводит к порочному кругу.

    Кроме того, среди десятков генов предрасположенности к ВЗК, идентифицированных в настоящее время, некоторые играют решающую роль в отношении микробиоты. Мутация гена NOD2 чаще всего наблюдается у пациентов, страдающих болезнью Крона: этот ген кодирует рецептор врожденного иммунитета, ответственный за обнаружение компонента бактериальной стенки. После мутации он больше не может выполнять эту функцию или помогать сохранять кишечный барьер. Сообщалось о других мутациях, например, в отношении гена ATG16L1 , участвующего в аутофагии иммунных клеток в присутствии бактерий, или гена MUC2 , который играет роль в синтезе кишечной слизи.

    Микробиота является одной из предпочтительных терапевтических мишеней при этих воспалительных заболеваниях. До сих пор первые клинические испытания, проведенные с пробиотиками или пребиотиками, были безрезультатными. Однако ожидаются новые исследования, основанные на более рациональном выборе используемых микроорганизмов или соединений. В то же время некоторые команды пытаются создать генетически модифицированных пробиотиков , которые позволили бы имплантировать интересующий микроорганизм, придавая ему дополнительные свойства, такие как секреция иммуномодулирующих медиаторов.

    Развитие кишечной микробиоты младенца

    Abstract

    Почти сразу после рождения человека возникает новая микробная экосистема, которая находится в желудочно-кишечном тракте этого человека. Несмотря на то, что это универсальная и неотъемлемая часть биологии человека, временное развитие этого процесса, источники микробов, составляющих экосистему, как и почему она меняется от одного младенца к другому, и как состав этой экосистемы влияет на человека. физиология, развитие и болезни все еще плохо изучены.В качестве шага к систематическому исследованию этих вопросов мы разработали микроматрицу для обнаружения и количественного определения последовательностей генов малых субъединиц рибосомной РНК (SSU рРНК) большинства известных в настоящее время видов и таксономических групп бактерий. Мы использовали этот микрочип вместе с секвенированием клонированных библиотек рДНК SSU, амплифицированных с помощью ПЦР, для профилирования микробных сообществ в среднем по 26 образцам стула от 14 здоровых доношенных новорожденных, включая пару дизиготных близнецов, начиная с первый стул после рождения и продолжающийся через определенные промежутки времени в течение первого года жизни.Чтобы исследовать возможное происхождение детской микробиоты, мы также составили профили вагинальных образцов и молока от большинства матерей, а также образцов кала от всех матерей, большинства отцов и двух братьев и сестер. Состав и временные паттерны микробных сообществ широко варьировались от ребенка к ребенку. Несмотря на значительные временные различия, отличительные черты микробного сообщества каждого ребенка можно было распознать в течение нескольких недель или месяцев. Поразительно параллельные временные паттерны близнецов предполагают, что случайные воздействия окружающей среды играют важную роль в определении отличительных характеристик микробного сообщества каждого ребенка.К концу первого года жизни идиосинкразические микробные экосистемы у каждого ребенка, хотя и различны, сходились к профилю, характерному для желудочно-кишечного тракта взрослого.

    Сведения об авторе

    Уже почти столетие было признано, что люди населены удивительно плотной и разнообразной микробной экосистемой, но мы только начинаем понимать и ценить многие роли, которые эти микробы играют в здоровье и развитии человека.Знание состава этой экосистемы - решающий шаг к пониманию ее роли. В этом исследовании мы разработали и применили подход на основе микрочипов рибосомальной ДНК для отслеживания развития кишечной флоры у 14 здоровых доношенных детей в течение первого года жизни. Мы обнаружили, что состав и временные паттерны микробных сообществ широко варьировались от ребенка к ребенку, поддерживая более широкое определение здоровой колонизации, чем считалось ранее. К одному году младенцы сохранили свою уникальность, но приблизились к профилю, характерному для желудочно-кишечного тракта взрослого человека.Состав и временные модели развития кишечной микробиоты у пары разнояйцевых близнецов были поразительно похожи, что позволяет предположить, что генетические факторы и факторы окружающей среды формируют нашу кишечную микробиоту воспроизводимым образом.

    Образец цитирования: Палмер С., Бик Е.М., ДиДжиулио Д.Б., Релман Д.А., Браун П.О. (2007) Развитие кишечной микробиоты у младенцев человека. PLoS Biol 5 (7): e177. https://doi.org/10.1371/journal.pbio.0050177

    Академический редактор: Иджун Руан, Институт генома Сингапура, Сингапур

    Поступила: 22 января 2007 г .; Принята к печати: 4 мая 2007 г .; Опубликован: 26 июня 2007 г.

    Это статья в открытом доступе, распространяемая в соответствии с условиями декларации Creative Commons Public Domain, которая предусматривает, что после размещения в общественном достоянии эта работа может быть свободно воспроизведена, распространена, передана, модифицированы, созданы на основе или иным образом использованы кем-либо в любых законных целях.

    Финансирование: Эта работа финансировалась Фондом Хорна и Медицинским институтом Говарда Хьюза.

    Конкурирующие интересы: ПОБ, исследователь Медицинского института Говарда Хьюза.

    Сокращения: GI, желудочно-кишечный тракт; нт, нуклеотид; ОТУ, оперативная таксономическая единица; prokMSA, выравнивание множественных прокариотических последовательностей; КПЦР, количественная ПЦР; рДНК, рибосомная ДНК; рРНК, рибосомальная РНК; СГУ, г. малая единица

    Введение

    Тело взрослого человека обычно содержит в десять раз больше микробных клеток, чем человеческих клеток, в основном из-за чрезвычайно высокой плотности микробов, обнаруженных в кишечном тракте человека (обычно 10 11 –10 12 микробов / мл просвета. содержание).Эта микробная экосистема выполняет множество важных функций для своего хозяина-человека, включая защиту от патогенов, обработку питательных веществ, стимуляцию ангиогенеза и регулирование накопления жира в организме хозяина [1–7]. Понятно, что этот список еще не полный; по мере расширения этой области исследований мы постоянно открываем для себя новые роли и отношения. Исследования на мышах-гнотобиотах были особенно полезными, демонстрируя важную роль микробиоты желудочно-кишечного тракта (ЖКТ) в нормальном развитии кишечника [2,5].Кроме того, многие заболевания как у взрослых, так и у младенцев имеют известную или предполагаемую связь с микробиотой желудочно-кишечного тракта, включая рак желудка [8], лимфому лимфоидной ткани, ассоциированную со слизистой оболочкой [9], воспалительное заболевание кишечника [10,11] и некротический энтероколит [ 12,13].

    Состав микробиоты ЖКТ взрослых был интенсивно изучен с использованием как культивирования, так и, в последнее время, методов на основе последовательности малых субъединиц (SSU) рибосомной ДНК (рДНК), не зависящих от культуры [14]. Одна только экосистема толстой кишки человека насчитывает более 400 видов бактерий, принадлежащих к ограниченному числу широких таксономических подразделений [15].Было обнаружено, что представители анаэробных родов Bacteroides, Eubacterium, Clostridium, Ruminococcus, и Faecalibacterium обычно составляют подавляющее большинство микробного сообщества кишечника взрослых людей. Тем не менее, кишечник каждого взрослого человека, по-видимому, имеет уникальное микробное сообщество со структурой, которая остается стабильной в течение нескольких месяцев [3,15,16].

    Напротив, микробиота желудочно-кишечного тракта младенцев более изменчива по своему составу и менее стабильна с течением времени. На первом году жизни кишечный тракт младенца прогрессирует от бесплодия до чрезвычайно плотной колонизации, заканчиваясь смесью микробов, которая в целом очень похожа на ту, что обнаруживается в кишечнике взрослого [17].Хотя начальная и конечная точки этого временного отрезка хорошо определены, путь между этими точками плохо понят. В литературе имеются противоречивые сообщения о составе микробиоты ЖКТ новорожденных и факторах, которые его формируют. В нескольких исследованиях сообщалось, что бифидобактерии почти всегда доминируют в микробиоте ЖКТ грудных детей в возрасте нескольких недель [17–20], в то время как другие обнаружили, что они встречаются только у небольшой части младенцев или не являются преобладающими численно [21, 22].Влияние диеты на состав микробиоты желудочно-кишечного тракта младенцев также является спорным - многочисленные исследования показали более низкую численность Bifidobacteria и более высокую численность аэробных бактерий в микробиоте желудочно-кишечного тракта младенцев, вскармливаемых смесью, по сравнению с младенцами, вскармливаемыми грудью [ 20,21,23–25], однако в других отчетах такой разницы не обнаружено [26,27]. Способ доставки часто упоминается как один из ключевых факторов, формирующих микробиоту младенца [18,28,29]. Сообщалось, что микробиота желудочно-кишечного тракта младенцев, рожденных с помощью кесарева сечения, отличается от микробиоты младенцев, рожденных естественным путем, как по времени колонизации, так и по составу [18,30–32], а в некоторых случаях имеются явные следы материнского микробиота влагалища в микробиоте желудочно-кишечного тракта новорожденных [33], однако относительная важность способа доставки для микробиоты желудочно-кишечного тракта неясна.Из-за увеличения частоты проблем с желудочно-кишечным трактом у недоношенных детей, влияние гестационного возраста также широко изучалось. Эти исследования неизменно показывают, что микробиота госпитализированных недоношенных детей отличается от микробиоты здоровых доношенных детей [32,34–36]. Попытки связать определенные микробы с возникновением некротического энтероколита, состояния с подозрением на бактериальную этиологию, которое является важной причиной заболеваемости и смертности недоношенных детей, дали неоднозначные результаты [32,36].Очевидно, что еще многое предстоит узнать о происхождении и развитии микробиоты желудочно-кишечного тракта младенцев и ее влиянии на здоровье и болезни.

    Мы сосредоточили наше исследование на описании ряда профилей, составляющих здоровую микробиоту желудочно-кишечного тракта младенцев, в надежде обнаружить темы, которые управляют ее развитием, а также предоставить подробный справочник и прочную основу для последующих исследований, посвященных изучению факторов, влияющих на Микробиота ЖКТ. В нашем исследовании участвовали 14 здоровых доношенных детей, рожденных от 13 здоровых матерей (включая одну группу разнояйцевых близнецов) (Таблица 1).Образцы стула собирали в соответствии с установленным графиком, начиная с первого стула после рождения: образцы собирали сначала ежедневно, а затем с уменьшающейся частотой в течение 1 года, с дополнительным отбором образцов вокруг ключевых событий (например, введение твердой пищи и введение антибиотиков), что дает в среднем 26 образцов стула на каждого ребенка (Таблица 2). Кроме того, у родителей, братьев и сестер были взяты образцы стула, а у матерей - вагинальные мазки и грудное молоко.Мы проанализировали микробиоту каждого из этих образцов с использованием недавно разработанной микроматрицы рДНК SSU, предназначенной для почти полного охвата известных видов рДНК SSU. Подмножество этих образцов было также проанализировано секвенированием библиотеки клонов рДНК SSU с целью калибровки и проверки наших результатов на микрочипах.

    Результаты

    Сравнение профилей бактериальных популяций на основе микрочипов и последовательностей

    Чтобы изучить состав нашего набора образцов и обеспечить основу для количественной калибровки результатов микроматрицы, мы создали контрольный пул, объединив равные количества амплифицированной рДНК SSU из каждого образца, способного амплифицироваться с помощью ПЦР (за исключением образцов, собранных, когда младенцы были ≥1 года).Мы получили 3 458 высококачественных последовательностей клонов из библиотеки, созданной из этого пула, и таксономически присвоили каждой последовательности с помощью классификатора проекта базы данных рибосом [37]. Таксономическое распределение этих последовательностей суммировано в Таблице 3.

    Чтобы оценить эффективность нашего нового дизайна микроматрицы относительно секвенирования рДНК SSU, мы секвенировали рДНК SSU, амплифицированные из каждого из 12 индивидуальных биологических образцов, полученных в этом исследовании, выбранных по их разнообразным профилям с помощью анализа микроматрицы 16S рДНК.Этот набор исследований включал ДНК, выделенную из восьми детских стула, двух материнских стула, одного вагинального мазка и одного образца грудного молока. Для каждого из этих образцов мы амплифицировали последовательности рДНК SSU с использованием тех же праймеров ПЦР, которые использовались в анализе микроматрицы, затем клонировали и секвенировали несколько сотен (среднее = 342) амплифицированных продуктов для всего 4100 последовательностей.

    Мы сосредоточили наше сравнение на уровнях 2, 3 и 4 иерархии прокариотического множественного выравнивания последовательностей (prokMSA), которые очень приблизительно соответствуют уровням типа, класса и порядка в классической таксономической иерархии.На этих более широких уровнях ожидается, что большинство последовательностей будут иметь гомологию по крайней мере с одним зондом в нашем текущем дизайне микроматрицы, и последовательности рДНК, как правило, можно однозначно классифицировать. Оценки относительной численности на основе микрочипов были получены для 2149 видов и таксономических групп путем объединения данных от всех зондов, которые представляли любое подмножество рассматриваемого класса, как полностью описано в разделе «Материалы и методы». Оценки на основе последовательностей были получены путем таксономической классификации каждой последовательности путем присвоения кода операционной таксономической единицы (OTU) prokMSA наилучшего соответствия BLAST в базе данных prokMSA 2004 года из 86 453 последовательностей гена рибосомной РНК (рРНК) SSU [38] (наборы данных S1 и S2 ).Хотя относительную численность бактериального вида нельзя точно определить из его пропорционального представительства в пуле амплифицированных последовательностей рДНК, мы ожидаем, что такие оценки должны быть точными в пределах порядка величины и обычно в пределах нескольких раз [39–41], на основе предыдущих исследований, в которых сравнивали уровни численности, оцененные на основе секвенирования ампликонов рДНК SSU, с подсчетами на основе гибридизации in situ.

    В целом результаты микроматрицы были очень похожи на результаты, полученные путем секвенирования, как качественно, так и количественно.На рисунке 1А показано сравнение профилей сообществ каждого из 12 образцов, полученных в результате нашего анализа микрочипов и путем секвенирования, для каждой таксономической группы на уровне 2 таксономического дерева prokMSA. Обратите внимание, что уровни (например, уровень 2) в таксономии prokMSA не имеют последовательного соответствия уровням (например, типу) в классической таксономической иерархии, и, таким образом, некоторые из традиционных имен, связанных с группами уровня 2 prokMSA, могут выглядеть несколько несочетаемый. Как анализ последовательностей, так и анализ микроматрицы показали, что в образцах преобладает ограниченное число таксономических групп - 99% из 4100 последовательностей охватываются всего тремя из 22 подразделений prokMSA уровня 2: 2.15 (Flexibacter-Cytophaga-Bacteroides), 2,28 (Proteobacteria) и 2,30 (грамположительные бактерии [включая Firmicutes и Actinobacteria]), а оставшийся 1% принадлежал к группам 2,10 (Prosthecobacter), 2,29 (Fusobacteria) , или 2,21 (цианобактерии и хлоропласты). Как показано на рис. 1B и 1C, профили популяции, полученные с помощью микроматрицы и анализа секвенирования, также были количественно схожи - корреляция Пирсона оценок относительной численности на основе микрочипов и секвенирования для 12 образцов была равна 0.97 на таксономическом уровне 2 prokMSA (рис. 1В), 0,89 на уровне 3 (рис. 1С) и 0,80 на уровне 4 (неопубликованные данные).

    Рис. 1. Сравнение профилей сообществ на основе микрочипов и секвенирования

    Полученные с помощью микрочипов и результаты секвенирования оценки численности таксономических групп сравниваются для 12 биологических образцов.

    (A) Сравниваются оценки численности для всех таксонов prokMSA уровня 2, измеренные на массиве. Каждый столбец представляет собой один биологический образец, а каждая строка соответствует одной таксономической группе, идентифицируемой (справа от каждой строки) своим числовым кодом prokMSA OTU вместе с примерно соответствующим условным названием группы.

    (B) Сравнение оценок относительной численности на основе последовательностей и микрочипов для таксономических групп уровня 2 в 12 образцах (то же, что и в [A]). Ось x представляет относительную численность, оцененную по частоте клонов из данной таксономической группы, а ось y представляет относительную численность, оцененную с помощью профилирования микроматрицы.

    (C) То же, что (B) для таксономических групп уровня 3.

    https://doi.org/10.1371/journal.pbio.0050177.g001

    Абсолютное количественное определение бактерий

    Мы оценили общую плотность бактерий в каждом образце с помощью количественного ПЦР (кПЦР) в реальном времени, используя широкий набор бактериальных праймеров и зондов (см. «Материалы и методы»). Мы использовали общее количество копий гена рРНК (обычно около пяти на геном [42]) на грамм стула, как оценивалось с помощью этого анализа, чтобы приблизительно определить общую плотность бактерий. Как показано на рисунке 2, общее количество копий гена рРНК было относительно нестабильным в течение первой недели жизни, а затем сохранялось у большинства младенцев в диапазоне от 10 9 до 10 10 / г стула (сырой вес).Хотя явного влияния метода родоразрешения на время колонизации не наблюдалось, следует отметить, что младенцы 13 и 14 лет (близнецы с дизиготом), которые были единственными младенцами, родившимися с помощью планового кесарева сечения и, следовательно, без разрыва околоплодных вод. мембрана и воздействие микробиоты родовых путей матери во время схваток или родоразрешения имели низкое количество бактерий (<10 8 копий гена рРНК / г) до седьмого дня жизни.

    Рисунок 2. Изменение общей плотности фекальных бактерий в течение первого года жизни.

    Для каждого образца ребенка численность бактерий оценивалась с помощью TaqMan ПЦР в реальном времени с универсальными бактериальными праймерами. Расчетные копии гена рРНК на грамм фекалий ( x -ось) нанесены на график как функция от дней жизни ( x -ось). Обе оси имеют логарифмическую шкалу. Измерения обилия усечены по нижнему краю до значения, соответствующего 95-му процентилю экстракционных (отрицательных) контролей (количество копий, скорректированное на среднюю массу стула). Эпизоды антибактериального или противогрибкового (нистатин) лечения обозначены на временной оси серыми или розовыми полосами соответственно (дополнительную информацию см. В Таблице 1).

    https://doi.org/10.1371/journal.pbio.0050177.g002

    Обзор профилей популяции бактерий на основе микрочипов

    Мы проанализировали бактериальный состав 430 образцов - 363 образца детского стула, 43 образца стула взрослых, 2 образца стула братьев и сестер, 12 образцов грудного молока и 10 материнских вагинальных мазков - путем гибридизации с микрочипом ДНК, разработанным в этом исследовании. Объединив информацию по нескольким зондам (см. Материалы и методы), мы получили оценки относительной численности для 2149 вложенных таксономических групп и видов в каждой из этих выборок (все зонды перечислены в наборе данных S3; все таксоны перечислены в наборе данных S4).Как показано на рисунке 3, разнообразие на уровне филумов в образцах стула, проанализированных в этом исследовании, было чрезвычайно ограниченным. В подавляющем большинстве образцов преобладали всего три из 22 бактериальных групп уровня 2, представленных нашим микрочипом: 2,15 (Flexibacter-Cytophaga-Bacteroides), 2,28 (Proteobacteria) и 2,30 (грамположительные бактерии [Firmicutes и Actinobacteria] ). Вторым важным открытием стала замечательная степень индивидуальных различий в процессе колонизации. Хотя таксоны, населяющие желудочно-кишечный тракт младенца, были ограничены на самых широких уровнях, каждый ребенок отличался сочетанием видов микробов, которые он приобрел и поддерживал, а также точным временным паттерном, в котором эти виды появлялись и исчезали. Bacteroides, , например, доминировали в ранней микробиоте некоторых младенцев, но практически отсутствовали на этой стадии у других младенцев. Третьей поразительной особенностью этого набора данных была относительная стабильность микробных популяций с течением времени - даже на ранних этапах колонизации желудочно-кишечного тракта младенца большинство таксономических групп сохранялось в течение интервалов от недель до месяцев.

    Рисунок 3. Обзор профилей микробных сообществ всех образцов

    Каждый столбец ( n = 430) представляет один биологический образец, а каждая строка ( n = 2 149) представляет одну таксономическую группу или вид.Выборки организованы во временном порядке, начиная с рождения слева и любых выборок, полученных от матери или других семей, справа от каждого временного курса. Клинья над столбцами пронумерованы в соответствии с идентификатором ребенка. Строки (таксоны) сортируются по их числовым кодам, так что подгруппы данной группы лежат непосредственно под более общей группой (например, 2.15, затем 2.15.1, затем 2.15.1.1). Символы «>» и «>>» добавляются к названиям помеченных таксономических групп, которые являются подгруппами на уровне 3 или уровне 4, соответственно, помеченной таксономической группы уровня 2.Увеличение темноты шкалы серого соответствует более высокому расчетному относительному содержанию.

    https://doi.org/10.1371/journal.pbio.0050177.g003

    Основными измерениями различий между профилями колонизации различных таксономических групп были время колонизации и временная стабильность. В соответствии с предыдущими исследованиями [28,35,43,44], первыми колонизаторами часто были организмы, которые, как предполагалось, были аэробами (например, Staphylococcus, Streptococcus, и Enterobacteria), тогда как более поздние колонизаторы, как правило, были строгими анаэробами (Eubacteria и Клостридия) . Бактероиды сильно различались от ребенка к ребенку по времени своего первого появления, но в некоторой степени постоянно присутствовали почти у всех младенцев к 1 году. Несколько других таксонов, в том числе Prevotella, Acinetobacter, Desulfovibrio, Veillonella, и Clostridium perfringens, , как правило, появлялись временно, иногда появляясь и исчезая повторно в течение первого года жизни ребенка.

    Сходства и различия между профилями населения

    Мы исследовали сходства и различия в составе всех наших выборок путем иерархической кластеризации 430 выборок на основе их сходства в отношении их профилей численности для набора из 53 таксономических групп prokMSA уровня 4, которые имели как минимум две выборки с относительной оценка численности более 1%.Схема кластеризации, отраженная в дендрограмме в верхней части рисунка 4, выделяет несколько важных особенностей программы колонизации и показывает, что микробиота стула детей в возрасте 1 года и старше заметно отличается от таковой в более раннем возрасте и намного больше. похож на взрослых. До 6 мес. Образцы стула имели тенденцию группироваться по каждому ребенку, что указывает на то, что различия от ребенка к ребенку намного больше, чем изменения в течение недель или месяцев в составе микробиоты любого отдельного ребенка.Было два заметных исключения из этой кластеризации, ориентированной на ребенка. Во-первых, образцы первых нескольких дней жизни часто сгруппированы вдали от остальных образцов данного ребенка, иногда сгруппировавшись с другими очень ранними образцами, а иногда с образцами из других мест (например, ребенок 8-го дня 1 с образцами из влагалища). Во-вторых, образцы от младенцев 13 и 14, которые являются разнояйцевыми близнецами, имели тенденцию смешиваться. На рисунке 4B показаны примеры нескольких описанных выше шаблонов кластеризации.

    Рисунок 4.Кластеризация выборок на основе профилей популяций наиболее распространенных и многочисленных таксонов

    (A) Каждый столбец ( n = 430) представляет один биологический образец, а каждая строка ( n = 52) представляет одну таксономическую группу или вид четвертого уровня. для двух или более образцов оценки относительной численности превышали 1%. Представлены все образцы, включая образцы стула от младенцев, родителей и братьев и сестер, а также образцы молока и влагалища. Образцы были сгруппированы по центрированной корреляции Пирсона, так что столбцы, представляющие наиболее похожие образцы, сгруппированы вместе, тогда как таксономические группы (строки) сортируются численно, а не кластеризоваться.Увеличение темноты шкалы серого соответствует более высокому расчетному относительному содержанию. Значения представляют собой log 2 относительной численности.

    (B) Отобранные кластеры, иллюстрирующие, что (1) профили из ранних образцов детского стула группируются по ребенку, (2) образцы очень раннего ребенка группируются с образцами от матери и (3) образцы из пары разнояйцевых близнецов группируются вместе и смешиваются.

    https://doi.org/10.1371/journal.pbio.0050177.g004

    Большинство образцов грудного молока и материнского влагалища идеально сгруппированы по анатомическим участкам происхождения.Как и ожидалось, во всех вагинальных образцах, кроме одного, преобладали лактобациллы, включая Staphylococci , Bacteroides, Clostridia и Veillonella среди групп, которые в разной степени присутствовали как составляющие меньшинства. Влагалищный образец от одной из матерей (матери ребенка 11) имел отчетливо другой профиль популяции, в котором преобладали представители группы гамма-протеобактерий. Популяции микробов, обнаруженные в образцах молока, были разнообразными, часто включая смеси кишечных бактерий и видов Bacteroides, Pseudomonas, Haemophilus, Veillonella, и Streptococcus .

    Для более систематического сравнения младенцев мы определили выборку ближайших соседей для каждой выборки, измеренную с помощью корреляции Пирсона оценок относительной численности четвертого уровня. Используя эту метрику, выборка ближайшего соседа любой данной выборки ребенка обычно была другой выборкой от того же ребенка - средний процент выборок от данного ребенка, для которых наиболее похожая выборка была от того же ребенка, составляла 82%. Рисунок 5 суммирует этот анализ и иллюстрирует интересный вывод о том, что по этому показателю наиболее похожей парой младенцев были младенцы 13 и 14 лет - разнояйцевые близнецы, воспитанные в одной и той же среде - 8 из 23 (35%) ближайших младенцев 13 - образцы соседей были взяты от ребенка 14 (следующей наиболее похожей парой были дети 11 и 14 лет - 17%).

    Рис. 5. Сходство микробиоты у младенцев

    Для каждой пары образцов мы рассчитали образцы ближайшего соседа в соответствии с корреляцией Пирсона профилей относительной численности уровня 4. Затем для каждого ребенка мы вычислили, какой процент выборок ближайшего соседа был получен от каждого ребенка. Оттенок серого указывает процент образцов из детского Y (столбец), которые были ближайшими соседями образцов из детского X (строка), так что суммы строк составляют 100%.

    https: // doi.org / 10.1371 / journal.pbio.0050177.g005

    Временные тенденции

    Сходство профилей микробных сообществ в образцах стула младенцев 1 года и старше друг с другом и с образцами стула взрослых свидетельствует о том, что сообщества желудочно-кишечного тракта младенцев со временем сошлись в сторону обобщенной «взрослой» микробиоты. Мы исследовали этот феномен, вычислив для каждого возрастного интервала среднюю попарную корреляцию Пирсона популяционных профилей всех выборок младенцев, собранных в этом возрасте.Как показано на рис. 6А, этот анализ показал, что с течением времени микробиота младенцев постоянно приближалась к общему профилю. Мы также рассчитали для каждой временной точки среднюю корреляцию выборок младенцев в этот момент времени с обобщенным профилем взрослого (центроид 18 выборок взрослых - девять отцов и девять матерей из этого исследования). Этот анализ, показанный на рисунке 6B, подтвердил, что профиль, к которому сходится микробиота младенцев, аналогичен профилю взрослых, и выявил очевидную тенденцию к перегруппировке популяции, которая происходит примерно через 5 дней после рождения.Примечательно, что микробиота желудочно-кишечного тракта младенцев не была значительно больше похожа на микробиоту их родителей, чем на микробиоту других взрослых, если судить по корреляциям Пирсона их таксономических профилей уровня 4 (средняя корреляция ребенок-родитель 0,55 для внутри семьи по сравнению с 0,62. между семьями для девяти «триад» одновременно полученных образцов от ребенка, матери и отца, полученных в возрасте 1–1,5 года).

    Рис. 6. Временные паттерны среднего попарного сходства профилей микробиоты детского стула

    (A) Сходство между младенцами во времени.Для каждой временной точки, для которой было профилировано не менее шести младенцев, мы рассчитали среднюю попарную корреляцию Пирсона между таксономическими профилями уровня 4 всех младенцев в этот момент времени. Также показана средняя парная корреляция Пирсона между этими профилями у 18 взрослых участников этого исследования (девять мужчин и девять женщин) (пустой кружок обозначен стрелкой).

    (B) Переход к взрослой флоре с течением времени. Для каждой временной точки, для которой был составлен профиль по крайней мере четырех младенцев, мы рассчитали среднюю корреляцию Пирсона между таксономическими профилями уровня 4 всех младенцев в этот момент времени и «общим взрослым» профилем.Общий профиль взрослого - это центроид 18 взрослых (девять мужчин и девять женщин) (родители в этом исследовании).

    https://doi.org/10.1371/journal.pbio.0050177.g006

    Чтобы визуализировать временные закономерности в определенных филогенетических группах, населяющих кишечник младенца, мы составили график относительной численности девяти таксономических групп уровня 4, которые имели средняя относительная численность 1% или более с течением времени у каждого младенца (рис. 7). Этот анализ позволил нам выявить общие темы и интересные различия между профилями колонизации этих младенцев.Во-первых, мы заметили, что «неравномерные» популяции (популяции, в которых преобладает одна таксономическая группа) были обычными в первые несколько недель, но редко в более поздние сроки. Другой примечательной особенностью временной программы многих младенцев было возникновение одного или нескольких резких сдвигов в структуре популяции - такие сдвиги часто стабилизировались в пределах одного интервала выборки. Нам не удалось идентифицировать какой-либо конкретный возраст или сигнальное событие, постоянно связанное с такими переходами, хотя переход к «взрослому» профилю часто сопровождал введение твердой пищи.

    Рис. 7. Временные профили наиболее обильных таксономических групп уровня 3

    Таксономические группы уровня 3 были выбраны для отображения, если их средняя (нормализованная) относительная численность по всем образцам детенышей превышала 1%. Ось x показывает дни с момента рождения и отображается в логарифмической шкале, а ось x показывает оценочную (нормализованную) относительную численность. Для некоторых младенцев значения для первых нескольких дней не отображаются, поскольку общее количество бактерий в образцах стула, собранных в эти дни, было недостаточным для анализа на основе микрочипов.

    https://doi.org/10.1371/journal.pbio.0050177.g007

    Несколько младенцев получали антибиотики либо в неонатальном периоде (дни 0–28), либо в более поздние месяцы (см. Таблицу 1 и Рисунок 2). Больше подробностей). В некоторых случаях лечение было связано с резким изменением плотности или состава микробиоты желудочно-кишечного тракта. Например, ребенок 8 получил два курса амоксициллина: один в 4 мес. И один в 6 мес. В обоих случаях как общая плотность бактерий (Рисунок 2), так и состав сообщества резко изменились (Рисунки 3 и 6).Действительно, у этого ребенка плотность бактерий в образцах кала снизилась настолько во время курсов антибиотиков, что мы не смогли амплифицировать достаточное количество рДНК SSU для анализа микрочипов, поэтому мы могли сравнивать популяции только до и после курса антибиотиков. Однако мы не выявили каких-либо устойчивых последствий лечения антибиотиками.

    Эксперименты по валидации микрочипов

    Результаты как анализа последовательности эталонного пула, так и анализа данных микроматрицы показали, что бифидобактерии были лишь второстепенными компонентами популяции - результат расходится с общепринятым мнением [20,21,26].Праймеры, которые мы использовали для широкодиапазонной ПЦР-амплификации контрольного пула (источник последовательностей), и образцы для анализа микрочипов были потенциально неоптимальными для амплификации Bifidobacteria [21,26] из-за трех несовпадений в последовательности рДНК Bifidobacterium longum и прямой праймер 8F, использованный в этом исследовании. Обзор 5'-последовательностей полноразмерных генов рДНК SSU показал, что бифидобактерии резко отличаются от обычно консервативной последовательности праймера 8F. Поэтому мы провели два независимых анализа, чтобы определить, нужно ли и каким образом корректировать количественные оценки бифидобактерий по результатам гибридизации микрочипов.Во-первых, мы количественно оценили относительную эффективность, с которой пара праймеров 8F / 1391R амплифицировала рДНК SSU из двух видов Bifidobacterium - Bifidobacterium longum и Bifidobacterium infantis - по сравнению с набором из трех различных распространенных фекальных бактерий - Escherichia coli, Clostridium perfringens, Bacteroides fragilis - все они имеют последовательности рДНК SSU с одним или несколькими несовпадениями с последовательностями праймеров 8F / 1391R ПЦР. Используя ряд стехиометрических смесей хромосомной ДНК, выделенных из этих видов, мы обнаружили, что после 20 циклов (количество циклов, использованных для наших анализов микроматриц и для амплификации контрольного пула перед секвенированием), эффективность амплификации двух видов бифидобактерий ДНК была в 8 раз ниже, чем у трех других видов, все из которых амплифицировались с почти одинаковой эффективностью (неопубликованные данные).Этот результат предполагает, что как результаты секвенирования контрольного пула, так и количественный анализ на основе микрочипов занижали численность группы бифидобактерий в восемь раз. Во-вторых, мы использовали анализ кПЦР в реальном времени с парой праймеров и зондом, оптимизированными для обнаружения бифидобактерий, чтобы получить независимую оценку численности бифидобактерий в каждом образце. Результаты подтвердили вывод микроматричного анализа о том, что бифидобактерии почти всегда были лишь второстепенными составляющими фекальной микробиоты как младенцев, так и взрослых в нашей исследуемой популяции (набор данных S5 и рисунок S1).

    Большинство видов бактерий, идентифицированных в нашем наборе образцов, ранее входили в состав микробиоты желудочно-кишечного тракта человека. Однако был ряд случаев, в которых результаты микроматрицы указывали на присутствие вида или группы бактерий, которые были неожиданными и не представлены в нашем пуле секвенированных эталонов. Мы исследовали несколько из этих случаев с помощью независимых тестов. Для 12 подозрительных видов / таксонов мы использовали специфичные для родственных групп праймеры в ПЦР-анализе, примененном к большинству или всем образцам, в которых подозреваемые виды / таксоны, по-видимому, присутствовали на основании результатов микроматрицы, а также небольшой набор образцов, в которых подозрительные виды не были обнаружены микрочипом.В одном случае, в случае Sutterella wadsworthia, секвенирование видоспецифичного продукта ПЦР подтвердило его присутствие. В семи из 12 случаев ни один из массивов положительных (или отрицательных) образцов не дал амплифицированного продукта при анализе ПЦР. В четырех оставшихся случаях анализ якобы видоспецифической ПЦР дал амплифицированный продукт ожидаемого размера, но клоны, секвенированные из этого продукта, не соответствовали ожидаемым видам. Мы дополнительно исследовали эти четыре случая путем секвенирования библиотеки клонов, полученной путем амплификации с теми же праймерами широкого диапазона, которые использовались при подготовке к анализу микрочипов.Хотя секвенирование не подтвердило присутствие какого-либо из четырех сомнительных видов / таксонов, оно предоставило убедительные доказательства основного источника ложноположительных сигналов гибридизации. В частности, в трех из четырех случаев мы идентифицировали относительно многочисленные виды, чья последовательность рДНК была достаточно похожа на последовательность зонда, что, вероятно, объясняло наблюдаемый сигнал. В одном случае (Legionella pneumophila), , присутствие которых прогнозировалось приблизительно в 1%, мы не смогли идентифицировать какие-либо виды-кандидаты, которые могли бы объяснить сигнал гибридизации (т.е.е., ни один с лучшими совпадениями BLAST ≥30 баллов) среди нашего набора из 192 последовательностей. Поскольку наша способность обнаруживать виды, присутствующие с частичной численностью 1%, составляла только 85%, остается возможным, что этот вид или другой вид со сходной последовательностью рДНК SSU мог присутствовать в небольшом количестве в подозрительных образцах.

    Обнаружение и количественная оценка грибов и архей

    Наши методы экстракции ДНК и амплификации рДНК были оптимизированы для бактерий и неоптимальны для эукариот и архей, поэтому мы отдельно проверили наличие и численность грибов или архей с помощью анализов кПЦР с широкой специфичностью для соответствующих таксономических групп.На основании нашего анализа количественной ПЦР, грибки периодически обнаруживались в образцах стула при относительно низкой численности (10 4 –10 6 генов рРНК / г сырой массы фекалий), сохраняющейся в течение различной продолжительности у отдельных детей в течение первого года жизни. . У одного из младенцев в этом исследовании (ребенок 10) была отмечена сыпь от подгузников, а также молочница во рту, которые обычно вызываются грибком (Candida), и лечились противогрибковыми препаратами (нистатин). ). Анализ qPCR обнаружил особенно высокие уровни грибковой рДНК в образцах стула этого ребенка, особенно в тот период, когда были описаны эти результаты.У матери этого ребенка также были заметно высокие уровни грибковых последовательностей рДНК SSU в пренатальном образце вагинального мазка, но не в образце стула «нулевого дня».

    Распространенность архей была значительно ниже и более вариабельна, чем распространенность грибов или бактерий; Анализ qPCR обнаружил гены архейной рРНК (в диапазоне 10 3 –10 6 генов рРНК / г) только у семи младенцев в течение первого года жизни, а у четырех из этих младенцев они были обнаружены только у одного ребенка. образец.У этих младенцев археи появлялись временно и почти исключительно в первые несколько недель жизни; они были обнаружены только у одного младенца после пятой недели жизни. Ограниченный анализ последовательностей архей, амплифицированных из трех образцов стула матери, которые дали положительный результат на археи (матери 4, 9 и 12), выявил преобладание Methanobrevibacter smithii (идентифицировано 7/8 архейных клонов, включая по крайней мере по одному клону от каждой матери), с одним дополнительным (некультурным) архейным филотипом.Результаты анализа количественной ПЦР грибов и архей включены в набор данных S5 и показаны графически вместе с результатами количественной ПЦР бактерий на Фигуре S2.

    Обсуждение

    Микробная колонизация желудочно-кишечного тракта младенца - примечательный эпизод в жизненном цикле человека. Каждый раз, когда рождается человеческий ребенок, из стерильной среды развивается богатая и динамичная экосистема. В считанные дни микробные иммигранты создают процветающее сообщество, население которого вскоре превосходит численность собственных клеток ребенка.Эволюционно древний симбиоз между желудочно-кишечным трактом человека и его резидентной микробиотой, несомненно, включает разнообразные взаимные взаимодействия между микробиотой и хозяином, что имеет важные последствия для здоровья и физиологии человека. Эти взаимодействия могут иметь полезные пищевые, иммунологические эффекты и эффекты развития или патогенные эффекты для хозяина [2,5,7,18,45].

    Это исследование началось с разработки микрочипа ДНК с почти полным охватом бактериальных таксонов, представленных в доступной базе данных последовательностей генов SSU рРНК.Наш дизайн микроматрицы и экспериментальные методы были основаны на уроках, извлеченных при валидации менее полной микроматрицы SSU рДНК [46]. Эти предыдущие эксперименты позволили нам оптимизировать наши методы для компьютерного прогнозирования поведения гибридизации SSU рДНК и разработать экспериментальный протокол, который максимизировал специфичность гибридизации. Превосходное согласование измерений отдельных таксонов, определенных с использованием нового дизайна микрочипов, по сравнению с результатами секвенирования из соответствующих библиотек клонов рДНК SSU (рисунок 1) предполагает, что эти принципы дизайна верны для этой платформы для множества таксонов и дают нам уверенность в том, что как полнота, так и точность результатов, полученных с помощью нашего нового набора микрочипов.Однако важно отметить, что наши методы проектирования и анализа массивов несовершенны и все еще развиваются. Некоторые из неожиданных видов, которые, по прогнозам микроматрицы, должны присутствовать в одном или нескольких образцах, не могли быть подтверждены секвенированием. В большинстве этих случаев анализ последовательности рассматриваемого образца (ов) показал, что перекрестная гибридизация на низком уровне высокоразвитых видов была ответственна за ложноположительный прогноз, результат, который будет приниматься во внимание в будущих раундах массива. дизайн и анализ.

    Мы использовали этот микрочип в подробном, систематическом и количественном исследовании бактериальной колонизации желудочно-кишечного тракта новорожденного человека. Мы использовали только что собранные образцы стула в качестве заменителей образцов, взятых из просвета и слизистой оболочки толстой кишки. Хотя, несомненно, существуют различия в популяционных профилях образцов стула и соответствующих слизистых оболочек, в предыдущем исследовании мы обнаружили, что профили, тем не менее, удивительно согласованы - достаточно, чтобы отдельные образцы стула можно было легко сопоставить с образцами биопсии толстой кишки от одного и того же человека на основе на сходство их бактериальных профилей [15,46].Таким образом, мы полагаем, что результаты нашего временного анализа бактериальных популяций в образцах детского стула предоставляют полезное окно для резидентной микробиоты толстой кишки.

    Принимая во внимание важность симбиоза между человеческим хозяином и кишечными комменсалами как для человека-хозяина, так и для микробного колониста, было бы легко представить, что программа микробной колонизации желудочно-кишечного тракта новорожденных развивалась под сильным избирательным давлением, воздействуя на как кишечная ниша, так и ее микробные колонисты должны быть сильно детерминированными и стереотипными.Мы могли ожидать, что весьма ограниченная группа совместно эволюционирующих комменсалов будет исключительно хорошо адаптирована к этой среде и будет последовательно доминировать в процессе колонизации стереотипным образом. Действительно, бактерии, которые мы обнаружили в кале младенцев и взрослых, предположительно отражающие микробиоту толстой кишки, были в значительной степени ограничены лишь небольшой подгруппой бактериального мира - Proteobacteria, Bacteroides, Firmicutes, Actinobacteria и Verrucomicrobia. Тем не менее, к удивлению, мы обнаружили, что в первые дни или месяцы жизни микробиота кишечника младенца и временная структура, в которой она развивается, заметно варьируются от человека к человеку.Казалось бы, хаотичное развитие ранних событий колонизации и сходство бактериального состава некоторых ранних младенческих образцов с грудным молоком или вагинальными мазками позволяет предположить, что бактериальная популяция, которая развивается на начальных стадиях, в значительной степени определяется конкретными бактериями. которому случайно подвергается ребенок. Примечательно, что эти материнские «сигнатуры» не сохранялись бесконечно, о чем свидетельствует наша неспособность найти значительно более высокую корреляцию общих таксономических профилей пар ребенок / родитель из одного и того же домохозяйства по сравнению с разными домохозяйствами.

    Важным исключением из рассказа об индивидуальности и уникальности ранних профилей было поразительное сходство временных профилей разнояйцевых близнецов (младенцев 13 и 14) (Рисунки 4 и 5). Эти близнецы имели как общую среду обитания, так и примерно 50% генетической идентичности, что делает невозможным определение из этого исследования, в какой степени каждая из этих общих черт ответственна за их сходные модели колонизации. Однако данные этого и других исследований показывают, что общая среда является основным фактором.Одним из аргументов в пользу этой точки зрения является отсутствие сопоставимого сходства в микробных сообществах других пар, которые также имеют 50% генетической идентичности, включая мать: ребенок, отец: ребенок и брат / сестра: ребенок (неопубликованные данные), хотя это несходство может отчасти из-за разных стадий их развития. Еще одним аргументом в пользу сильного влияния окружающей среды является случайное временное появление определенных организмов у обоих близнецов - трудно представить, что появление определенного микроба в конкретный день может быть генетически запрограммировано.Наш последний аргумент основан на доказательствах из предыдущего исследования, что микробиота генетически эквивалентных семей от скрещивания инбредных мышей была более похожей среди членов одного и того же «домохозяйства» (мать и потомство, живущие в одной клетке), чем между домохозяйствами [1].

    Определение «здоровой» кишечной микробиоты охватывает удивительное разнообразие профилей сообщества в первые 6 месяцев жизни. Хотя в первые месяцы эти микробные сообщества были разнообразными и своеобразными, они постепенно становились все более похожими друг на друга (рис. 6A), сходясь к общему профилю, подобному взрослому (рис. 6B), характеризующемуся преобладанием Bacteroides и Firmicutes, обычным проявлением Веррукомикробия и очень низкая численность протеобактерий и аэробных грамотрицательных бактерий в целом.Мы предполагаем, что самые ранние события колонизации в значительной степени определяются условно-патогенной колонизацией бактериями, которым ребенок подвергается в окружающей среде. Общие воздействия окружающей среды, вероятно, включают микробиоту влагалища, фекалий или кожи матери, о чем свидетельствует наблюдаемое сходство микробиоты раннего стула у некоторых младенцев с этими образцами, что согласуется с предыдущими доказательствами вертикальной передачи микробов [33,47 , 48]. Таким образом, разнообразие и вариативность отражают соответствующую индивидуальность этих случайных воздействий.Однако со временем преимущество пригодности таксонов, которые обычно доминируют в микробиоте толстой кишки взрослых особей, по-видимому, преодолевает первоначальное преимущество оппортунистов с ранней колонизацией, которые менее приспособлены к кишечной среде. Кроме того, прогрессирующие изменения в кишечной среде из-за внутренних изменений слизистой оболочки кишечника, перехода на «взрослую» диету и влияния самой микробиоты [44,49–51] могут требовать все более строгого отбора для наиболее адаптированные бактерии.Таким образом, несмотря на неожиданно хаотичный период первых месяцев жизни, становление экосистемы кишечника у младенцев, в конце концов, следует консервативной традиционной программе.

    Трансформация кишечной микробиоты по образцу взрослого неявно включала замену видов, встречающихся у младенцев, но редко у взрослых, видами, характерными для толстой кишки взрослых. Одной из потенциальных движущих сил таких демографических изменений может быть то, что взрослые члены сообщества в конечном итоге будут доминировать в силу их большей способности стабильно и необратимо утвердиться после колонизации хозяина.Мы искали доказательства этой дифференциальной «липкости», сравнивая автокорреляцию во времени численности каждого «вида» (см. Материалы и методы). Мы не нашли четких доказательств того, что виды, характерные для взрослой микробиоты, смогли установить более стабильную по своей природе колонизацию, чем виды, характерные для детской микробиоты.

    Мы и другие обнаружили, что индивидуально-специфические характеристики бактериальной микробиоты взрослых стабильны в том смысле, что они остаются постоянно более похожими у одного человека с течением времени, чем между отдельными людьми, в течение периода в год или более, и одного из поразительными результатами этого исследования было выявление относительно стабильных, индивидуальных паттернов бактериальной колонизации даже в первые недели и месяцы жизни.Эти наблюдения открыли интересную возможность того, что события оппортунистической колонизации в раннем младенчестве могут играть значительную роль в определении различных характеристик микробиоты одного и того же человека во взрослой жизни. Мы искали доказательства этого, сравнивая внутрииндивидуальные и межиндивидуальные корреляции бактериальных профилей через 1 или 2 мес. И 1 год, и не обнаружили существенной разницы (неопубликованные данные). Таким образом, хотя эти результаты, безусловно, не исключают возможности того, что события ранней колонизации играют важную роль в определении взрослой микробиоты, не похоже, что между ними существует сильная прямая корреляция.

    Наши результаты и выводы значительно отличаются от многих предыдущих отчетов по нескольким аспектам. Одним из заметных расхождений между нашими исследованиями и многими другими была относительно низкая частота и численность бифидобактерий в фекальной микробиоте в любом возрасте от рождения до взрослого возраста. Бифидобактериям уделялось непропорционально большое внимание, отчасти из-за их предполагаемых положительных эффектов, и во многих исследованиях сообщалось (и повторялись обзоры), что в микробиоте грудных детей преобладают бифидобактерии [17–19].Таким образом, мы были удивлены и поначалу скептически относились к очевидной малочисленности бифидобактерий почти во всех наших образцах и предприняли шаги для проверки точности наших результатов. Специфическая кПЦР для бифидобактерий подтвердила вывод, сделанный на основе результатов нашего микроматрицы, что бифидобактерии редко были основными составляющими микробиоты ЖКТ, по крайней мере, в этой исследуемой популяции, и что у большинства младенцев они появлялись только через несколько месяцев после рождения и после этого сохранялись меньшинство населения.Хотя можно предположить, что существуют географические или демографические различия в распространенности бифидобактерий, мы подозреваем, что акцент на бифидобактерии в исследованиях и обзорах микробиоты желудочно-кишечного тракта младенцев может быть непропорциональным его распространенности, численности и значимости для здоровья.

    Представленные здесь результаты указывают на многочисленные направления будущих исследований. Интересной особенностью динамики бактериальной популяции было появление резких сдвигов, перемежающих интервалы относительной стабильности.За исключением одного случая (лечение антибиотиками ребенка 8 лет), мы не смогли легко определить сильного кандидата в причину наблюдаемых нами сдвигов. Некоторые возможности включают вспышки бактериофагов, которые могут выборочно уничтожить доминирующую таксономическую группу [52]; случайное, условно-патологическое вторжение в метаболическую или анатомическую нишу более приспособленным видом; и тонкие изменения кишечной среды, вызванные развитием или диетой, нарушают физический баланс населения. Другими важными направлениями будущих исследований будут сравнение состава и эволюции микробных сообществ, встречающихся у этих здоровых детей, с сообществами недоношенных или других нездоровых детей, а также изучение влияния антибиотиков, диеты и способов родоразрешения на их развитие и эволюцию. сообщества.Несмотря на то, что здоровые дети в этом исследовании предполагали широкий диапазон профилей микробного сообщества, они были схожи в нескольких отношениях, в первую очередь в основных способствующих типах, в приобретении определенных ключевых типов с течением времени и в относительной стабильности их профилей. через некоторое время. Возможно, что при других состояниях здоровья или болезни мы найдем либо виды или группы, которые являются новыми для этой среды, либо необычные комбинации этого недавно определенного набора «обычных» видов.

    Важно отметить, что хотя мы показали, что микробиота кишечника становится все более стереотипной в течение первого года, четко установлено, что устойчивые межиндивидуальные различия сохраняются даже у взрослых [15,16].Когда и как развиваются эти стабильные «внутренние» характеристики микробиоты каждого человека? Как долго они сохраняются? Как различная стабильность колонизации разными бактериями связана с их микроанатомическими (например, крипта против ворсинок против слизистого слоя) или метаболическими нишами? Выявление экологических и генетических факторов, которые определяют отличительные характеристики микробиоты каждого человека, и определение того, влияют ли эти индивидуальные особенности на физиологию и здоровье хозяина, и каким образом, будет важной целью будущих исследований, в которых микроматрица, описанная в этом исследовании, будет быть полезным инструментом.

    Материалы и методы

    Разработка и производство микрочипов.

    Микроматрица содержала 10 500 ДНК-зондов (10265 уникальных последовательностей). Зонды включали 1379 контрольных зондов (1144 уникальных последовательностей) и 9121 уникальных таксономически специфичных зонда (5938 зондов на групповом уровне и 3183 зондов на уровне видов), состоящих из 40-нуклеотидных (нуклеотидных) последовательностей, полученных из генов SSU рРНК, и выбранных для их специфичность к соответствующему виду или таксономической группе. Основные принципы конструкции подробно описаны в предыдущем отчете [46].Дизайн был основан на базе данных последовательностей рДНК prokMSA SSU 2004 года и филогенетическом дереве [38], содержащем 86 453 прокариотических последовательностей рДНК SSU (5 672 архей и 80 781 бактериальных), организованных в 672 архейных и 15 765 бактериальных ОТЕ. OTU были определены в prokMSA как группы последовательностей с баллами идентичности (как определено в [38]) выше 95% или 98% (в некоторых релевантных с медицинской точки зрения родах). Мы дистиллировали эту базу данных, выбрав одну высококачественную последовательность, репрезентативную для каждой OTU, и урезали последовательности до областей, амплифицированных универсальными бактериями (Bact-8F: 5'-AGAGTTTGATCCTGGCTCAG-3 '[53] + 1391R: 5'- GACGGGCGGTGTGTRCA-3 '[54]) или архейный (Arch444 [55] / 1391R) праймеры.OTU в нашей сокращенной базе данных prokMSA были организованы в 945 (53 архейных + 892 бактериальных) таксономических групп (узлов), содержащих несколько OTU, и 92 отдельных «узла» OTU.

    Номенклатура базы данных была такова, что каждая OTU была обозначена числовым кодом, который указывал на ее таксономию prokMSA, например, вид «1.2.3.4.5.6.007» принадлежит к суперкоролевству 1, типу 1.2, классу 1.2.3, порядку 1.2. .3.4, семейство 1.2.3.4.5, род 1.2.3.4.5.6. В этой рукописи таксономические уровни упоминаются в соответствии с их глубиной в коде OTU, т.е.g., вид «1.2.3.4.5.6» принадлежит к группе с более широким охватом «1» на уровне 1 и к группе с меньшим охватом «1.2.3.4: на уровне 4».

    Мы сгенерировали большой набор зондов-кандидатов, используя BLAST [56], чтобы предсказать возможность гибридизации перекрывающихся 40-нуклеиновых последовательностей из каждой OTU в нашей базе данных дистиллированных последовательностей с каждой из других OTU в базе данных (путем разбиения каждой последовательности с окном на два). Последовательность считалась зондом-кандидатом для конкретной таксономической группы, если предсказывалось, что она гибридизуется по крайней мере с 10% членов этой группы, а не с какими-либо членами, не входящими в группу, с использованием эмпирически определенного порога 28 из 40 совпадений BLAST - несовпадения (общее количество нуклеотидов за вычетом несовпадений соответствует лучшему совпадению BLAST для данной последовательности рДНК) в качестве предельного значения для потенциальной гибридизации [46].Из полученного набора зондов-кандидатов мы выбрали для каждого узла / таксономической группы два зонда, которые, по прогнозам, гибридизуются с наибольшей частью этой группы. Мы также выбрали зонды из нашего набора кандидатов таким образом, чтобы каждая OTU в нашей дистиллированной базе данных была представлена ​​зондами на максимально возможном количестве таксономических уровней. Из-за нехватки места в массиве мы не смогли напечатать видоспецифические зонды для каждой OTU в нашей базе данных. Вместо этого мы дополнили набор зондов на уровне группы, разработанных, как описано выше, тремя дополнительными наборами зондов.Во-первых, мы составили список видов бактерий, которые были либо релевантными с медицинской точки зрения, либо известными человеческими комменсалами. Мы определили коды prokMSA для каждого из этих видов и протестировали выбранную последовательность из этой OTU для видоспецифичных 40-нуклеиновых последовательностей, как определено баллом совпадения-несоответствия BLAST не более 27 для любой другой последовательности. Мы также оценили видоспецифичные зонды из нашего предыдущего дизайна массива [46] в контексте базы данных prokMSA и включили 467 таких видоспецифичных зондов, представляющих 286 видов.Последней категорией таксономических зондов были зонды «новые OTU» - 316 зондов, разработанные для представления недавно открытых «видов» рДНК SSU, которые были идентифицированы в исследованиях толстой кишки [15] или желудка [57] взрослого человека (новые OTU были определены ограничение идентичности 99%, как описано в исходных исследованиях). Наконец, наш дизайн микроматрицы включал 1153 контрольных зонда - положительных и отрицательных - предназначенных для нормализации и систематического изучения гибридизационного поведения. Отрицательные контроли включали как последовательности, не относящиеся к рДНК, так и последовательности рДНК обратного комплемента, тогда как положительные контроли включали последовательности праймеров и несколько наборов перекрывающихся зондов, охватывающих полные гены SSU рРНК бактерий, архей и эукариот.Прикрепленные к поверхности олигонуклеотидные зонды были синтезированы in situ, как описано ранее [58], с 10-нуклеотидным поли-Т линкером, используемым для связывания специфического 40-нуклеотидного ДНК-зонда (Agilent Technologies, http://www.chem.agilent.com). ). Все наборы также включали 307 стандартных контрольных зондов Agilent. Все последовательности зондов и аннотации доступны в наборе данных S6.

    Покрытие массива.

    Наш набор микроматричных зондов включает один или несколько группоспецифичных зондов для 649 из 950 таксономических групп в prokMSA и видоспецифических зондов для 1590 видов бактерий и 39 видов архей.Взятые вместе, эти зонды гарантировали, что 15 406 (94%) из 16 437 видов, представленных в базе данных prokMSA, имели по крайней мере один репрезентативный зонд на каком-то уровне дерева от типа к виду, а большинство видов prokMSA (74%) имели репрезентативные зонды на несколько таксономических уровней (в среднем 2,4 уровня на вид).

    Предметы исследования и сбор образцов.

    Тринадцать здоровых беременных женщин были набраны в Медицинском центре Стэнфордского университета. Все участники исследования, в том числе 14 младенцев (одна пара разнояйцевых близнецов), девять отцов, 13 матерей и двое братьев и сестер (в возрасте 1-2 лет) дали информированное согласие или получили согласие своих родителей.Дизайн исследования был одобрен административной комиссией Стэнфордского университета по медицинским исследованиям на людях. На 36–40 неделе беременности вагинальные мазки (Copan Diagnostics, http://www.copanusa.com) были получены от десяти из 13 матерей и немедленно заморожены при –20 ° C. После рождения родители брали образцы стула младенцев с помощью пробирок для сбора стула (Sarstedt, http://www.sarstedt.com/php/main.php), которые содержали ложку для стандартизированного сбора примерно 300 мг материала.Образцы детского стула были собраны в соответствии с предписанным графиком (Таблица 1) и немедленно помещены в домашние морозильные камеры. Образец стула матери «нулевого дня» был взят в течение 0–5 дней после родов. Образцы стула были доставлены на льду в лабораторию для обработки через 2 недели, 3 месяца и 6 месяцев после рождения ребенка. Двенадцать матерей предоставили образцы грудного молока (~ 20 мл) через 3–9 месяцев после родов, а одна из них также предоставила грудное молоко через 6 дней после родов; эти образцы собирали в пробирки объемом 50 мл и немедленно замораживали.Девять из исследуемых семей также предоставили образцы стула одновременно от матери, отца и ребенка через 12–17 месяцев после рождения ребенка. По прибытии в лабораторию все образцы были немедленно перенесены в морозильную камеру с температурой –80 ° C и хранились там до обработки. Всего было собрано 548 образцов, в том числе 471 образец стула у младенцев, 39 образцов стула от матерей, 9 образцов стула от отцов, 2 образца стула от братьев и сестер, 16 образцов грудного молока и 11 вагинальных мазков. Родителям было поручено вести дневник, фиксируя ключевые события в категориях болезней, лекарств, изменения диеты и путешествий.Таблица 2 содержит выбранную информацию для каждого ребенка (например, пол и способ родов).

    Извлечение ДНК и амплификация рДНК SSU.

    ДНК

    экстрагировали из образцов стула с использованием мини-набора QIAamp Stool DNA (Qiagen, http://www1.qiagen.com). Вагинальные мазки обрабатывали с использованием мини-набора QIAamp DNA (Qiagen). Образцы молока сначала концентрировали вращением 2 мл в микроцентрифуге в течение 10 мин при 5000 g, удаляя 1800 мкл супернатанта. Осадок ресуспендировали в 200 мкл оставшегося супернатанта, и ДНК экстрагировали с помощью мини-набора QIAamp DNA.Образцы обрабатывали партиями примерно по 16, и в каждый цикл включали несколько контрольных экстрактов для мониторинга загрязнения. Отношение образцов к контролю экстракции составляло 6,8 для стула, 2,8 для вагинальных мазков и 5,3 для молока.

    РДНК

    SSU была амплифицирована из экстрагированной ДНК с использованием бактериально-специфических праймеров широкого спектра действия Bact-8F (5'-AGAGTTTGATCCTGGCTCAG-3 ') [53] и T7-1391R (5'-AATTCTAATACGACTCACTATAGGGAGACGGGCGGTGTGTRCA-3) [46,5]. Эти праймеры амплифицируют приблизительно 90% или более полноразмерной бактериальной последовательности, кодирующей рРНК SSU, и обеспечивают промотор для РНК-полимеразы Т7.Смеси для ПЦР состояли из 1 × буфера II для ПЦР (Applied Biosystems, http://www.appliedbiosystems.com), 1,5 мМ MgCl 2 , 0,05% Triton X-100, 20 мМ хлорида тетраметиламмония, 2% диметилсульфоксида, 0,1 Концентрации мМ каждого дезоксирибонуклеозидтрифосфата, концентрации каждого праймера 0,4 мкМ, 2,5 ед. ДНК-полимеразы AmpliTaq (Applied Biosystems) и 5 ​​мкл экстрагированной ДНК в конечном объеме 50 мкл. Используемые условия ПЦР: 5 минут при 95 ° C, 20 циклов по 30 секунд при 94 ° C, 30 секунд при 55 ° C и 90 секунд при 72 ° C, затем 8 минут при 72 ° C.Амплификацию проводили с использованием системы ПЦР GeneAmp 9700 (Applied Biosystems). В случаях чрезвычайно низкого выхода объединяли несколько 20-цикловых реакций. Реакции ПЦР очищали в 96-луночном формате с использованием системы на основе шариков для очистки ПЦР с переключателем заряда Invitrogen (Invitrogen, http://www.invitrogen.com) и хранили при -20 ° C.

    Строительство эталонного бассейна.

    Нашим общим эталоном была эквимолярная смесь ампликонов рДНК SSU из каждого образца (детский или материнский стул, вагинальное или грудное молоко), собранных до того, как субъекту исполнился 1 год.Для создания эквимолярной смеси очищенные продукты ПЦР с 20 циклами количественно определяли в 96-луночном формате с использованием набора дцДНК Quant-It PicoGreen (Molecular Probes, http://probes.invitrogen.com) и объединяли в равных количествах. Приблизительные доли рДНК SSU, полученной из стула, влагалища и молока, в полученном пуле составляли 90%, 5% и 5% соответственно. Этот пул ДНК использовали как в качестве матрицы для транскрипции in vitro (для гибридизации микроматриц), так и для конструирования библиотеки клонов SSU рДНК.

    Анализ последовательности и таксономическая классификация клонированных продуктов ПЦР рДНК.

    Контрольный пул (эквимолярная смесь ампликонов рДНК SSU из большинства образцов, описанная выше) клонировали и секвенировали, как описано ранее [15]. Мы получили 3458 высококачественных бактериальных последовательностей рДНК длиной более 800 нуклеотидов, включая 3163 двойных и 295 одиночных считываний. Эти последовательности были таксономически классифицированы с использованием классификатора Ribosomal Database Project (RDP) (обобщены в таблице 3).

    Мы также клонировали и секвенировали несколько сотен ампликонов рДНК SSU (среднее значение = 342; диапазон = 125–557 адекватных последовательностей) из каждого из 12 различных индивидуальных образцов одним и тем же способом, получив в общей сложности 4100 высококачественных последовательностей длиной более 800 nt.12 секвенированных образцов состояли из десяти образцов стула (день 11 от ребенка 2; день 1 от матери ребенка 3; неделя 12 от ребенка 3; месяц 6+ от ребенка 8; день 1 и день 2B от ребенка 10; день 12 от ребенка. 12; 7 месяц от ребенка 13; 7 месяц от матери близнецов: младенцев 13 и 14; и 7 месяц от ребенка 14), один образец молока от матери близнецов 13 и 14 и один образец из влагалища от матери близнецов 13 и 14.

    Каждая последовательность из этих 12 отдельных образцов была таксономически классифицирована в соответствии с таксономией prokMSA 2004 года [38] с использованием BLAST.В частности, мы использовали BLAST, чтобы найти последовательность с наибольшим количеством совпадений во всей базе данных prokMSA (также обрезанной до 8F и 1391R). Были зарегистрированы и сопоставлены два лучших совпадения (совпадения с менее чем 600 совпадающими нуклеотидами не учитывались), и если эти два совпадения были сопоставлены с одним и тем же OTU, то последовательность классифицировалась по этому OTU. Если два самых популярных совпадения различались по таксономическому коду, то последовательность классифицируется только на самом конкретном уровне, разделяемом двумя лучшими совпадениями. В случаях, когда второй лучший результат был значительно хуже (соответствует 2-му / соответствует 1-му <0.9) учитывалось только лучшее попадание. Коды prokMSA OTU явно определяют таксономическую классификацию последовательности на всех филогенетических уровнях для всех 4100 высококачественных последовательностей «индивидуального образца».

    Маркировка и гибридизация.

    Очищенные ампликоны рДНК SSU использовали в качестве матрицы для основанного на транскрипции синтеза амино-аллил-меченой одноцепочечной РНК с использованием набора для транскрипции MEGAScript T7 In Vitro (Ambion, http://www.ambion.com). Реакции транскрипции очищали в 96-луночном формате с использованием системы очистки Ambion MagMax RNA Purification и хранили при -20 ° C.Большие партии (5–10 мкг) эталонной РНК (эквимолярный пул всех образцов; см. Ниже) метили, используя сложный эфир Cy3 NHS, и хранили в течение нескольких недель для повторного использования. В день гибридизации 1 мкг каждого образца РНК метили, используя сложный эфир Cy5 NHS, как описано ранее [46]. Затем мы объединили 100 нг меченного Cy5 образца и 100 нг меченного Cy3 контрольного пула в объеме 48 мкл (в воде, свободной от нуклеаз). Затем мы добавили 2 мкл 25-кратного буфера для фрагментации Agilent и фрагментировали РНК путем нагревания при 70 ° C в течение 30 минут перед остановкой реакции, поместив ее на лед и добавив 50 мкл 2-кратного буфера для гибридизации Agilent.Непосредственно перед гибридизацией мы нагревали реакционную смесь до 95 ° C в течение 5 мин, затем охлаждали на льду перед добавлением 120 мкл 1 × гибридизационного буфера к 100 мкл фрагментированной меченой РНК и загружали 200 мкл этой смеси в камеру для гибридизации. (Agilent). Массивы гибридизовали при 60 ° C во вращающейся печи в течение 14–18 ч. Слайды промывали в 6 × SSC, 0,005% TritonX-102 в течение 5 минут при комнатной температуре, затем в 0,1 × SSC, 0,005% TritonX-102 в течение 5 минут и немедленно сканировали с использованием сканера Agilent DNA Microarray Scanner.Промывка и сканирование проводились в среде с низким содержанием озона [59].

    Нормализация данных микрочипа.

    Данные были извлечены из отсканированного изображения микрочипа с использованием самой последней версии программного обеспечения Agilent Feature Extraction (версии 7.1.1–8.1.1). Необработанные значения интенсивности флуоресценции Cy5 (или Cy3) за вычетом фона для каждого зонда были нормализованы путем деления значений Cy5 (или Cy3) на медианное значение Cy5 (или Cy3) универсального зонда «UNIV2» (расширенная версия 3 'ПЦР праймер 1391R: 5'-GTGGGGAGCGAACAGGATTAGATACCCTGGTAGTCCACGC-3 ') из соответствующего массива и умножение на 100.На этом этапе значения варьировались от 0,01 до примерно 100; значения выше 100 были редкими и возникали только тогда, когда флуоресцентный сигнал для определенного зонда был ярче, чем у универсального зонда. Нормализованные значения Cy5 были «декомпрессированы» следующей коррекцией: декомпрессированный Cy5 равен 10 в степени log 5 нормализованной интенсивности Cy5. Эта декомпрессия корректирует нелинейную связь сигналов гибридизации с относительной численностью целевых видов, которую мы наблюдали в серии экспериментов по серийному разведению, описанных в предыдущем отчете [46].В этих экспериментах мы обнаружили, что 10-кратное изменение численности переводится примерно в 5-кратное изменение соответствующей интенсивности флуоресценции. После этого преобразования расширенный диапазон значений составлял от 0,001 до приблизительно 700. Мы использовали BLAST для прогнозирования гибридизации каждой из 3458 общих эталонных последовательностей рДНК, превышающих 800 пар оснований, с использованием схемы взвешивания, описанной ранее [46], так что зонд с идеальным соответствием каждой последовательности будет иметь ожидание 100%, а зонды с меньшим количеством совпадений или несовершенные совпадения с последовательностями в контрольном пуле будут иметь соответственно более низкие ожидаемые значения гибридизации.Затем мы вычислили логарифмическое (наблюдаемое / ожидаемое) отношение для каждого зонда в контексте нашей объединенной эталонной смеси образцов и применили эти поправочные коэффициенты, специфичные для зонда, к разуплотненным значениям Cy5.

    Фильтрация микрочипов.

    Микроматричный анализ синтетических пулов определенного состава позволил нам идентифицировать плохо работающие зонды, которые затем были исключены из дальнейших анализов. Мы оценили эффективность зонда с использованием пяти синтетических пулов (четыре пула из шести уникальных продуктов ПЦР рДНК, один пул из 230 уникальных продуктов ПЦР рДНК [из [46]]) и одного биологического пула (общая ссылка, описанная выше), состав которых характеризовался следующим: глубокое секвенирование.Зонды со значениями интенсивности флуоресценции более 0,5% от интенсивности универсальных зондов, несмотря на отсутствие предсказанной гомологии последовательности (определяемой как значение совпадения-несовпадения BLAST менее 25 из возможных 40) с любым из видов в образце, были исключены. из последующих анализов. Мы также отбросили данные от зондов, которые имели наблюдаемую (декомпрессированную) интенсивность сигнала в 100 раз выше или ниже, чем ожидалось, в анализах биологического контрольного пула (как описано выше в разделе нормализации данных микрочипов).Оставшийся набор из 6381 зонда с хорошими характеристиками использовался во всех последующих анализах.

    Оценка численности таксономических групп.

    Для каждого образца мы получили оценку относительной численности каждой таксономической группы в нашем филогенетическом дереве с использованием алгоритма, который гарантирует, что ни один вид не вносит более одного вклада в оценку численности таксономической группы, и что нижележащие зонды (зонды, которые представляют отдельные подмножества видов, принадлежащих к этой филогенетической группе) включены в оценку совокупной численности группы.В частности, для каждой филогенетической группы в каждом образце мы отсортировали все находящиеся ниже по течению зонды в соответствии с их оценками относительной численности на основе микрочипов и рассчитали общую сумму оценок относительной численности всех неперекрывающихся зондов. В результате конкретные пробы, добавленные вместе для представления данной таксономической группы, варьировались в разных образцах, в зависимости от того, какие конкретные пробы имели наибольший сигнал гибридизации в этом образце.

    Сравнение данных микрочипа и последовательности.

    Оценки относительной численности каждой группы prokMSA на каждом уровне таксономической иерархии в контрольном пуле и в 12 отдельных образцах, проанализированных с помощью секвенирования, были получены путем расчета доли последовательностей в соответствующей библиотеке рДНК, которые были назначены пользователя BLAST в эту группу. Эти основанные на последовательностях оценки численности были напрямую сравнены с оценками, полученными на основе данных микрочипа, как описано в предыдущем разделе.

    Автокорреляционный анализ.

    Мы использовали автокорреляции как способ измерения тенденции таксономической группы к сохранению после установления («прилипчивость»). Для данного временного ряда от времени a до времени b, мы вычислили корреляцию Пирсона для каждого дочернего вектора ( a + 1,…, b ) и вектора ( a, …, b - 1), представляющий логарифмические оценки (относительной численности). Автокорреляция каждой таксономической группы затем принималась как медианная автокорреляция для всех младенцев, для которых рассматриваемая таксономическая группа присутствовала хотя бы один раз (определяемая как численность> 0.1%) в рассматриваемом временном интервале. В нашем «липком» анализе мы выполнили этот анализ отдельно для двух разных наборов образцов, собранных с разными интервалами выборки, чтобы избежать смешивающего эффекта вариации в интервалах выборки: (1) образцы раз в неделю с 1 по 12 недель; и (2) ежемесячные пробы с 1 по 6 месяцев.

    Обнаружение последовательностей архей и грибов.

    Для скрининга последовательностей рДНК архей и грибов. мы сначала проверили пулы, содержащие все извлеченные образцы ДНК от каждого ребенка (т.е., один пул на ребенка), все образцы стула родителей, все образцы из влагалища и все образцы молока, соответственно. Для каждого пула, дающего положительный результат, все образцы компонентов затем анализировались индивидуально. Для скрининга последовательностей рДНК архей мы использовали два набора специфичных для архей праймеров с широким спектром действия: A751F и U1406R [60]; и Arch433F (5'-TCCAGGCCCTACGGG-3 '[61]) и Arch958R (5'-YCCGGCGTTGAMTCCAATT-3' [62,63]). Для скрининга грибов мы использовали специфические для грибов праймеры широкого спектра действия 817F [64] и 1536R-rev (5'-AATRCAATGCTCTATCCCCA-3 ', адаптировано из [64]).Смеси для ПЦР были аналогичны тем, которые использовались для ПЦР с широким спектром действия, описанной выше, но со следующими изменениями: для ПЦР, специфичной для грибов, концентрация MgCl 2 была увеличена до 2 мМ, а BSA был добавлен в конечной концентрации. 1 мг / мл. В реакциях ПЦР, специфичных для грибов и архей, хлорид тетраметиламмония не добавляли, а добавляли 2 мкл объединенной ДНК с конечным объемом 50 мкл. Программа цикла состояла из 5 минут при 95 ° C, 35 циклов (30 секунд при 94 ° C, 30 секунд при 55 ° C и 30 секунд при 72 ° C), а затем 8 минут при 72 ° C.Реакции амплификации анализировали на агарозных гелях.

    Анализ смещения амплификации.

    Чтобы исследовать, могут ли несовпадения бактериальных праймеров влиять на амплификацию, была выделена ДНК из пяти контрольных штаммов бактерий: Escherichia coli (клетки TOP10, Invitrogen), Clostridium perfringens (ATCC 13124), Bacteroides fragilis (ATCC 25285), Bifidobacterium longum. (ATCC 15707) и Bifidobacterium infantis (ATCC 15697) с использованием мини-набора QIAamp DNA.Концентрации ДНК измеряли с помощью УФ-спектрофотометра и корректировали для корректировки выхода ДНК, размера генома и количества копий гена рРНК SSU на геном для получения «нормализованных» ДНК, каждая из которых содержит одинаковое количество копий гена рРНК SSU на мкл. Бактериальную ДНК из лизатов амплифицировали индивидуально или парами с использованием праймеров 8F и T7-1391R, как описано выше, с использованием 20 или 35 циклов. Для парных реакций нормализованную ДНК Bifidobacterium longum смешивали с неразбавленными или серийными разведениями нормализованной ДНК из Escherichia coli, Clostridium perfringens, или Bacteroides fragilis.После амплификации смеси ПЦР очищали с использованием набора для очистки ПЦР QIAquick (Qiagen) и расщепляли с использованием набора рестрикционных ферментов, выбранных для различения двух продуктов ПЦР, полученных с парными видами. Расщепления анализировали на агарозных гелях для количественной оценки относительного количества продуктов ПЦР, представляющих Bifidobacterium longum и виды в группе сравнения, соответственно.

    Количественная ПЦР.

    Отдельный анализ кПЦР в реальном времени использовался для амплификации и количественного определения рДНК каждой из четырех микробных групп: все бактерии, бифидобактерии, все грибы и все археи.Тотальный бактериальный КПЦР выполняли с использованием смеси 10: 1 универсального прямого праймера 8FM (5'-AGAGTTTGATCMTGGCTCAG-3 ', адаптировано из [53]) и соответствующего прямого праймера 8FB Bifidobacterium longum (5'-AGGGTTCGATTCTGGCTCAG-3', это исследование ), с обратным праймером Bact515R (5'-TTACCGCGGCKGCTGGCAC-3 ', адаптированный из [54]) и зондом TaqMan Bact338K (5'-FAM / CCAKACTCCTACGGGAGGCAGCAG / TAMRA-3', адаптированный из [65]). Мы дополнили универсальный бактериальный прямой праймер прямым праймером Bifidobacterium longum, потому что анализ последовательностей рДНК SSU показал, что эта группа была особой, поскольку она имела три несовпадения с нашим прямым праймером 8FM.Пилотные исследования показали, что эта смесь праймеров позволяет сравнимую амплификацию генов рРНК SSU из репрезентативных Bifidobacteria, Bacteroides, Enterobacteria и Clostridia. КПЦР рода Bifidobacterium выполняли с использованием праймеров Bif42F [26] и Bif164R (5'-CATCCGGCATTACCACCCGTT-3 ', адаптировано из [66]) и зонда Bif126_Taqman [26]. Тотальную количественную ПЦР грибов проводили с использованием праймеров ITS1F-F (5'-CTTGGTCATTTAGAGGAAGTAA-3 '[67]) и ITS4-R (5'-TCCTCCGCTTATTGATATGC-3' [68] и зонда TaqMan 5.8S (5'-FAM / CATTTCGCTGCGTTCTTCATCGATG / TAMRA-3 ', адаптировано из [68]. КПЦР архей выполняли с использованием праймеров Arch433F (5'-TCCAGGCCCTACGGG-3') [61] и Arch958R (5'-YCCGGCGTTCC) [63], и зонд 515F TaqMan (5'-FAM / GTGCCAGCMGCCGCGGTAA / TAMRA-3 ', адаптированный из [54]). Для всех анализов qPCR каждая 20-мкл реакционная смесь содержала 1 × мастер-микс TaqMan Universal PCR (Applied Biosystems) , 0,9 мкМ каждого праймера (0,09 мкМ праймера 8FB в общем бактериальном анализе), 0,2 мкМ зонда, 1 ед. ДНК-полимеразы AmpliTaq Gold (Applied Biosystems) и 2 мкл экстрагированной ДНК.Программа термоциклирования состояла из 95 ° C в течение 10 минут, за которыми следовали либо 40 циклов (анализы на бактерии и бифидобактерии), либо 45 циклов (анализы грибов и архей) при 95 ° C в течение 30 секунд, 55 ° C в течение 30 секунд, 60 ° C в течение 45 с, 65 ° C в течение 15 с и 72 ° C в течение 15 с [69]. Реакции проводили в системе обнаружения последовательностей Prism 7900HT (Applied Biosystems). Для построения стандартных кривых использовали десятикратные серийные разведения известных количеств рДНК из соответствующей микробной группы (т. Е. Бактерий, бифидобактерий, грибов или архей).Абсолютную численность рДНК рассчитывали на основе стандартных кривых с использованием программного обеспечения SDS версии 2.1 (Applied Biosystems) с базовым уровнем, установленным на циклах 3–15 (бактериальные и бифидобактериальные анализы) или циклах 3–13 (анализы грибов и архей), а также пороге цикла. устанавливается в пределах геометрической фазы кривой усиления. Чувствительность каждого анализа составляла приблизительно 100 молекул рДНК на лунку для реакции ПЦР. Каждый реакционный планшет для количественной ПЦР включал два типа отрицательных контролей (контроль реагентов и контроль аликвот), каждый в трех экземплярах.Специфичность ПЦР-анализа на бифидобактерии в реальном времени была проверена с использованием геномной ДНК, выделенной из 17 контрольных бактериальных штаммов: Bacillus subtilis (ATCC 6633), Bacteroides fragilis (ATCC 25285), Bacteroides thetaiotaomicron (ATCC 29148), Bifidobacterium longum) (ATCC 15ifidobacterium longum) (ATCC 15ifidobacterium longum). Infantis (ATCC 15697), Clostridium perfringens (ATCC 13124), Clostridium putrefaciens (ATCC 25786), Enterococcus faecalis (ATCC 19433), Escherichia coli (клетки TOP10; Invitrogen), Haemophilus haemolyticus (ATCC 33390), Lactophilus haemolyticus (ATCC 33390), Lactophilus haemolyticus (ATCC 33390), Lactophilus haemolyticus (ATCC 33390), Lactobacillus Lactobacillus delbrueckii (ATCC 4797), Megasphaera elsdenii (ATCC 17752), Proteus vulgaris (ATCC 13315), Pseudomonas aeruginosa (ATCC 10145), Staphylococcus aureus (ATCC 25923) и Streptococcus salivarius (ATCC 13419).

    Проверка подозрительных видов / таксонов.

    Мы исследовали происхождение сигналов гибридизации массива, представляющих 12 видов / таксонов, присутствие которых в образцах было неожиданным и не подтвержденным последовательностями в контрольном пуле. Для каждого анализа мы использовали один или оба из двух независимых анализов. Во-первых, мы попытались амплифицировать последовательности, очевидно обнаруженные с помощью анализа массива, с использованием праймеров, специфичных для видов / таксонов; когда продукт был получен, его дополнительно анализировали путем секвенирования.Для амплификации последовательностей мы использовали праймер, идентичный 40-мерному зонду, который давал сигнал гибридизации в нашем микроматрице в качестве 5'-праймера и 40-мерную универсальную последовательность (обратный комплемент последовательности UNIV2, приведенной выше) в качестве 3'-фрагмента. грунтовка. В некоторых случаях мы также пытались амплифицировать подозрительную последовательность, используя усеченную (23-мерную) версию соответствующего олигонуклеотидного зонда из микроматрицы в паре с известным группоспецифическим праймером ПЦР от ProbeBase [55]. Все ПЦР проводили в условиях, идентичных тем, которые использовались при первоначальных амплификациях образцов для анализа микрочипов.Положительные полосы ожидаемого размера были клонированы и секвенированы. В качестве второго подхода четыре образца, которые, как было предсказано на основании результатов микроматрицы, содержали последовательности от неожиданных видов, были дополнительно проанализированы путем секвенирования библиотек клонов рДНК SSU (96–288 клонов), созданных путем амплификации с использованием широкодиапазонных бактериальных праймеров 8F и 1391R (как указано выше). ), а также клонирование и секвенирование, как описано ранее [15]. Относительная численность, предсказанная анализом микрочипов, и количество секвенированных клонов были следующими: Vibrio (13%): 96, Deinococcus (0.1%): 192, Spirochaetes (1%): 288 и Legionella pneumophila (1%): 192.

    Дополнительная информация

    Набор данных S3. Нормализованные данные микрочипов для всех образцов и всех отфильтрованных зондов.

    Необработанные интенсивности Cy5 преобразовывали, как описано в разделе «Материалы и методы». Обратите внимание, что для образцов с повторной гибридизацией ( n = 36) показаны усредненные значения, а названия образцов обозначены (Avg).

    https://doi.org/10.1371/journal.pbio.0050177.sd003

    (19,0 МБ TXT)

    Рисунок S1. Численность бактерий и бифидобактерий в течение первого года жизни

    Для каждого образца ребенка общее количество бактерий и бифидобактерий оценивалось с помощью TaqMan ПЦР в реальном времени, как подробно описано в разделе «Материалы и методы». Для каждой из этих таксономических групп расчетные копии гена рРНК на грамм фекалий ( y -ось) нанесены на график как функция дней жизни (ось x -). Обе оси имеют логарифмическую шкалу.Для каждой таксономической группы измерения численности усекаются на нижнем конце диапазона до значения, соответствующего 95-му процентилю экстракционных (отрицательных) контролей для соответствующего набора праймеров ПЦР (10702 и 1183 копий рДНК на грамм эквивалента стула. для общих бактерий и бифидобактерий соответственно). Таким образом, значения, нанесенные на соответствующие нижние пределы обнаружения, обычно представляют собой численность ниже указанного значения (диапазон, включающий ноль).

    https: // doi.org / 10.1371 / journal.pbio.0050177.sg001

    (457 КБ PDF)

    Рисунок S2. Обилие фекальных бактерий, грибов и архей в течение первого года жизни

    Для каждого образца ребенка обилие бактерий, грибов и архей оценивалось с помощью ПЦР в реальном времени TaqMan, как подробно описано в разделе «Материалы и методы». Для каждой из этих таксономических групп расчетные копии гена рРНК на грамм фекалий ( y -ось) наносятся на график как функция дней жизни ( x -ось). Обе оси имеют логарифмическую шкалу.Для каждой таксономической группы измерения численности усекаются на нижнем конце диапазона до значения, соответствующего 95-му процентилю экстракционных (отрицательных) контролей для соответствующего набора праймеров ПЦР (10702, 9831 и ноль копий рДНК на грамм). эквивалента стула для бактерий, грибов и архей соответственно). Таким образом, значения, нанесенные на соответствующие нижние пределы обнаружения, обычно представляют собой численность ниже указанного значения (диапазон, включающий ноль). Все значения, для которых оценка численности методом qPCR была равна нулю (только для архей), были опущены.Эпизоды антибактериального или противогрибкового (нистатин) лечения обозначены на временной оси серыми или розовыми полосами соответственно (дополнительную информацию см. В Таблице 1).

    https://doi.org/10.1371/journal.pbio.0050177.sg002

    (773 КБ PDF)

    Благодарности

    Мы благодарим все семьи, принявшие участие в этом исследовании. Мы благодарны за помощь членов групп Брауна и Релмана, включая Стивена Поппера, Гарольда Амогана, Ле Детлефсена и Лину Веннстрём, а также за ценные советы Майкла Эйзена (Национальные лаборатории Лоуренса Беркли и Калифорнийский университет в Беркли), Роба Тибширани ( Стэнфорд) и Джерел Дэвис.Мы благодарим Карен Нельсон и Джоан Эмерсон (Институт геномных исследований) за техническую поддержку в создании и секвенировании библиотеки клонов рДНК SSU. Мы благодарим Horn Foundation за поддержку этой работы. ПОБ - исследователь Медицинского института Говарда Хьюза. DAR является лауреатом премии «Пионер» Национального института здравоохранения.

    Вклад авторов

    CP, EMB, DBD, DAR и POB разработали и разработали эксперименты и проанализировали данные. CP, EMB и DBD проводили эксперименты.CP, EMB, DBD и POB написали статью.

    Ссылки

    1. 1. Ley RE, Backhed F, Turnbaugh P, Lozupone CA, Knight RD и др. (2005) Ожирение изменяет микробную экологию кишечника. Proc Natl Acad Sci U S A 102: 11070–11075.
    2. 2. Backhed F, Ding H, Wang T, Hooper LV, Koh GY и др. (2004) Микробиота кишечника как фактор окружающей среды, регулирующий накопление жира. Proc Natl Acad Sci U S A 101: 15718–15723.
    3. 3. Ley RE, Turnbaugh PJ, Klein S, Gordon JI (2006) Микробная экология: кишечные микробы человека, связанные с ожирением.Природа 444: 1022–1023.
    4. 4. Stappenbeck TS, Hooper LV, Gordon JI (2002) Регуляция развития кишечного ангиогенеза с помощью местных микробов через клетки Панета. Proc Natl Acad Sci U S A 99: 15451–15455.
    5. 5. Сюй Дж., Гордон Дж. И. (2003) Вступительная статья: Почитай своих симбионтов. Proc Natl Acad Sci U S A 100: 10452–10459.
    6. 6. Hooper LV, Midtvedt T, Gordon JI (2002) Как взаимодействия хозяина и микробов формируют питательную среду кишечника млекопитающих.Анну Рев Нутр 22: 283–307.
    7. 7. MacDonald TT, Gordon JN (2005) Бактериальная регуляция кишечных иммунных ответов. Гастроэнтерол Clin North Am 34: 401–412.
    8. 8. Парсоннет Дж., Фридман Г.Д., Вандерштин Д.П., Чанг Й., Фогельман Дж. Х. и др. (1991) Инфекция Helicobacter pylori и риск рака желудка. N Engl J Med 325: 1127–1131.
    9. 9. Лекит М., Абачин Э., Мартин А., Пойярт С., Почарт П. и др. (2004) Иммунопролиферативное заболевание тонкого кишечника, связанное с Campylobacter jejuni.N Engl J Med 350: 239–248.
    10. 10. Отт С.Дж., Мусфельдт М., Вендерот Д.Ф., Хампе Дж., Брант О. и др. (2004) Уменьшение разнообразия бактериальной микрофлоры слизистой оболочки толстой кишки у пациентов с активным воспалительным заболеванием кишечника. Кишечник 53: 685–693.
    11. 11. Сексик П., Риготтье-Гойс Л., Грамет Г., Сутрен М., Покхарт П. и др. (2003) Изменения доминирующих фекальных бактериальных групп у пациентов с болезнью Крона толстой кишки. Кишечник 52: 237–242.
    12. 12.Fell JM (2005) Воспалительные кишечные заболевания новорожденных: некротический энтероколит и аллергический колит. Early Hum Dev 81: 117–122.
    13. 13. de la Cochetiere MF, Piloquet H, des Robert C., Darmaun D, ​​Galmiche JP, et al. (2004) Ранняя кишечная бактериальная колонизация и некротический энтероколит у недоношенных детей: предполагаемая роль Clostridium . Pediatr Res 56: 366–370.
    14. 14. Vaughan EE, Schut F, Heilig HG, Zoetendal EG, de Vos WM, et al.(2000) Молекулярный взгляд на экосистему кишечника. Curr Issues Intest Microbiol 1: 1–12.
    15. 15. Eckburg PB, Bik EM, Bernstein CN, Purdom E, Dethlefsen L, et al. (2005) Разнообразие кишечной микробной флоры человека. Наука 308: 1635–1638.
    16. 16. Zoetendal EG, Akkermans AD, De Vos WM (1998) Анализ гель-электрофореза в градиенте температуры 16S рРНК из образцов фекалий человека выявляет стабильные и специфичные для хозяина сообщества активных бактерий.Appl Environ Microbiol 64: 3854–3859.
    17. 17. Старк П.Л., Ли А. (1982) Микробная экология толстой кишки грудных детей и детей, вскармливаемых смесями, в течение первого года жизни. J Med Microbiol 15: 189–203.
    18. 18. Penders J, Thijs C, Vink C, Stelma FF, Snijders B, et al. (2006) Факторы, влияющие на состав кишечной микробиоты в раннем младенчестве. Педиатрия 118: 511–521.
    19. 19. Бенно Ю., Савада К., Мицуока Т. (1984) Микрофлора кишечника младенцев: состав фекальной флоры у младенцев, находящихся на грудном и искусственном вскармливании.Microbiol Immunol 28: 975–986.
    20. 20. Favier CF, Vaughan EE, De Vos WM, Akkermans AD (2002) Молекулярный мониторинг последовательности бактериальных сообществ у новорожденных людей. Appl Environ Microbiol 68: 219–226.
    21. 21. Hopkins MJ, Macfarlane GT, Furrie E, Fite A, Macfarlane S (2005) Характеристика кишечных бактерий в детском стуле с использованием ПЦР в реальном времени и анализов северной гибридизации. FEMS Microbiol Ecol 54: 77–85.
    22. 22. Hall MA, Cole CB, Smith SL, Fuller R, Rolles CJ (1990) Факторы, влияющие на присутствие фекальных лактобацилл в раннем младенчестве.Arch Dis Child 65: 185–188.
    23. 23. Йошиока Х, Исэки К., Фудзита К. (1983) Развитие и различия кишечной флоры в неонатальном периоде у детей, находящихся на грудном и искусственном вскармливании. Педиатрия 72: 317–321.
    24. 24. Harmsen HJ, Wildeboer-Veloo AC, Raangs GC, Wagendorp AA, Klijn N, et al. (2000) Анализ развития кишечной флоры у детей, находящихся на грудном вскармливании и на искусственном вскармливании, с использованием методов молекулярной идентификации и обнаружения. J Pediatr Gastroenterol Nutr 30: 61–67.
    25. 25. Balmer SE, Wharton BA (1989) Диета и фекальная флора новорожденного: грудное молоко и детские смеси. Arch Dis Child 64: 1672–1677.
    26. 26. Пендерс Дж., Винк С., Дриссен С., Лондон Н., Тиджс С. и др. (2005) Количественная оценка Bifidobacterium spp., Escherichia coli и Clostridium difficile в образцах фекалий младенцев, вскармливаемых грудью и вскармливаемых смесями, с помощью ПЦР в реальном времени. FEMS Microbiol Lett 243: 141–147.
    27. 27. Lundequist B, Nord CE, Winberg J (1985) Состав фекальной микрофлоры у младенцев на грудном и искусственном вскармливании от рождения до восьми недель.Acta Paediatr Scand 74: 45–51.
    28. 28. Orrhage K, Nord CE (1999) Факторы, контролирующие бактериальную колонизацию кишечника у младенцев, находящихся на грудном вскармливании. Acta Paediatr Suppl 88: 47–57.
    29. 29. Fanaro S, Chierici R, Guerrini P, Vigi V (2003) Микрофлора кишечника в раннем младенчестве: состав и развитие. Acta Paediatr Suppl 91: 48–55.
    30. 30. Bennet R, Nord CE (1987) Развитие фекальной анаэробной микрофлоры после кесарева сечения и лечения антибиотиками у новорожденных.Инфекция 15: 332–336.
    31. 31. Neut C, Bezirtzoglou E, Romond C, Beerens H, Delcroix M и др. (1987) Бактериальная колонизация толстой кишки у новорожденных, рожденных путем кесарева сечения. Zentralbl Bakteriol Mikrobiol Hyg [A] 266: 330–337.
    32. 32. Hallstrom M, Eerola E, Vuento R, Janas M, Tammela O (2004) Влияние способа доставки и некротизирующего энтероколита на микрофлору кишечника у недоношенных детей. Eur J Clin Microbiol Infect Dis 23: 463–470.
    33. 33. Мандар Р., Микелсаар М. (1996) Передача микрофлоры матери новорожденному при рождении. Биол для новорожденных 69: 30–35.
    34. 34. Швирц А., Грюль Б., Лобниц М., Мишель П., Радке М. и др. (2003) Развитие бактериального состава кишечника у госпитализированных недоношенных детей по сравнению с доношенными детьми, находящимися на грудном вскармливании. Pediatr Res. 54: 393–399.
    35. 35. Саката Х., Йошиока Х., Фудзита К. (1985) Развитие кишечной флоры у младенцев с очень низкой массой тела при рождении по сравнению с нормальными доношенными новорожденными.Eur J Pediatr 144: 186–190.
    36. 36. Миллар М.Р., Линтон С.Дж., Кейд А., Глэнси Д., Холл М. и др. (1996) Применение ПЦР гена 16S рРНК для изучения флоры кишечника недоношенных детей с некротическим энтероколитом и без него. J Clin Microbiol 34: 2506–2510.
    37. 37. Коул Дж. Р., Чай Б., Марш Т. Л., Фаррис Р. Дж., Ван К. и др. (2003) Проект базы данных рибосом (RDP-II): предварительный просмотр нового средства автоматического выравнивания, которое позволяет регулярно обновлять новую таксономию прокариот. Nucl Acids Res 31: 442–443.
    38. 38. ДеСантис Т.З., Дубосарский И., Мюррей С.Р., Андерсен Г.Л. (2003) Комплексное построение выровненных последовательностей для автоматизированного проектирования эффективных зондов (CASCADE-P) с использованием 16S рДНК. Биоинформатика 19: 1461–1468.
    39. 39. Дедыш С.Н., Панкратов Т.А., Белова С.Е., Куличевская И.С., Лизак В. (2006) Филогенетический анализ и определение состава бактериального сообщества на кислых сфагновых торфяниках in situ. Appl Environ Microbiol 72: 2110–2117.
    40. 40.Шмитт-Вагнер Д., Фридрих М.В., Вагнер Б., Брюн А. (2003) Филогенетическое разнообразие, численность и осевое распределение бактерий в кишечном тракте двух термитов, питающихся почвой (Cubitermes spp.). Appl Environ Microbiol 69: 6007–6017.
    41. 41. Salzman NH, de Jong H, Paterson Y, Harmsen HJ, Welling GW и др. (2002) Анализ библиотек 16S микрофлоры желудочно-кишечного тракта мышей выявил новую большую группу кишечных бактерий мышей. Микробиология 148: 3651–3660.
    42. 42. Acinas SG, Marcelino LA, Klepac-Ceraj V, Polz MF (2004) Дивергенция и избыточность последовательностей 16S рРНК в геномах с множественными оперонами рРНК. J Bacteriol 186: 2629–2635.
    43. 43. Park HK, Shim SS, Kim SY, Park JH, Park SE и др. (2005) Молекулярный анализ колонизированных бактерий в кишечнике новорожденного человека. J Microbiol 43: 345–353.
    44. 44. Mackie RI, Sghir A, Gaskins HR (1999) Микробная экология развития желудочно-кишечного тракта новорожденных.Am J Clin Nutr 69: 1035S – 1045S.
    45. 45. Macdonald TT, Monteleone G (2005) Иммунитет, воспаление и аллергия в кишечнике. Наука 307: 1920–1925.
    46. 46. Палмер С., Бик Е.М., Эйзен М.Б., Экбург П.Б., Сана Т.Р. и др. (2006) Быстрое количественное определение сложных микробных популяций. Nucleic Acids Res. 34.
    47. 47. Линц Б., Баллу Ф., Мудли Й., Маника А., Лю Х. и др. (2007) Африканское происхождение тесной связи между человеком и Helicobacter pylori.Природа 445: 915–918.
    48. 48. Caufield PW, Saxena D, Fitch D, Li Y (2007) Популяционная структура плазмидсодержащих штаммов Streptococcus mutans, члена местной биоты человека. J Bacteriol 189: 1238–1243.
    49. 49. Беленгер А., Дункан С.Х., Колдер А.Г., Холтроп Дж., Луи П. и др. (2006) Два пути метаболического перекрестного питания между Bifidobacterium adolescentis и анаэробами, продуцирующими бутират, из кишечника человека. Appl Environ Microbiol 72: 3593–3599.
    50. 50. Сэмюэл Б.С., Гордон Д.И. (2006) Гуманизированная модель мыши-гнотобиотической мыши мутуализма «хозяин-архей-бактерия». Proc Natl Acad Sci U S A 103: 10011–10016.
    51. 51. Зонненбург JL, Chen CT, Gordon JI (2006) Геномные и метаболические исследования воздействия пробиотиков на модельный симбионт кишечника и хозяина. PLoS Biol 4: e413 ..
    52. 52. Фарук С.М., Насер И.Б., Ислам М.Дж., Фарук А.С., Гош А.Н. и др. (2005) Сезонные эпидемии холеры обратно коррелируют с распространенностью фагов холеры в окружающей среде.Proc Natl Acad Sci U S A 102: 1702–1707.
    53. 53. Edwards U, Rogall T, Blocker H, Emde M, Bottger EC (1989) Выделение и прямое полное определение нуклеотидов целых генов. Характеристика гена, кодирующего рибосомную РНК 16S. Nucleic Acids Res 17: 7843–7853.
    54. 54. Lane DJ, Pace B, Olsen GJ, Stahl DA, Sogin ML, et al. (1985) Быстрое определение последовательностей 16S рибосомной РНК для филогенетических анализов. Proc Natl Acad Sci U S A 82: 6955–6959.
    55. 55. Loy A, Horn M, Wagner M (2003) probeBase: Интернет-ресурс для олигонуклеотидных зондов, нацеленных на рРНК. Nucleic Acids Res 31: 514–516.
    56. 56. Альтшул С.Ф., Гиш В., Миллер В., Майерс Е. В., Липман Д. Д. (1990) Базовый инструмент поиска локального выравнивания. J Mol Biol 215: 403–410.
    57. 57. Бик Э.М., Экбург П.Б., Гилл С.Р., Нельсон К.Э., Пурдом Э.А. и др. (2006) Молекулярный анализ бактериальной микробиоты в желудке человека. Proc Natl Acad Sci U S A 103: 732–737.
    58. 58. Blanchard AP, Kaiser RJ, Hood LE (1996) Матрицы олигонуклеотидов высокой плотности. Biosens Bioelectron 11: 687–690.
    59. 59. Фаре Т.Л., Коффи Э.М., Дай Х., Хе Ю.Д., Кесслер Д.А. и др. (2003) Влияние атмосферного озона на качество данных микрочипов. Anal Chem 75: 4672–4675.
    60. 60. Baker GC, Smith JJ, Cowan DA (2003) Обзор и повторный анализ доменно-специфичных праймеров 16S. J Microbiol Methods 55: 541–555.
    61. 61. Лепп П.У., Бриниг М.М., Оуверни С.К., Палм К., Армитаж Г.К. и др.(2004) Метаногенные археи и пародонтоз человека. Proc Natl Acad Sci U S A 101: 6176–6181.
    62. 62. DeLong EF, Wickham GS, Pace NR (1989) Филогенетические красители: зонды на основе рибосомной РНК для идентификации одиночных клеток. Наука 243: 1360–1363.
    63. 63. Делонг Е.Ф. (1992) Археи в прибрежной морской среде. Proc Natl Acad Sci U S A 89: 5685–5689.
    64. 64. Borneman J, Hartin RJ (2000) Праймеры для ПЦР, которые амплифицируют гены рРНК грибов из образцов окружающей среды.Appl Environ Microbiol 66: 4356–4360.
    65. 65. Аманн Р.И., Биндер Б.Дж., Олсон Р.Дж., Чисхолм С.В., Деверо Р. и др. (1990) Комбинация олигонуклеотидных зондов, нацеленных на 16S рРНК, с проточной цитометрией для анализа смешанных микробных популяций. Appl Environ Microbiol 56: 1919–1925.
    66. 66. Langendijk PS, Schut F, Jansen GJ, Raangs GC, Kamphuis GR, et al. (1995) Количественная флуоресцентная гибридизация in situ Bifidobacterium spp. с геноспецифическими зондами, нацеленными на 16S рРНК, и их применением в образцах фекалий.Appl Environ Microbiol 61: 3069–3075.
    67. 67. Гардес М., Брунс Т.Д. (1993) Праймеры ITS с повышенной специфичностью в отношении базидиомицетов - применение для идентификации микоризы и ржавчины. Мол Экол 2: 113–118.
    68. 68. White TJ, Burns T, Lee S, Taylor J (1990) Амплификация и секвенирование генов грибковой рибосомной РНК для филогенетики. В: Иннис М.А., Гельфанд Д.Х., Снинский Дж. Дж., Уайт Т. Дж., Редакторы. Протоколы ПЦР. Руководство по методам и приложениям. Сан-Диего (Калифорния): Academic Press.С. 315–322.
    69. 69. Brinig MM, Lepp PW, Ouverney CC, Armitage GC, Relman DA (2003) Распространенность бактерий подразделения TM7 в поддесневой бляшке человека и их связь с заболеванием. Appl Environ Microbiol 69: 1687–1694.

    Кишечные микробы и заболевания пищеварительной системы у собак

    Ян Суходолски Доктор медицинских наук, AGAF, DACVM

    Доктор Суходольски - профессор медицины мелких животных, заместитель директора по исследованиям и руководитель отдела микробиомных наук в желудочно-кишечной лаборатории Техасского университета A&M. .Он получил докторскую степень в Венском университете, Австрия, и докторскую степень по ветеринарной микробиологии в Техасском университете A&M. Он сертифицирован по иммунологии Американским колледжем ветеринарных микробиологов. Его исследования сосредоточены на разработке биомаркеров желудочно-кишечных заболеваний и терапевтических подходов к модуляции кишечной микробиоты.

    Микробиота кишечника состоит из вирусов, бактерий, грибов и простейших. В прошлом для описания этой сложной экосистемы использовалось слово микрофлора , но более подходящим термином является микробиота (от - bios , «живые организмы»).Микробиом - это коллективный геном всех этих микробов. На сегодняшний день большинство исследований сосредоточено на бактериальной микробиоте, которая, по оценкам, составляет подавляющее большинство кишечной микробиоты.

    По оценкам, в кишечнике присутствует 100 триллионов микробных клеток, что в 10 раз превышает количество клеток млекопитающих во всем организме. В совокупности количество микробных генов превышает количество генов хозяина примерно в 10 раз.

    Эта сложная экосистема кишечных бактерий оказывает огромное влияние на здоровье хозяина.Взаимодействия между бактериями и хозяином опосредуются прямым контактом между микробами и иммунной системой и через различные метаболиты микробиоты. Физиологический микробиом модулирует иммунную систему, защищает от энтеропатогенов и обеспечивает питательные свойства хозяина.

    И наоборот, изменения сложных взаимоотношений между кишечными бактериями и клетками хозяина влияют на иммунные ответы и метаболический статус хозяина и могут привести к заболеванию (, рис. 1, ).Недавние исследования описали дисбактериоз кишечника (т.е. изменения в составе и / или разнообразии кишечной микробиоты) при различных острых и хронических желудочно-кишечных (ЖКТ) расстройствах. 1 Кроме того, первоначальные данные на моделях человека и животных связывают хронический дисбиоз, например, вызванный воздействием антибиотиков, с внекишечными расстройствами, такими как диабет и ожирение. 2,3 Эти данные подчеркивают важность кишечной микробиоты и дисбактериоза в регулировании метаболизма хозяина, причем эффекты выходят далеко за пределы желудочно-кишечного тракта.

    Паттерны дисбактериоза и метаболические признаки, наблюдаемые при острых и хронических заболеваниях желудочно-кишечного тракта и метаболическом синдроме, только начинают описываться. Признаки дисбактериоза и метаболические изменения оцениваются на предмет их диагностического и терапевтического потенциала. В этой статье представлен обзор бактерий в кишечнике собак и роль дисбактериоза в этиологии заболеваний желудочно-кишечного тракта.

    Рис. 1. Взаимодействие между кишечной микробиотой, иммунной системой и метаболизмом хозяина.(A) В здоровом кишечнике существует правильное пространственное расположение между очень многочисленной микробиотой просвета, эпителием и иммунными клетками (дендритными клетками, лимфоцитами, макрофагами, нейтрофилами), которые присутствуют в небольшом количестве. Микробиота обеспечивает иммуномодулирующие стимулы для иммунной системы, метаболизирует и сбраживает сложные углеводы в полезные короткоцепочечные жирные кислоты (SCFA). Эти SCFA обеспечивают энергией эндотелиальные клетки, обладают противовоспалительным действием и регулируют перистальтику кишечника.Нормальная микробиота также превращает первичные желчные кислоты во вторичные желчные кислоты, которые также обладают противовоспалительным действием, индуцируют глюкагоноподобный пептид 1 (который, в свою очередь, увеличивает инсулин) и уменьшают, например, споруляцию Clostridium difficile. (B) В болезненном состоянии, независимо от первопричины, снижение выработки антимикробных пептидов и слизи приводит к увеличению кишечной проницаемости и транслокации бактерий. Врожденные иммунные рецепторы, такие как Toll-подобные рецепторы на макрофагах и других иммунных клетках, распознают определенные патоген-ассоциированные молекулярные структуры из-за дисбактериоза (например, липополисахариды в стенках бактериальных клеток) и запускают воспалительные реакции.Макрофаги фагоцитируют микробы, вызывая также иммунные реакции, которые могут привести к окислительному стрессу. Окислительный стресс, в свою очередь, может вызвать дисбактериоз кишечника.

    РЕДКАЯ ПОРОДА

    У каждой собаки есть уникальное микробное сообщество с отчетливыми различиями в пропорциях этих бактериальных групп. Тем не менее, содержание бактериальных генов сохраняется у разных людей, что позволяет предположить, что функциональные аспекты микробиома у разных животных схожи. Индивидуальные различия между видами микробов могут вызывать индивидуальные реакции на разные диеты, источники клетчатки и пробиотики.

    МИКРОБИОТА КИШЕЧНИКА В ЗДОРОВЬЕ

    Идентификация и компоненты

    До недавнего времени идентификация кишечных бактерий почти всегда осуществлялась с использованием традиционных бактериальных культур. Культура фекалий может быть полезна для обнаружения специфических энтеропатогенов, таких как Salmonella или Campylobacter jejuni , поскольку этот подход позволяет проводить испытания клинических образцов на чувствительность к антибиотикам, но подавляющее большинство кишечных бактерий являются анаэробами и не поддаются обнаружению с помощью стандартные методы выращивания.Таким образом, рутинный бактериальный посев не позволяет детально охарактеризовать сложные кишечные бактериальные сообщества ( Рисунок 2 ). В настоящее время для характеристики кишечной микробиоты используется ряд молекулярных методов. 4

    Традиционные бактериальные культуры, а также молекулярные подходы выявили различия в типах и количестве бактерий в желудочно-кишечном тракте. Количество бактерий в двенадцатиперстной кишке здоровых собак колеблется от 10 2 до 10 9 колониеобразующих единиц (КОЕ) / г. 5 В толстой кишке находятся гораздо более высокие значения, до 10 11 КОЕ / г. 6

    Молекулярные инструменты позволили идентифицировать ранее не культивируемые и, следовательно, неизвестные бактерии. В то время как в двенадцатиперстной кишке обитает смесь аэробных и факультативных анаэробных бактерий, толстая кишка почти исключительно колонизирована строгими анаэробами. 7 Бактериальные группы Clostridiaceae, Bacteroidaceae, Prevotellaceae и Fusobacteriaceae преобладают в толстом кишечнике ( Рисунок 2 ).Следует отметить, что у каждой собаки есть уникальное микробное сообщество с отчетливыми различиями в пропорциях этих бактериальных групп. Тем не менее, содержание бактериальных генов сохраняется у разных людей, что позволяет предположить, что функциональные аспекты микробиомов у разных животных схожи. 8 Тем не менее, индивидуальные различия между видами микробов могут вызывать индивидуальные реакции на разные диеты, источники клетчатки и пробиотики.

    Желудочно-кишечный тракт также является домом для разнообразной популяции вирусов и грибов.Одно исследование описало до 40 видов грибов в образцах фекалий собак; большинство из них были различными Candida spp. 9 На основании этих результатов ожидается, что грибковые организмы будут обнаружены в обычных мазках фекалий. Их точный вклад в здоровье и болезнь остается неясным, поскольку при сравнении здоровых собак с собаками с острой диареей не сообщалось о каких-либо существенных различиях в типах грибов.

    Рисунок 2. Преобладающие таксоны бактерий в образцах кала здоровых собак.Каждая полоса соответствует одной здоровой собаке. Обратите внимание, что представленные семейства бактерий широко варьируются, преобладают анаэробные бактерии, и соотношение этих бактериальных групп различается у каждой здоровой собаки. Обычная бактериальная культура пропускает эти анаэробные бактерии. Мазки кала, которые оценивают соотношение грамположительных и грамотрицательных бактерий, также бесполезны для оценки дисбактериоза, поскольку каждая собака имеет уникальное соотношение этих групп.

    Роли

    Сбалансированный микробиом имеет решающее значение для поддержания здоровья хозяина.Нормальная микробиота выполняет следующие функции:

    • Модулирует иммунную систему
    • Контролирует вторжение энтеропатогенов
    • Обеспечивает хозяина питательными веществами путем метаболизма и ферментации различных пищевых компонентов

    Кишечные бактерии также способствуют развитию физиологии кишечника. Это было продемонстрировано в исследованиях на выращенных без микробов мышах, которые демонстрируют измененную архитектуру эпителия (например, уменьшенное количество лимфоидных фолликулов) по сравнению с мышами, которые подверглись воздействию бактерий при рождении.

    Постоянные перекрестные помехи между кишечной микробиотой и иммунными клетками хозяина опосредуются комбинацией метаболитов микробного происхождения (например, короткоцепочечных жирных кислот [SCFA], индола, вторичных желчных кислот), а также молекул на поверхности бактерий, которые активируют рецепторы врожденной иммунной системы хозяина (например, Toll-подобные рецепторы, дендритные клетки).

    Комменсальные бактерии, которые предотвращают вторжение в слизистую оболочку транзиторных патогенов за счет конкуренции за питательные вещества и места адгезии эпителия, являются важной частью кишечного барьера.Кроме того, они создают физиологически ограничивающую среду для нерезидентных видов бактерий за счет секреции антимикробных соединений и модуляции pH в просвете.

    Основные группы бактерий в кишечнике - это строгие или факультативные анаэробы. Преобладающие семейства бактерий в толстом кишечнике (, рис. 2 ) сбраживают пищевые углеводы (например, крахмал, целлюлозу, пектин, инулин), что приводит к образованию SCFA (например, ацетата, пропионата, бутирата) и других метаболитов.SCFA являются важным источником энергии и факторов роста эпителиальных клеток кишечника и оказывают модулирующее действие на перистальтику кишечника. Кроме того, SCFA обладают иммуномодулирующим действием. Например, бутират индуцирует иммунорегуляторные Т-клетки, а ацетат благотворно модулирует кишечную проницаемость.

    Новая область исследований направлена ​​на лучшее описание биологических функций дополнительных метаболитов бактериального происхождения, которые недавно были признаны регуляторами здоровья хозяина, таких как индол и вторичные желчные кислоты.Например, диетический триптофан метаболизируется бактериями в индол, который, как было показано, снижает экспрессию интерлейкина-8, усиливает барьерную функцию кишечника и улучшает энтеропатию, вызванную приемом нестероидных противовоспалительных препаратов у мышей. 10 Некоторые виды бактерий в толстой кишке превращают первичные желчные кислоты во вторичные желчные кислоты (например, литохолевую и дезоксихолевую кислоты). Следовательно, вторичные желчные кислоты присутствуют в толстой кишке в гораздо более высоких концентрациях, чем первичные желчные кислоты.Такая высокая концентрация вторичных желчных кислот в толстой кишке полезна, поскольку эти кислоты являются важным регулятором гомеостаза хозяина за счет активации различных рецепторов по всему телу. Например, специфический для желчных кислот мембранный рецептор TGR5 экспрессируется в желчном пузыре, в эпителии желчных протоков, на моноцитах и ​​макрофагах, а также в клетках мышц, почек, поджелудочной железы и кишечника. Активация этих рецепторов, к которым вторичные желчные кислоты имеют самое высокое сродство, подавляет экспрессию провоспалительных цитокинов и модулирует метаболизм инсулина и глюкозы за счет активации глюкагоноподобного пептида 1. 11

    Вторичные желчные кислоты также подавляют прорастание спор Clostridium difficile , тогда как увеличение количества первичных желчных кислот (эффект дисбактериоза) способствует прорастанию спор бактерий. Дисбактериоз кишечника приводит к уменьшению количества видов бактерий, превращающих желчные кислоты, и, следовательно, связан с дисметаболизмом желчных кислот (снижение вторичных и увеличение первичных желчных кислот) и потенциально системными эффектами на метаболизм хозяина. 12,13 Кроме того, аномальное увеличение первичных желчных кислот может вызвать секреторную диарею.

    ДИСБИОЗ

    Дисбиоз кишечника определяется как различия в соотношении бактериальных групп по сравнению с таковыми у здоровых собак и часто сопровождается сокращением видового разнообразия. Сообщалось о дисбактериозе кишечника при различных острых и хронических расстройствах желудочно-кишечного тракта, но он также может быть вызван применением антибиотиков широкого спектра действия. 1

    Значение микробиоты кишечника в регуляции иммунитета и метаболизма хозяина (, рис. 1 ) означает, что дисбиотический микробиом может иметь негативные последствия для хозяина.Однако степень клинических признаков варьируется от человека к человеку. Например, введение метронидазола здоровым собакам вызвало серьезные изменения в микробиоте кишечника с уменьшением количества комменсальных анаэробных бактерий и одновременным увеличением количества Escherichia coli ; эти изменения сопровождались обширными изменениями метаболических путей в просвете кишечника (например, усилением окислительного стресса, снижением вторичных желчных кислот). 14 У девяти из 16 собак на фоне приема антибиотиков развился жидкий стул, но у остальных собак не было никаких клинических признаков, несмотря на аналогичные микробные и биохимические изменения.Это говорит о том, что клинические признаки зависят от взаимодействия множества микробных факторов и факторов хозяина, некоторые из которых (например, лежащая в основе генетическая предрасположенность хозяина, пищевые и экологические триггеры) еще предстоит выяснить. Тем не менее, дисбактериоз, вызванный антибиотиками, является примером того, как изменения микробного состава и метаболизма могут повлиять на здоровье хозяина, поскольку вызванный антибиотиками дисбиоз в раннем детстве или повторная пульс-терапия признаны фактором риска развития аллергии, ожирения и воспалительных процессов. заболевание кишечника у человека. 3,15

    Новые эпидемиологические данные о людях и наше развивающееся понимание иммуномодулирующих и метаболических свойств кишечной микробиоты предполагают, что правильная диагностика и коррекция дисбактериоза будут важными целями при различных заболеваниях. Дисбиотический микробиом может причинить вред через несколько механизмов (, вставка 1 ), которые, вероятно, действуют одновременно. Диарея может быть вызвана бактериальными энтеротоксинами, которые стимулируют секрецию слизистой оболочки. Еще одним недавно признанным механизмом диареи у людей является мальабсорбция желчных кислот из-за неспособности дисбиотической микробиоты преобразовывать первичные желчные кислоты во вторичные. 13 Первоначальные исследования показывают, что такой механизм может также встречаться у собак и требует дальнейшего изучения. 12,16

    ВСТАВКА 1 Последствия дисбактериоза

    • Избыточное производство и перемещение бактериальных токсинов
    • Воспалительная стимуляция иммунной системы
    • Снижение уровня противовоспалительных метаболитов (например, SCFA, индолов, вторичных желчных кислот)
    • Изменения ферментов щеточной каймы
    • Повреждение рецепторов слизистой оболочки
    • Конкуренция за питательные вещества (например, витамин B12)
    • Повышенная кишечная проницаемость

    Оценка дисбактериоза

    Из-за важности комменсальной микробиоты для поддержания гомеостаза важно диагностировать дисбактериоз.Как уже отмечалось, бактериальный посев кала не может охарактеризовать многие анаэробы в желудочно-кишечном тракте. Подсчитано, что только очень небольшой процент кишечных бактерий можно культивировать с помощью стандартных лабораторных методов. Лучший способ полностью охарактеризовать микробиоту - это платформы высокопроизводительного секвенирования, которые могут обеспечить обзор пропорций всех бактериальных групп в образце; однако стоимость и длительные сроки выполнения ограничивают использование этого метода для исследовательских исследований. Использование анализов полимеразной цепной реакции (ПЦР) для нацеливания на определенные бактериальные таксоны, которые постоянно изменяются у собак с хроническими энтеропатиями (ХЭ), может обеспечить более быстрые результаты. 1

    Результаты этих множественных ПЦР-анализов можно объединить и выразить в виде математического соотношения, индекса дисбактериоза (DI; , рис. 3 ). Отрицательный DI (<0) указывает на нормальную микробиоту, тогда как положительный DI (> 0) указывает на дисбактериоз, связанный с CE. 17 Затем DI можно использовать для мониторинга реакции микробиоты на терапию CE. Первоначальные долгосрочные последующие исследования на собаках с CE показывают, что микробиому требуется несколько месяцев для нормализации, даже если собаки реагируют в течение нескольких недель снижением показателей клинической активности. 18

    Недавнее небольшое исследование, в котором оценивали 3 собак с CE, использовало DI для мониторинга микробных изменений фекалий в ответ на трансплантацию фекальных микробов. 19 Все 3 собаки первоначально показали немедленное снижение DI, но через 3 недели дисбактериоз вернулся у 1 собаки (увеличение DI выше 2), при этом клинические признаки не улучшились. У оставшихся 2 собак наблюдалось частичное улучшение клинических признаков, и их DI оставался ниже 0 в течение большей части 8-недельного периода наблюдения.Этот первоначальный небольшой набор данных предполагает возможность мониторинга микробиоты с течением времени у пациентов с КЭ и после трансплантации фекальных микробов, но необходимы дополнительные исследования для определения точности и клинической применимости анализа микробиоты.

    Анализ образцов кала дает информацию только об изменениях микробиоты просвета. Использование флуоресцентной гибридизации in situ (FISH) образцов кишечной биопсии позволяет визуализировать, переместились ли бактерии в эпителий слизистой оболочки, как это наблюдается у собак с гранулематозным колитом. 20 Положительный результат указывает на необходимость антимикробной терапии для удаления перемещенных бактерий. FISH требует специального анализа и доступен только в нескольких справочных лабораториях.

    Хотя оценка микробиоты кала полезна для распознавания дисбактериоза в толстом кишечнике, образцы кала, вероятно, не точно отражают ситуацию в тонком кишечнике. Хотя образцы фекалий многих собак с заболеванием тонкого кишечника показывают дисбактериоз, у подгруппы собак может быть дисбактериоз исключительно тонкого кишечника.Измерения сывороточных концентраций кобаламина и фолиевой кислоты остаются наиболее полезными маркерами дисбактериоза тонкого кишечника. У собак с дисбактериозом тонкого кишечника может быть снижено содержание кобаламина в сыворотке крови и может повыситься концентрация фолиевой кислоты в сыворотке; изменение обоих параметров очень указывает на состояние.

    Недавние исследования оценили связь между дисбиозом и изменениями в различных биохимических путях (например, аномальный метаболизм желчных кислот, аминокислот и триптофана), которые влияют на иммунную систему и метаболизм хозяина. 18,21 Многие новые метаболические биомаркеры, такие как концентрации фекальных желчных кислот, исследуются для лучшей оценки этиологии и лечения заболеваний ЖКТ, и вскоре они могут стать полезными в повседневной практике.

    Рисунок 3. Индекс дисбактериоза (DI) повышен у собак с хроническими энтеропатиями (CE). DI - это математическое соотношение, которое суммирует численность различных бактериальных групп (например, E coli, Faecalibacterium, Blautia, Fusobacterium) в одно число.DI ниже 0 указывает на нормальную микробиоту, а DI выше 0 указывает на дисбактериоз в толстой кишке. Анализ DI коммерчески доступен в Лаборатории желудочно-кишечного тракта Техасского университета A&M.

    Терапевтические рекомендации по коррекции дисбактериоза

    Микробиота играет важную роль в метаболизме организма. Недавние метаболомные исследования четко связали дисбактериоз с различными заболеваниями желудочно-кишечного тракта и за его пределами. Однако требуется дополнительная работа, чтобы определить, как модулировать микробиом для наилучшего терапевтического успеха и предсказать ответ на конкретную терапию.

    Диета и противомикробная терапия

    Дисбиоз присутствует у многих собак с CE и может быть причиной диареи у некоторых пациентов, но дисбактериоз также может быть следствием воспаления желудочно-кишечного тракта у других пациентов. Вероятен градиент различных паттернов заболевания у разных пациентов, причем иммунная система хозяина и микробиом вносят свой вклад в разной степени. Следовательно, наличие дисбактериоза не означает немедленной необходимости в антимикробной терапии, поскольку собаки с чувствительной к диете CE также могут иметь дисбактериоз.Некоторые животные с диареей благоприятно реагируют на противомикробные препараты, но антибиотики могут вызывать диарею у других. Длительное введение антибиотиков может вызвать паттерны дисбиоза, которые могут стать фактором риска различных метаболических заболеваний, например, из-за индукции дисметаболизма желчных кислот. 3 В настоящее время лучшим терапевтическим подходом к лечению хронических заболеваний желудочно-кишечного тракта остается эмпирический подход с последовательным протоколом испытаний пищевых продуктов, противовоспалительных и / или противомикробных препаратов.

    Пробиотики и пребиотики

    Поскольку микробиота участвует в патофизиологии хронического желудочно-кишечного заболевания, может оказаться целесообразным добавление пробиотической и пребиотической терапии.Пробиотики - это живые микроорганизмы, которые при введении в достаточном количестве приносят пользу здоровью хозяина. В нескольких исследованиях оценивалась польза пробиотиков при острых и хронических заболеваниях желудочно-кишечного тракта. Данные свидетельствуют о том, что пробиотики оказывают лишь незначительное влияние на кишечную микробиоту, но их положительный эффект у собак с воспалительными заболеваниями кишечника может быть частично связан с иммунной стимуляцией и / или усилением барьерной функции кишечника. 22 Кроме того, похоже, что введение более высоких доз и нескольких штаммов приводит к более высокой вероятности того, что пробиотические бактерии смогут колонизировать кишечник.

    Пребиотики - это ферментируемые и неферментируемые волокна, которые после достижения толстой кишки метаболизируются кишечными бактериями с образованием SCFA и других метаболитов, которые могут иметь иммуномодулирующее действие. Большинство коммерческих кишечных диет содержат пребиотики.

    Трансплантация фекальных микробов

    Трансплантация фекальных микробов вызвала большой интерес. Хотя это очень успешный терапевтический подход у людей с рецидивирующим заболеванием C difficile , его использование при КЭ у собак требует дальнейшего изучения, поскольку патофизиология этих заболеваний различается.Отдельные данные и мелкомасштабные исследования предполагают, что трансплантация фекальных микробов может быть многообещающей для подгруппы собак с CE, 19 , но в настоящее время правильный отбор пациентов является чисто эмпирическим и требуются дополнительные исследования.

    Ссылки

    1. Хоннеффер Дж. Б., Минамото Ю., Суходольски Дж. С.. Изменения микробиоты при остром и хроническом воспалении желудочно-кишечного тракта у кошек и собак. World J Gastroenterol 2014; 20: 16489-16497.
    2. Саари А., Вирта Л.Дж., Санкилампи У. и др.Воздействие антибиотиков в младенчестве и риск ожирения в первые 24 месяца жизни. Педиатрия 2015; 135: 617-626.
    3. Vrieze A, Out C, Fuentes S и др. Влияние перорального ванкомицина на микробиоту кишечника, метаболизм желчных кислот и чувствительность к инсулину. Дж. Hepatol 2014; 60: 824-831.
    4. Suchodolski JS. Диагностика и интерпретация дисбактериоза кишечника у собак и кошек. Vet J 2016; DOI: 10.1016 / j.tvjl.2016.04.011
    5. German AJ, Day MJ, Ruaux CG, et al.Сравнение прямых и непрямых тестов на избыточный бактериальный рост в тонком кишечнике и антибиотикочувствительную диарею у собак. J Vet Intern Med 2003; 17: 33-43.
    6. Mentula S, Harmoinen J, Heikkilä M и др. Сравнение культивируемых микробиот тонкого кишечника и фекалий у гончих. Appl Environ Microbiol 2005; 71: 4169-4175.
    7. Suchodolski JS, Camacho J, Steiner JM. Анализ бактериального разнообразия в двенадцатиперстной кишке, тощей кишке, подвздошной и толстой кишке собак с помощью сравнительного анализа гена 16S рРНК. FEMS Microbiology Ecology 2008; 66: 567-578.
    8. Guard BC, Suchodolski JS. Симпозиум по видам лошадей - микробиология и метагеномика кишечника собак: от филогении к функции. J Anim Sci 2016; 94: 2247-2261.
    9. Фостер М.Л., Дауд С.Е., Стефенсон С. и др. Характеристика грибкового микробиома (микобиома) в образцах фекалий собак. Vet Med Int 2013; 2013: 658373.
    10. Whitfield-Cargile CM, Cohen ND, Chapkin RS, et al. Полученный из микробиоты метаболит индол уменьшает воспаление и повреждение слизистой оболочки на мышиной модели энтеропатии, связанной с НПВП. Кишечные микробы 2016; 7: 246-261.
    11. Павлидис П., Пауэлл Н., Винсент Р.П. и др. Систематический обзор: желчные кислоты и воспаление кишечника - агрессоры просвета или регуляторы защиты слизистой оболочки? Aliment Pharmacol Ther 2015; 42: 802-817.
    12. Honneffer J, Guard B, Steiner JM, et al. Mo1805 Ненаправленная метаболомика выявляет нарушение метаболических путей желчных кислот, холестерина и триптофана у собак с идиопатическим воспалительным заболеванием кишечника. Гастроэнтерология 2015; 148: S-715 (аннотация).
    13. Duboc H, Rajca S, Rainteau D и др. Соединение дисбактериоза, дисметаболизма желчных кислот и воспаления кишечника с воспалительными заболеваниями кишечника. Кишечник 2013; 62: 531-539.
    14. Suchodolski JS, Olson E, Honneffer J, et al. Влияние диеты с гидролизованным белком и метронидазола на фекальный микробиом и метаболом у здоровых собак. J Vet Intern Med 2016; 30: 1455 (аннотация).
    15. Cox LM, Blaser MJ. Антибиотики в молодости и ожирении. Нат Рев эндокринол 2015; 11: 182-190.
    16. Kent AC, Cross G, Taylor DR, et al. Измерение сывороточного 7альфа-гидрокси-4-холестен-3-она как маркера мальабсорбции желчных кислот у собак с хронической диареей: пилотное исследование. Vet Rec Open 2016; 3: e000163.
    17. Alshawaqfeh M, Guard M, Minamoto Y, et al. Индекс дисбактериоза для оценки микробных изменений в образцах кала собак с хронической энтеропатией. J Vet Intern Med 2016; 30: 1536 (аннотация).
    18. Minamoto Y, Otoni CC, Steelman SM, et al. Изменение фекальной микробиоты и профилей метаболитов в сыворотке крови у собак с идиопатическим воспалительным заболеванием кишечника. Кишечные микробы 2015; 6: 33-47.
    19. Gerbec Z. Оценка терапевтического потенциала восстановления гомеостаза желудочно-кишечного тракта с помощью трансплантации фекальной микробиоты у собак. Магистерская работа: Университет Любляны, Словения, 2016.
    20. Симпсон К.В., Доган Б., Ришнив М. и др. Прилипшая и инвазивная инфекция Escherichia coli связана с гранулематозным колитом у собак-боксеров. Infect Immun 2006; 74: 4778-4792.
    21. Guard BC, Barr JW, Reddivari L, et al.Характеристика микробного дисбактериоза и метаболических изменений у собак с острой диареей. PLoS ONE 2015; 10: e0127259.
    22. Росси Г., Пенго Г., Калдин М. и др. Сравнение микробиологических, гистологических и иммуномодулирующих параметров в ответ на лечение комбинированной терапией преднизоном и метронидазолом или пробиотическими штаммами VSL # 3 у собак с идиопатическим воспалительным заболеванием кишечника. Plos ONE 2014; 9: e94699.

    Это внутреннее чувство

    Если бы инопланетяне налетели из космоса и сжали человека, чтобы увидеть, из чего мы сделаны, они бы пришли к выводу, что клетка за клеткой, мы в основном бактерии.Фактически, одноклеточные организмы - в основном бактерии - в 10 раз превосходят наши собственные клетки, и большинство из них живут в кишечнике. Кишечник, в свою очередь, развил потрясающе сложную нейронную сеть, способную использовать эту бактериальную экосистему как для физического, так и для психологического благополучия.

    Идея о том, что бактерии, обитающие в кишечнике, известные под общим названием микробиом, могут влиять не только на кишечник, но и на разум, «только что вышла на сцену», - говорит нейроиммунолог Джон Биненсток, доктор медицины, из Университета Макмастера в Гамильтоне. Онтарио.Всего за последние несколько лет исследования на грызунах показали, что микробиом кишечника может влиять на нервное развитие, химию мозга и широкий спектр поведенческих явлений, включая эмоциональное поведение, восприятие боли и реакцию системы стресса.

    Исследования показали, например, что изменение баланса между полезными и болезнетворными бактериями в кишечнике животного может изменить химический состав его мозга и привести к тому, что оно станет более смелым или более тревожным. Мозг также может оказывать сильное влияние на кишечные бактерии; как показали многие исследования, даже легкий стресс может нарушить микробный баланс в кишечнике, делая хозяина более уязвимым к инфекционным заболеваниям и вызывая каскад молекулярных реакций, которые возвращаются в центральную нервную систему.

    Такие открытия открывают заманчивую возможность использования полезных или пробиотических бактерий для лечения расстройств настроения и тревожных расстройств - либо путем введения самих полезных микробов, либо путем разработки лекарств, имитирующих их метаболические функции. Новое исследование также намекает на новые способы лечения хронических желудочно-кишечных (ЖКТ) расстройств, которые обычно сопровождаются тревогой и депрессией, а также, по-видимому, связаны с аномальной микробиотой кишечника.

    Какими бы захватывающими ни были эти исследования, исследования того, как кишечные бактерии влияют на психологическое благополучие людей, все еще находятся в зачаточном состоянии.Во-первых, исследования почти полностью ограничивались грызунами. Во-вторых, исследователи только начали исследовать, как возникают такие эффекты. Наконец, исправление микробного дисбаланса для лечения болезней требует сначала определения того, что составляет здоровый микробиом кишечника - то, что ученые все еще пытаются понять.

    «Мы просто соскребаем с поверхности», - говорит гастроэнтеролог Университета Макмастера Премысл Берчик, доктор медицины. "Определенно данные на животных предполагают, что бактерии могут оказывать сильное влияние на поведение и биохимию мозга, вероятно, несколькими путями."Чтобы распутать эти биологические процессы и научиться применять эти знания для улучшения психологического здоровья человека, потребуется много лет.

    Жизнь внутри

    Человеческий кишечник - удивительная работа. Часто называемый «вторым мозгом», это единственный орган, который может похвастаться собственной независимой нервной системой, сложной сетью из 100 миллионов нейронов, встроенных в стенку кишечника. Эта нейронная сеть настолько сложна, что кишечник продолжает функционировать даже тогда, когда основной нервный канал между ним и мозгом, блуждающий нерв, разорван.(Ссылаясь на автономность и очевидную непогрешимость кишечной нервной системы, комик Стивен Колбер однажды окрестил кишечник «папой твоего туловища».)

    При рождении каждый кишечник бесплоден. Но со временем в кишечнике каждого человека вырабатывается разнообразная и отличная смесь видов бактерий, отчасти определяемая генетикой, а отчасти тем, какие бактерии живут в нас и на тех, кто нас окружает. 100 триллионов микробов, которые делают желудочно-кишечный тракт своей игровой площадкой, критически важны для здоровья. Кишечные бактерии регулируют пищеварение и обмен веществ.Они извлекают и производят витамины и другие питательные вещества из пищи, которую вы едите. Они программируют иммунную систему организма. Они создают и поддерживают стенку кишечника, защищающую организм от внешних захватчиков. И одним своим присутствием полезные бактерии в кишечнике блокируют создание лагерей вредных микробов и вырабатывают антимикробные химические вещества, которые защищают хозяина от патогенов.

    Кишечные бактерии также производят сотни нейрохимических веществ, которые мозг использует для регулирования основных физиологических процессов, а также психических процессов, таких как обучение, память и настроение.Например, кишечные бактерии производят около 95 процентов запасов серотонина в организме, который влияет как на настроение, так и на активность желудочно-кишечного тракта.

    Если принять во внимание многогранную способность кишечника взаимодействовать с мозгом, а также его решающую роль в защите тела от опасностей внешнего мира, «почти немыслимо, чтобы кишечник не играл решающей роли в состояниях разума», - говорит гастроэнтеролог Эмеран Майер, доктор медицины, директор Центра нейробиологии стресса Калифорнийского университета в Лос-Анджелесе.

    Действительно, целый ряд исследований, проведенных за последние несколько лет, показывает, что значение микробиома кишечника выходит за рамки физического здоровья: он также играет ключевую роль в связи кишечника и мозга. В одной поразительной демонстрации силы так называемой «оси микробиом-кишечник-мозг», опубликованной в журнале Gastroenterology в 2011 году, Беркик и его коллеги дали мышам BALB / c, мышам, которые обычно робкие и застенчивые, коктейль из антибиотиков, резко меняющий состав их кишечных бактерий.

    «Их поведение полностью изменилось», - говорит Берчик. «Они стали смелыми и предприимчивыми».

    Лечение антибиотиками также повысило уровень нейротрофического фактора головного мозга (BDNF) в гиппокампе. Это нейрохимическое вещество способствует развитию нейронных связей и является важным фактором памяти и настроения. Когда режим антибиотиков был прекращен, животные вскоре вернулись к своему обычному, осторожному образу жизни, и биохимия их мозга также вернулась к норме.

    В ходе последующего эксперимента команда Берчика выловила две линии мышей, рожденных и выросших в стерильной среде: робких мышей BALB / c и мышей NIH Swiss, известных своим смелым исследовательским поведением.Затем исследователи колонизировали каждую группу этих «стерильных» мышей бактериями мышей противоположной линии. Результат этого микробного обмена был поразительным: обычно склонные к тревоге мыши BALB / c стали гораздо более бесстрашными исследователями, в то время как типично смелые мыши NIH Swiss внезапно стали более нерешительными и застенчивыми. Результаты, говорит Берчик, подчеркивают, что, по крайней мере, у лабораторных мышей некоторые, казалось бы, внутренние характеристики обусловлены не только самими животными, но и микробами, населяющими кишечник.Будет ли эта закономерность сохраняться у людей, чьи кишки содержат более разнообразные микробные сообщества, еще предстоит увидеть, говорит Берчик.

    Не обязательно проводить полномасштабную трансплантацию микробов, чтобы вызвать изменение поведения. Добавление одного бактериального штамма также может изменить поведение мышей. В одном из самых ранних исследований, показывающих, что добавление одной бактерии может повлиять на поведение, микробиолог Марк Лайт, доктор философии из Центра медицинских наук Техасского технологического университета, и его коллеги размешали небольшую дозу патогенной бактерии Campylobacter jejuni - слишком мало, чтобы вызвать заражение иммунный ответ - в физиологический раствор и скармливали им группе лабораторных мышей.Результаты, опубликованные в журнале « Physiology and Behavior » в 1998 году, показали, что два дня спустя мыши, потреблявшие бактерии, были более осторожны при входе в открытые участки лабораторного лабиринта - обычная мера беспокойства у грызунов - по сравнению с мышами из контрольной группы. группа.

    Обещание пробиотиков

    В то время как вредные бактерии могут усиливать беспокойство, несколько исследований показали, что полезные бактерии могут успокаивать склонных к беспокойству мышей. В исследовании 2011 года, опубликованном в журнале Proceedings of the National Academy of Sciences , например, Биненсток и его коллеги кормили одну группу мышей бульоном BALB / c с добавлением Lactobacillus rhamnosus , микроба, который часто рекламируется за его пробиотические свойства.Мыши в контрольной группе получали только бульон без микробного бонуса. Через 28 дней исследователи провели на мышах серию тестов, чтобы выявить признаки беспокойства или депрессии.

    По сравнению с мышами в контрольной группе, те, кого кормили Lactobacillus, были более склонны входить в открытые участки лабиринта, а также с меньшей вероятностью сдавались и просто начинали плавать, когда подвергались тесту «принудительного плавания» - тесту, который служит мышиный аналог некоторых аспектов человеческой депрессии. Пробиотическая диета также притупляла физиологические реакции животных на стресс от теста принудительного плавания, заставляя их производить более низкие уровни гормона стресса кортикостерона.А у мышей, которых кормили Lactobacillus , в некоторых областях мозга было обнаружено увеличение количества рецепторов гамма-аминомасляной кислоты или ГАМК - нейромедиатора, который подавляет активность нейронов, сдерживая тревогу.

    Многие исследователи задавались вопросом, могут ли полезные кишечные бактерии смягчить беспокойство и депрессию, которые часто сопровождают расстройства желудочно-кишечного тракта, такие как болезнь Крона, язвенный колит и синдром раздраженного кишечника (СРК). Bercik и его коллеги исследовали этот вопрос в исследовании 2010 года, опубликованном в Gastroenterology.Сначала они заразили мышей паразитом, чтобы вызвать хроническое воспаление кишечника слабой степени. Помимо воспаления кишечника, это лечение подавляло уровни BDNF в гиппокампе и заставляло мышей вести себя более тревожно. Когда мышей затем лечили 10-дневным курсом полезного микроба Bifidobacterium longum, их поведение нормализовалось, как и их уровни BDNF.

    Как кишечные бактерии могут так сильно влиять на мозг и поведение? Один из способов, как показывают некоторые исследования, - это задействовать саму иммунную систему, используя иммунные клетки и химические вещества, которые они синтезируют, для отправки сообщений в мозг.Но, как показало исследование Лайта 1998 года, некоторые бактерии могут вызывать изменения в поведении, даже не вызывая иммунного ответа, предполагая, что должны работать и другие каналы коммуникации кишечника и мозга. В других исследованиях Биненшток и другие обнаружили, что, по крайней мере, в некоторых случаях бактерии общаются с мозгом через блуждающий нерв: когда блуждающий нерв разрывается, влияние кишечных бактерий на биохимию мозга, реакцию на стресс и поведение исчезает. Эти результаты не только проливают свет на то, как бактерии могут влиять на мозг, но и подходят для других исследований у людей, которые предполагают, что стимуляция блуждающего нерва может использоваться в качестве последнего средства для лечения депрессии.«Это открывает идею о том, что как только мы узнаем, как бактерии разговаривают с блуждающим нервом, мы сможем смоделировать это с помощью новых молекул - лекарств без бактерий», - говорит Биненшток.

    Lyte в статье BioEssays от 2011 г. предложил нейрохимическую «систему доставки», с помощью которой кишечные бактерии, такие как пробиотики, могут отправлять сообщения в мозг. Кишечные бактерии производят одни и те же нейрохимические вещества, такие как ГАМК, серотонин, норадреналин, дофамин, ацетилхолин и мелатонин, и реагируют на них, которые мозг использует для регулирования настроения и познания.Такие нейрохимические вещества, вероятно, позволяют мозгу настраивать свое поведение на обратную связь, которую он получает от армии бактерий в кишечнике. "И почему бы нет?" - спрашивает Лайт. В конце концов, говорит он, учитывая огромное количество бактерий, обитающих в кишечнике человека, «разве не имеет смысла, что ваш мозг захочет следить за этим?» Однако вопрос о том, как будет развиваться это общение, остается открытым. «Мы действительно находимся в начале попыток понять, как все взаимосвязано», - говорит Лайт. По его словам, уже ясно, что «это очень интерактивная среда, гораздо более интерактивная, чем мы когда-либо ожидали, когда пытались понять эти вещи как автономные системы.«

    Программирование развития мозга

    Некоторые исследования показывают, что влияние микробиома кишечника на поведение начинается вскоре после рождения, когда микробы помогают «программировать» некоторые аспекты развития мозга, такие как его характерная реакция на стресс. В влиятельном исследовании 2004 года, опубликованном в журнале Journal of Physiology , нейроиммунолог Нобуюки Судо, доктор медицины из Университета Кюсю в Японии, обнаружил, что у мышей, свободных от микробов, короткий период заключения - стрессор, обычно используемый в экспериментах на грызунах, - вызывает преувеличенные реакция оси гипоталамус-гипофиз-надпочечники (HPA), нейроэндокринной сети, которая управляет физиологической реакцией организма на стресс.В частности, команда обнаружила, что у подвергнутых стрессу свободных от микробов мышей были повышенные уровни двух основных гормонов стресса, кортикостерона и адренокортикотропина.

    Группа Судо обнаружила, что можно частично обратить вспять эту преувеличенную реакцию на стресс, но только в течение короткого периода времени на раннем этапе развития. Когда исследователи трансплантировали образцы фекалий мышей с нормальной флорой кишечника в толстую кишку стерилизованных младенцев мышей или даже только одного полезного микроба, Bifidobacterium infantis , мыши позже показали нормальную стрессовую реакцию на HPA.Но если пересадка фекалий откладывалась до момента отлучения мышей от груди, у животных продолжалась повышенная реакция на стресс.

    Последующие исследования предоставили дополнительные доказательства того, что раннее воздействие нормальных кишечных бактерий важно для развития мозга и поведения. В исследовании 2011 года, опубликованном в журнале Proceedings of the National Academy of Sciences , нейробиолог Рохеллис Диас Хейц, доктор философии из Каролинского института в Швеции, и его коллеги обнаружили, что стерильные, не подвергшиеся стрессу мыши были более активны и охотнее исследовали открытые участки. лабиринта, чем мышей с нормальной кишечной микробиотой.Как и группа Судо, Хейц и ее коллеги смогли стереть эти поведенческие различия, трансплантировав нормальные кишечные бактерии беспроблемным мышам, но только если они сделали это, когда мыши были младенцами, что снова указывает на то, что существует критическое окно для кишечных бактерий чтобы установить нормальные модели поведения у животного-хозяина.

    Улица с двусторонним движением

    Подобно тому, как кишечные бактерии влияют на мозг, мозг также может оказывать глубокое влияние на микробиом кишечника - с эффектами обратной связи на поведение.Например, многочисленные исследования показали, что психологический стресс подавляет полезные бактерии. В исследовании 2004 года, опубликованном в журнале Journal of Pediatric Gastroenterology and Nutrition , интегративный иммунолог Майкл Бейли, ныне работающий в Университете штата Огайо, и его коллеги из Университета Висконсин-Мэдисон обнаружили, что детеныши обезьян, чьи матери были напуганы громким звуком во время беременности, имели меньше Lactobacilli и Bifidobacteria . Результаты также распространяются на людей. В 2008 году исследователи под руководством психолога Саймона Ноулза, доктора философии из Технологического университета Суинберна в Австралии, обнаружили, что во время экзаменационной недели образцы стула студентов университета содержали меньше лактобацилл, чем в относительно спокойные первые дни семестра.

    В исследовании 2011 года на мышах, опубликованном в журнале Brain, Behavior and Immunity , Бейли, Лайт и его коллеги изучали, как такие вызванные стрессом изменения микробиома кишечника влияют на здоровье. Они сообщили, что совместное использование клетки с более агрессивными мышами - стрессором для «социального разрушения» - подавляло количество полезных бактерий, уменьшало общее разнообразие микробиома кишечника и способствовало чрезмерному росту вредных бактерий, делая животных более восприимчивыми к инфекции и вызывая воспаление у них. кишечник.

    В последующем исследовании Бейли и его коллеги обнаружили, что введение мышам антибиотиков широкого спектра действия для подавления кишечных бактерий предотвращает воспаление, вызванное стрессом. Точно так же они обнаружили, что у беспроблемных мышей также не было вызванного стрессом воспаления, но когда стерильные мыши были заселены нормальной популяцией бактерий, стресс снова спровоцировал воспаление кишечника.

    «Благодаря всем этим экспериментам мы действительно уверены, что эти кишечные бактерии играют роль в вызванном стрессом усилении воспаления», - говорит Бейли.

    Изменения микробиома, вызванные стрессом, могут, в свою очередь, повлиять на мозг и поведение. Несколько исследований показывают, что защитные молекулы, вырабатываемые кишечником во время инфекции, называемые воспалительными цитокинами, нарушают нейрохимию мозга и делают людей более уязвимыми для беспокойства и депрессии. Берсик считает, что этот процесс может помочь объяснить, почему более половины людей с хроническими расстройствами желудочно-кишечного тракта, такими как болезнь Крона, язвенный колит и синдром раздраженного кишечника (СРК), также страдают от тревожности и депрессии.

    Признание того, что связь между мозгом и кишечником является двунаправленной, также указывает на новые способы лечения как физических симптомов кишечных заболеваний, так и психологических расстройств, которые так часто присутствуют. Берчик предполагает, что сдерживание тревожности и депрессии может уменьшить воспаление в кишечнике; а лечение воспаления в кишечнике может улучшить настроение за счет изменения биохимии мозга.

    Но прежде чем клиницисты смогут использовать кишечные бактерии для лечения физиологических или психологических расстройств, необходимо провести гораздо больше исследований.Несмотря на большой интерес к тому, как полезные кишечные бактерии могут способствовать психологическому благополучию, лишь немногие исследования изучали такие эффекты у людей. В одном из таких исследований, опубликованном в British Journal of Nutrition в 2011 году, исследователи обнаружили, что 30-дневный курс пробиотических бактерий (смесь Lactobacillus helveticus и Bifidobacteria longum ) привел к снижению тревожности и депрессии у здоровых добровольцев. .

    Стремясь лучше понять, как кишечные бактерии влияют на активность мозга человека, Майер и его сотрудник, гастроэнтеролог из Калифорнийского университета в Лос-Анджелесе Кирстен Тилш, доктор медицинских наук, только что завершили нейровизуализационное исследование, в котором изучается влияние пробиотиков на активность мозга у здоровых добровольцев.Майер отказывается подробно описывать результаты исследования, поскольку они еще не опубликованы, но говорит, что результаты показали «наблюдаемое» влияние на деятельность мозга добровольцев, когда они рассматривали либо нейтральные, либо отрицательные эмоциональные стимулы.

    Со своей стороны, Берчик и его сотрудники решили выяснить, влияют ли кишечные бактерии на настроение и функции мозга у пациентов с СРК, которые также страдают депрессией и тревогой, и как. Сейчас они набирают пациентов для исследовательского исследования, в котором будет изучено влияние пробиотика Bifidobacterium longum на различные показатели, включая настроение, функцию мозга и биохимию мозга.Они надеются получить результаты к концу этого года.

    Дни анализа кишечных бактерий пациента для лечения депрессии или тревоги, вероятно, далеки. Тем не менее, ученые, следящие за этим направлением исследований, все больше убеждаются в том, что для полного понимания наших эмоций и поведения нам необходимо изучать кишечник не меньше мозга.


    Сири Карпентер, доктор философии, писатель из Мэдисона, Висконсин.

    Кишечный микробиом в лечении биполярного расстройства и фармакотерапии - FullText - Neuropsychobiology 2020, Vol.79, № 1

    Аннотация

    Микробиом кишечника - это сложное и динамичное сообщество комменсальных, симбиотических и патогенных микроорганизмов, которые существуют в двунаправленных отношениях с хозяином. Бактериальные функции в кишечнике играют решающую роль в функционировании здорового организма-хозяина, и их нарушение может способствовать возникновению многих заболеваний. Взаимосвязь между кишечной микробиотой и мозгом привлекла внимание специалистов в области психического здоровья из-за растущего числа доказательств, подтверждающих связь кишечных бактерий с настроением и поведением.У пациентов с биполярным расстройством наблюдается повышенная частота желудочно-кишечных заболеваний, таких как воспалительное заболевание кишечника, которое механически связано с функцией микробного сообщества. Хотя неоднородность микробных сообществ между людьми может быть связана с риском заболевания, она также может снизить эффективность или побочные эффекты, связанные с использованием лекарств. В следующем обзоре освещаются опубликованные данные, связывающие функцию микробиоты кишечника как с риском биполярного расстройства, так и с действием лекарств, влияющих на микробиоту, воспаление и симптомы настроения.

    © 2019 S. Karger AG, Базель


    Введение

    Биполярное расстройство (БР) - тяжелое психологическое заболевание, которое определяется изменениями настроения и энергии [1]. Независимо от национальности, этнической принадлежности или социально-экономического статуса, БР поражает 1% населения мира, ассоциируется с более высокими показателями злоупотребления психоактивными веществами и сердечно-сосудистыми заболеваниями и представляет собой серьезный источник инвалидности [2-4]. Этиология BD до конца не изучена.Полногеномные исследования ассоциации показывают, что шизофрения и BD генетически перекрываются, и многие идентифицированные гены риска связаны с иммунным ответом и воспалением [5-7]. Хотя генетические факторы распознаются в патогенезе BD, эти идентифицированные гены риска составляют лишь небольшую часть риска заболевания.

    Растущие данные подтверждают наличие двунаправленной связи между мозгом и микробиотой кишечника (называемой «ось кишечник-мозг»), которая может влиять на поведение и патологию психических заболеваний.Микробиом человека - это «сообщество комменсальных, симбиотических и патогенных микроорганизмов», населяющих наш организм [8]. Последнее десятилетие привело к расширению доступа к методам секвенирования и биоинформатики следующего поколения, которые помогли показать, что микробиота кишечника играет критически важную роль в здоровье человека, но также может способствовать риску заболеваний в определенных группах населения [9]. Структура сообщества кишечного микробиома является изменчивой по составу у разных людей и также будет варьироваться в пределах одного и того же человека в зависимости от пространства или периода времени, в котором проводится выборка [10].Текущие исследования направлены на определение того, может ли эта неоднородность в составе микробиома способствовать риску заболевания или как люди реагируют на лекарства, что приводит к неоптимальному ответу на лекарственную терапию. В этом обзоре мы стремимся выделить опубликованные доказательства, которые не только связывают функцию микробиоты кишечника с BD, но также описывают влияние микробов кишечника на фармакотерапию.

    Желудочно-кишечные сопутствующие заболевания, кишечное воспаление и метаболизм триптофана в BD

    Желудочно-кишечные патологии (ЖКТ) давно признаны частыми сопутствующими заболеваниями при ББ и других психологических заболеваниях, что подтверждает теорию о взаимосвязи патологии ЖКТ и психических заболеваний.В то время как, в зависимости от используемых диагностических критериев, синдром раздраженного кишечника (СРК) оценивается примерно у 11% населения в целом [11]. Напротив, частота коморбидности с психическими расстройствами у лиц, обращающихся за лечением от СРК, колеблется от 54 до 94% [12, 13]. Метаанализ, включавший 177 117 пациентов с СРК и 192 092 здоровых человека в контрольной группе, показал, что распространенность СРК, в частности, была значительно выше в популяции СРК по сравнению со здоровыми добровольцами (OR = 2,48, p <0.001) [14].

    Пациенты с СРК также обнаруживают различия в морфологии мозга по сравнению со здоровыми добровольцами [15, 16]. Недавнее исследование пациентов с СРК сгруппировало кишечные микробные сообщества по 2 различным подтипам; либо участники СРК демонстрировали здоровый микробиом, подобный контролю, несмотря на сопутствующие желудочно-кишечные симптомы (ГК-СРК), либо участники демонстрировали микробную структуру, отличную от здоровых контрольных субъектов (СРК1) [17]. Участники, демонстрирующие особый подтип микробного сообщества IBS1, были не только обогащены людьми, перенесшими травмы в раннем возрасте (переменная окружающей среды для психического заболевания), но также показали коррелированные структурные изменения мозга, которые были связаны со структурой их сообщества микробиома.

    Воспаление кишечника, по-видимому, особенно актуально как способ двунаправленной коммуникации между кишечником и мозгом, механизм, на который сильно влияет функционирование кишечных микробов [18-20]. Воспаление кишечника может вызвать фенотип «дырявого кишечника» за счет уменьшения содержания содержимого кишечника, в частности, грамотрицательных липополисахаридов, которые могут просачиваться в кровоток и вызывать как центральные, так и системные воспалительные иммунные реакции, одновременно отбирая для выживания определенные виды бактерий, которые могут переносят иммунный ответ хозяина [21-23].У пациентов с ББ часто наблюдается периферическое воспаление низкой степени с дальнейшим повышением уровня провоспалительных цитокинов во время эпизодов настроения [24]. Было показано, что у пациентов с шизофренией и BD более высокие уровни сывороточных антител к грибковым организмам, таким как Saccharomyces cerevisiae и Candida albicans, , а также растворимому CD14 (sCD14), белку-маркеру бактериальной транслокации [25–29]. Помимо кишечной транслокации микробов, пациенты с BD также демонстрируют повышенное воздействие других связанных с кишечником маркеров, таких как пищевые белки из системы GI [30].

    Тем не менее, у пациентов с BD существуют значительные различия в предрасположенности к хроническому воспалению [30-32]. Специфические параметры окружающей среды, такие как история неблагоприятных исходов в детстве, связаны с повышением провоспалительных цитокинов плазмы по сравнению с диагнозом без травм в раннем возрасте [31, 33]. Другие данные показывают, что такие факторы, как антипсихотические препараты или диетические продукты, могут ослабить этот фенотип дырявого кишечника [25, 34]. Однако эта и другие теории, описывающие воспалительные механизмы, остаются совершенно неспецифичными для психологических заболеваний.

    Измененная иммуно-воспалительная активность, проявляющаяся при шизофрении и ББ, также может проявляться через изменения в путях метаболизма триптофана [35-37]. Триптофан является диетической аминокислотой и предшественником как кинуренового пути, так и пути синтеза серотонина (5-HT) [37]. Преобладающим путем метаболизма триптофана является кинуреновый путь, который превращает триптофан в возбуждающие нейротрансмиттеры, многие из которых являются антагонистами эндогенных рецепторов N-метил-d-аспартата (NMDAR) [38].В рамках этого пути диетический триптофан метаболизируется в печени, триптофан-2,3-диоксигеназой (TDO2) , или внепеченочно, индоламин-2,3-диоксигеназой 1 (IDO1) , в кинуренин (Kyn) [ 35, 39]. Кинуренин далее метаболизируется до ряда биологически активных метаболитов, таких как кинуреновая кислота (KynA), антагонист NMDAR [40], гидроксикинуренин (3-HK), который метаболизируется до хинолиновой кислоты, нейротоксина [41]. Данные показывают, что избыток метаболитов кинуренина наблюдается у пациентов с психологическим заболеванием, таким как BD [35, 36].В клиническом исследовании, проведенном Birner et al. [42], уровни метаболита триптофана в периферической крови у 143 пациентов с эутимией и умеренной депрессией сравнивали с таковыми у 101 здорового контроля. Авторы обнаружили, что уровни KynA были снижены у пациентов с BD по сравнению с контрольной группой. Этот пониженный показатель KynA отразился в повышенных соотношениях 3-HK / Kyn и 3-HK / KynA, также обнаруженных у лиц с BD.

    В отличие от TDO2 , IDO1 обогащен лимфоидной тканью кишечника, и известно, что воспалительные сигналы повышают его активность, эффективно индуцируя выработку нейротоксичных соединений, которые потенциально способствуют когнитивной дисфункции и психозу [35, 43, 44].Несколько независимых исследований демонстрируют, что микробный H 2 O 2 ингибирует IDO1 , что приводит к снижению периферических киневринов и других метаболитов триптофана [20, 45, 46]. Интересно, что добавление пробиотика, содержащего Lactobacillus , показало снижение активности IDO1 во время хронической инфекции SIV в модели макака вируса иммунодефицита ВИЧ / обезьяны [45]. Однако взаимосвязь между кишечным ингибированием IDO1 и тяжестью симптомов BD не исследовалась ни на животных, ни на людях.

    Доклинические / клинические исследования кишечной микробиоты и BD

    Уже есть несколько недавних обзоров, которые элегантно резюмируют исследования, связывающие кишечную микробиоту с поведением или психическими заболеваниями [47, 48]. Однако ниже упомянуты некоторые из наиболее важных исследований, которые определили наш нынешний взгляд на «ось кишечник-мозг».

    Sudo et al. [49] были первыми, кто продемонстрировал, что присутствие кишечной микробиоты модулирует дальнодействующую реакцию гипоталамус-гипофиз-надпочечники на стресс [49].Эти эксперименты показали, что мыши без микробов (GF) (мыши, выращенные в стерильной среде и лишенные кишечных бактерий) проявляли повышенный стрессовый ответ, измеряемый повышенным высвобождением адренокортикотропного гормона и кортикостерона, по сравнению с контрольными мышами с кишечной микробиотой. Этот преувеличенный ответ гипоталамус-гипофиз-надпочечники был обращен введением Bifidobacterium infantis и несколько восстановлен при стуле мышей, выращенных обычным способом. Мыши GF также демонстрируют сниженное тревожное поведение в дополнение к измененным уровням нейротропных факторов мозга и других нейротрансмиттеров [49, 50].Важно отметить, что эта взаимосвязь между микробиотой и поведением была продемонстрирована на нескольких генетически различных линиях мышей GF, что усиливает взаимосвязь между микробиотой и поведением [50-52]. Взятые вместе, эти доклинические исследования демонстрируют, что наличие кишечной микробиоты, особенности раннего развития, важны для поведения мышей.

    Evans et al. [53] проанализировали микробиом стула пациентов с клиническим биполярным расстройством и контрольной группы из Лонгитюдного исследования биполярного расстройства Prechter, проводимого в Университете Мичигана.Авторы обнаружили значительные различия в микробных сообществах кишечника между биполярными и здоровыми участниками контрольной группы. Кроме того, у людей с BD наблюдалось снижение относительной численности кишечного микроба, известного как Faecalibacterium , по сравнению с контрольными участниками. Интересно, что для участников с BD относительная численность Faecalibacterium связана с лучшими показателями здоровья, о которых сообщают сами люди, на основе краткого опроса о состоянии здоровья (SF12), опросника о состоянии здоровья пациента (PHQ9), индекса качества сна Питтсбурга (PSQI), шкалу генерализованного тревожного расстройства (GAD7) и шкалу оценки мании Альтмана (ASRM) и независимо от ковариант. Faecalibacterium является распространенным кишечным грамположительным микроорганизмом, который продемонстрировал противовоспалительные свойства [54] и, как сообщается, снижается при таких состояниях, как воспалительное заболевание кишечника [55], неалкогольный стеатогепатит [56] и другие психические расстройства, такие как депрессия [ 57, 58].

    Специфические кишечные микробы также были связаны с симптомами настроения в клинической когорте большого депрессивного расстройства [59]. В этом исследовании показатели видового богатства или общего количества обнаруженных кишечных бактерий позволяли прогнозировать бессонницу и депрессию, в то время как численность Enterobacteriaceae прогнозировала тревожность.В том же исследовании численность Lactobacillus и Enterococcus также была положительно связана с психомоторным возбуждением. Последовательность исследований, связывающих определенные кишечные микробы с настроением и поведением, предполагает, что микробы нижних отделов кишечника могут быть предиктором болезни, связанной с депрессивным состоянием. Эти данные предполагают, что применение добавок или стратегий питания, которые могут терапевтически увеличить количество полезных организмов, таких как Faecalibacterium, , у пациентов с BD, может быть полезным для снижения бремени болезни; однако эту гипотезу необходимо проверить с помощью соответствующего дизайна исследования.

    Недавно Painold et al. [60] обнаружили снижение показателей видового богатства и разнообразия в образцах фекальных микробов людей с диагнозом BD по сравнению со здоровыми людьми из контрольной группы. Кроме того, авторы выявили значительное увеличение численности организмов, классифицированных как тип Actinobacteria и класс Coriobacteria из образцов BD. Сообщалось, что здоровые контрольные животные демонстрируют более высокую относительную численность организмов, таких как Rumicococcaceae spp.и, как и в исследовании Evans et al. [53], Faecalibacterium spp. Эти данные предполагают, что применение добавок или стратегий питания, которые могут терапевтически увеличить количество полезных организмов, таких как Faecalibacterium, , у пациентов с BD, может улучшить симптомы настроения, но это необходимо проверить с помощью проспективных клинических испытаний.

    Фармакотерапевтическое лечение BD и кишечной микробиоты

    Некоторые фармакотерапевтические препараты, включая литий, противосудорожные препараты и атипичные нейролептики (AAP), одобрены Федеральным управлением по лекарственным средствам для лечения острых и долгосрочных заболеваний BD.Хотя монотерапия является идеальным вариантом, для достижения ремиссии симптомов BD часто требуется комбинированная лекарственная терапия [61]. Схемы лечения могут включать антидепрессанты, которые добавляются в качестве вспомогательного лечения при биполярных депрессивных симптомах. Лечение, которое приводит к улучшению или ремиссии эпизода BD, сопровождается ухудшением симптомов или рецидивом эпизода у 39–52% пациентов, соответственно [62]. Взаимодействие между микробиомом и фармакотерапией может объяснить потерю эффективности лекарства или отсутствие ремиссии симптомов BD у некоторых пациентов.

    По мере того, как все больше внимания уделяется взаимоотношениям микробиома и хозяина, становится очевидным, что микробы кишечника важны для индивидуального ответа на фармакотерапию. Согласно базе данных PharmacoMicrobiomics (www.pharmacomicrobiomics.com), более 60 лекарств взаимодействуют с микробиомами. Взаимодействия микробиом-хозяин варьируются от прямого влияния на фармакокинетику лекарственного средства до непрямого изменения метаболизма лекарственного средства хозяина посредством модификации активности печеночных ферментов [10, 63].Поскольку кишечные микробы являются первой точкой контакта между организмом и пероральными лекарствами, в последнее время внимание было уделено рассмотрению микробиома в точной медицине [64]. Неоднородность в составе микробиома может влиять на реакцию людей на лекарства, что приводит к неоптимальному лечению. С другой стороны, мы узнаем, что большая часть лекарств для хозяина (неантимикробные препараты) проявляют прямую активность против комменсальных микробов, которые могут изменить нормальное функционирование кишечных микробов [65].В этом разделе мы рассматриваем как клинические, так и доклинические исследования, в которых изучается взаимосвязь между лекарствами, используемыми для лечения BD, и микробиомом кишечника.

    Литий

    Литий остается золотым стандартом фармакотерапии для лечения ББ [66]. Хотя мало что известно о взаимодействии между литием и микробиотой кишечника, исследование Cussotto et al. [67] исследовали эту взаимосвязь in vitro и на крысах. В этом исследовании литий не проявлял антимикробной активности против грамотрицательного организма Escherichia coli или грамположительного организма Lactobacillus rhamnosus in vitro.Однако авторы наблюдали увеличение видового богатства и разнообразия кишечной микробиоты у крыс, получавших пищу с добавлением лития, что соответствует примерно 150 мг / кг / день. Кроме того, после обработки литием увеличилось количество видов, принадлежащих к родам Clostridium , Peptoclostridium , Intestinibacter, и Christenellaceae .

    Антипсихотики

    ААР обычно назначают при ББ для лечения острой мании и БР депрессии, а также при поддерживающей терапии БР, причем кветиапин является одним из препаратов первой линии при биполярной депрессии и мании [61].Популяционные исследования в области психического здоровья отметили вклад AAP в бремя сердечных и метаболических заболеваний среди населения с психическим здоровьем [68]. Множество данных связали микробиоту кишечника с ожирением и метаболическими заболеваниями, и поэтому в настоящее время исследуется вклад микробиома в метаболический риск, связанный с ААП. Недавнее исследование in vitro показало, что антипсихотические препараты как класс лекарств проявляют прямую активность против комменсальных микробов, в частности Akkermansia muciniphila [65], организма, связанного с метаболическим здоровьем [69].У мышей GF [70] было определено, что присутствие кишечных бактерий является необходимым компонентом для опосредованного оланзапином увеличения веса. Лечение оланзапином показало значительное влияние на ряд физиологических, воспалительных и микробных параметров в модели на крысах [71]. Интересно, что многие из этих изменений, вызванных ААР, были более выражены у самок крыс по сравнению с самцами и ослаблялись при совместном введении антибиотиков [72].

    Многие наблюдения AAP в доклинических моделях были перенесены на людей.Использование антипсихотического препарата второго поколения рисперидон и вторичная прибавка в весе были связаны с изменением кишечной микробиоты у мальчиков-подростков [73]. Кроме того, в когорте людей с BD лечение AAP было связано со снижением относительной численности A. muciniphila и уменьшением биоразнообразия у пациентов, получавших AAP, по сравнению с пациентами с BD, не получавшими AAP [74, 75]. Из-за этого документированного взаимодействия AAP и микробиоты кишечника, рассмотрение воздействия прописанных лекарств на микробы будет важной переменной при рассмотрении взаимодействия лекарств хозяина в будущих исследованиях.

    Селективные ингибиторы обратного захвата серотонина

    Из-за их способности вызывать манию или быстрое переключение, антидепрессанты консервативно используются при лечении BD [1]. Даже в этом случае около 34% людей с диагнозом BD лечатся каким-либо антидепрессантом [76]. Давно известно, что антидепрессанты обладают целым рядом антимикробных эффектов [77]. Общие селективные ингибиторы обратного захвата серотонина (СИОЗС) сертралин, флуоксетин и пароксетин проявляют активность против грамположительных бактерий, таких как Staphylococcus и Enterococcus видов [78, 79] и грамотрицательных бактерий, таких как Pseudomonas aeruginosa и . Klebsiella pneumoniae [77, 80].Специфические СИОЗС, такие как флуоксетин, даже были связаны с повышенным риском развития инфекции Clostridium difficile [81]. Хотя механизм действия СИОЗС при депрессии не связан с каким-либо антимикробным действием этих препаратов, потенциальные изменения в микробных сообществах могут влиять на другие воспалительные или физиологические параметры, связанные с настроением.

    Противосудорожные препараты

    Противосудорожные препараты часто используются в качестве стабилизаторов настроения при ББ.В настоящее время одобренными стабилизаторами настроения для лечения BD являются вальпроевая кислота, ламотриджин и карбамазепин. Хотя они не изучались в контексте BD, было обнаружено, что некоторые противосудорожные препараты изменяют сообщества микробиома кишечника в доклинических моделях. В модели аутизма на крысах, индуцированной вальпроевой кислотой (VPA) [82], VPA, вводимая беременным самкам, значительно снижала разнообразие фекального микробиома у детенышей и изменяла структуру микробного состава, чтобы напоминать микробный состав, полученный от пациентов с расстройством аутистического спектра.В другом исследовании, посвященном лечению VPA в микробиоме слепой кишки крыс [67], увеличение количества видов, принадлежащих к родам Clostridium , Peptoclostridium , Intestinibacter, и Christenellaceae , увеличилось после обработки VPA, наряду с измерениями видов. разнообразие.

    Ламотриджин оказался эффективным ингибитором бактериального рибосомного биосинтеза на модельной бактерии E. coli [83]. Исследования in vitro также показали, что ламотриджин проявляет антимикробную активность против грамположительных организмов, таких как Bacillus subtilis и Staphylococcus aureus [84].Крайне важно понять, как лечение препаратами, проявляющими антимикробную активность in vitro, влияет на микробиом кишечника и реакцию на лечение в клинических когортах BD.

    Заключение

    В связи с быстрыми темпами открытий в микробиологической науке, вероятно, будут обнаружены многие дополнительные функции микробиома. Исследователи все больше осознают, что кишечник и мозг взаимодействуют между собой, и стремятся использовать действия здоровой кишечной микробиоты для лечения психологических состояний.Разработка методов прецизионной медицины, использующих микробные процессы кишечника, может принести пользу в ближайшем будущем. Однако микробиом представляет собой сложную и динамичную экосистему, и понимание его роли в заболевании хозяина и его потенциала для лечения BD в конечном итоге потребует дополнительных исследований.

    Заявление о раскрытии информации

    Авторы не заявляют о конфликте интересов.

    Вклад авторов

    Каждый автор внес значительный вклад в разработку, написание и редактирование этой обзорной статьи.

    Список литературы

    1. Гранде I, Берк М., Бирмахер Б., Виета Э. Биполярное расстройство. Ланцет. 2016 апр; 387 (10027): 1561–72.
    2. Алонсо Дж., Петухова М., Вилагут Дж., Чаттерджи С., Херинга С., Устюн Т. Б. и др.Дни отсутствия на работе из-за общих физических и психических состояний: результаты опросов ВОЗ в области психического здоровья в мире. Мол Психиатрия. 2011 декабрь; 16 (12): 1234–46.
    3. Whiteford HA, Degenhardt L, Rehm J, Baxter AJ, Ferrari AJ, Erskine HE и др. Глобальное бремя болезней, связанных с психическими расстройствами и расстройствами, связанными с употреблением психоактивных веществ: результаты исследования глобального бремени болезней 2010 г.Ланцет. 2013 ноябрь; 382 (9904): 1575–86.
    4. Сообщение RM. Влияние биполярной депрессии. J Clin Psychiatry. 2005; 66 Дополнение 5: 5–10.
    5. Перселл С.М., Рэй Н.Р., Стоун Дж.Л., Висшер П.М., О’Донован М.С., Салливан П.Ф. и др.; Международный консорциум по шизофрении. Общие полигенные вариации повышают риск шизофрении и биполярного расстройства. Природа. 2009 август; 460 (7256): 748–52.
    6. Лихтенштейн П., Ип Б.Х., Бьорк С., Павитан И., Кэннон Т.Д., Салливан П.Ф. и др. Общие генетические детерминанты шизофрении и биполярного расстройства в шведских семьях: популяционное исследование.Ланцет. Январь 2009 г., 373 (9659): 234–9.
    7. Ван Снелленберг Дж. Х, де Кандиа Т. Метааналитические доказательства семейной коагрегации шизофрении и биполярного расстройства. Arch Gen Psychiatry. Июль 2009 г.; 66 (7): 748–55.
    8. Кларк Дж., Стиллинг Р. М., Кеннеди П. Дж., Стэнтон С., Крайан Дж. Ф., Динан Т. Г..Мини-обзор: Микробиота кишечника: запущенный эндокринный орган. Мол Эндокринол. 2014 Авг; 28 (8): 1221–38.
    9. Маккарти Дж. Дж., Маклеод Х. Л., Гинзбург Г. С.. Геномная медицина: десятилетие успехов, проблем и возможностей. Sci Transl Med. 2013 июн; 5 (189): 189ср4.
    10. ЭльРакайби М., Дутиль Б.Э., Ризкаллах М.Р., Болейдж А., Коул Дж. Н., Азиз Р.К.Фармакомикробиомика: влияние вариаций микробиома человека на системную фармакологию и персонализированную терапию. ОМИКС. 2014 Июль; 18 (7): 402–14.
    11. Ловелл Р.М., Форд переменного тока. Глобальная распространенность и факторы риска синдрома раздраженного кишечника: метаанализ. Clin Gastroenterol Hepatol.2012 июл; 10 (7): 712–721.e4.
    12. Уайтхед В.Е., Палссон О., Джонс К.Р. Систематический обзор коморбидности синдрома раздраженного кишечника с другими заболеваниями: каковы причины и последствия? Гастроэнтерология. 2002 Апрель; 122 (4): 1140–56.
    13. Рой-Бирн П.П., Дэвидсон К.В., Кесслер Р.К., Асмундсон Г.Дж., Гудвин Р.Д., Кубзанский Л. и др.Тревожные расстройства и сопутствующие соматические заболевания. Gen Hosp Psychiatry. Май-июнь 2008 г .; 30 (3): 208–25.
    14. Цзэн П.Т., Цзэн Б.С., Чен Ю.В., Ву М.К., Ву СК, Линь П.Я. Метаанализ и систематический обзор коморбидности между синдромом раздраженного кишечника и биполярным расстройством. Медицина (Балтимор).2016 август; 95 (33): e4617.
    15. Piché M, Chen JI, Roy M., Poitras P, Bouin M, Rainville P. Более толстый задний островок связан с длительностью заболевания у женщин с синдромом раздраженного кишечника (IBS), тогда как более толстая орбитофронтальная кора предсказывает снижение подавления боли как у пациентов с IBS, так и у контрольной группы.J Pain. 2013 Октябрь; 14 (10): 1217–26.
    16. Эллингсон Б.М., Майер Э., Харрис Р.Дж., Эш-МакНалли К., Налибофф Б.Д., Лабус Д.С. и др. Визуализация с помощью тензора диффузии выявляет реорганизацию микроструктуры в головном мозге, связанную с синдромом хронического раздраженного кишечника. Боль. 2013 сентябрь; 154 (9): 1528–41.
    17. Лабус Дж. С., Холлистер Э. Б., Джейкобс Дж., Кирбах К., Озгуен Н., Гупта А. и др. Различия в микробном составе кишечника коррелируют с региональными объемами головного мозга при синдроме раздраженного кишечника. Микробиом. 2017 Май; 5 (1): 49.
    18. Хаузер М.С., Тэнси М.Г.Ось кишечник-мозг: является ли воспаление кишечника скрытой движущей силой патогенеза болезни Паркинсона? NPJ Parkinsons Dis. 2017 Янв; 3 (1): 3.
    19. Jobin C, Sartor RB. Система I каппа B / NF-каппа B: ключевой фактор воспаления слизистой оболочки и защиты. Am J Physiol Cell Physiol.2000 Mar; 278 (3): C451–62.
    20. Марсиаль Г.Е., Форд А.Л., Халлер М.Дж., Гезан С.А., Харрисон Н.А., Цай Д. и др. Lactobacillus johnsonii N6.2 модулирует иммунные ответы хозяина: двойное слепое рандомизированное исследование на здоровых взрослых. Фронт Иммунол. 2017 июн; 8: 655.
    21. Чжао Ю., Конг Л., Джабер В., Лукив В.Дж.Липополисахарид, полученный из микробиома, обогащенный перинуклеарной областью мозга при болезни Альцгеймера. Фронт Иммунол. 2017 Сентябрь; 8: 1064.
    22. Абрахам Ч., Меджитов Р. Взаимодействие между врожденной иммунной системой хозяина и микробами при воспалительном заболевании кишечника. Гастроэнтерология.2011 Май; 140 (6): 1729–37.
    23. Schirmer M, Smeekens SP, Vlamakis H, Jaeger M, Oosting M, Franzosa EA и др. Связь микробиома кишечника человека с производительностью воспалительных цитокинов. Клетка. 2016 ноябрь; 167 (4): 1125–36.
    24. Бай Ю.М., Су Т.П., Цай С.Дж., Вэнь-Фей Ч., Ли К.Т., Пей-Чи Т. и др.Сравнение уровней воспалительных цитокинов среди типов I / II и маниакальных / гипоманиакальных / эутимических / депрессивных состояний биполярного расстройства. J влияет на Disord. 2014 сентябрь; 166: 187–92.
    25. Северанс Е.Г., Алаедин А., Янг С., Холлинг М., Гресситт К.Л., Сталлингс С.Р. и др. Воспаление желудочно-кишечного тракта и связанная с ним активация иммунной системы при шизофрении.Schizophr Res. 2012 июн; 138 (1): 48–53.
    26. Северанс Э.Г., Гресситт К.Л., Сталлингс К.Р., Кацафанас Э., Швайнфурт Л.А., Сэвидж К.Л. и др. Воздействие Candida albicans, половая специфика и когнитивные нарушения при шизофрении и биполярном расстройстве. NPJ Schizophr. 2016 Май; 2 (1): 16018.
    27. Северанс Е.Г., Гресситт К.Л., Столлингс К.Р., Оригони А.Е., Хушалани С., Левеке Ф.М. и др. Несогласованные паттерны бактериальных маркеров транслокации и последствия для врожденного иммунного дисбаланса при шизофрении. Schizophr Res. 2013 август; 148 (1-3): 130–7.
    28. Ким Ю.К., Юнг Х.Г., Мьинт А.М., Ким Х., Пак Ш.Дисбаланс между провоспалительными и противовоспалительными цитокинами при биполярном расстройстве. J влияет на Disord. 2007 декабрь; 104 (1-3): 91–5.
    29. Дебнат М., Берк М. Иммунопатогенез шизофрении, опосредованный путем Th27: механизмы и последствия. Шизофр Бык. 2014 ноябрь; 40 (6): 1412–21.
    30. Северанс Э.Г., Гресситт К.Л., Янг С., Сталлингс К.Р., Оригони А.Е., Воган С. и др. Серореактивный маркер воспалительного заболевания кишечника и ассоциации с антителами к диетическим белкам при биполярном расстройстве. Биполярное расстройство. 2014 Май; 16 (3): 230–40.
    31. Деннисон У., МакКернан Д., Крайан Дж., Динан Т.Пациенты с шизофренией, перенесшие в анамнезе детские травмы, имеют провоспалительный фенотип. Psychol Med. 2012 сентябрь; 42 (9): 1865–71.
    32. Goldsmith DR, Rapaport MH, Miller BJ. Мета-анализ изменений сети цитокинов крови у психиатрических пациентов: сравнение шизофрении, биполярного расстройства и депрессии.Мол Психиатрия. 2016 декабрь; 21 (12): 1696–709.
    33. Мейер У., Фелдон Дж. Пренатальное воздействие инфекции: основной механизм аномального дофаминергического развития при шизофрении. Психофармакология (Берл). 2009 ноябрь; 206 (4): 587–602.
    34. Северанс Э.Г., Гресситт К.Л., Сталлингс К.Р., Кацафанас Э., Швайнфурт Л.А., Сэвидж К.Л. и др.Пробиотическая нормализация Candida albicans при шизофрении: рандомизированное, плацебо-контролируемое, продолжительное пилотное исследование. Иммунное поведение мозга. 2017 Май; 62: 41–5.
    35. Андерсон Г., Маес М. Биполярное расстройство: роль иммуно-воспалительных цитокинов, окислительного и нитрозативного стресса и катаболитов триптофана.Curr Psychiatry Rep.2015 Февраль; 17 (2): 8.
    36. Myint AM, Kim YK, Verkerk R, Park SH, Scharpé S, Steinbusch HW и др. Путь распада триптофана при биполярной мании. J влияет на Disord. 2007 сентябрь; 102 (1-3): 65–72.
    37. О’Махони С.М., Кларк Дж., Борре Й.Е., Динан Т.Г., Крайан Дж. Ф.Серотонин, метаболизм триптофана и ось мозг-кишечник-микробиом. Behav Brain Res. 2015, январь; 277: 32–48.
    38. Андерсон Дж., Джейкоб А., Белливье Ф., Жоффруа, Пенсильвания. Биполярное расстройство: роль кинурениновых и мелатонинергических путей. Curr Pharm Des. 2016; 22 (8): 987–1012.
    39. Ларкин П.Б., Сатьясайкумар К.В., Notarangelo FM, Фунакоши Х., Накамура Т., Шварц Р. и др.Триптофан-2,3-диоксигеназа и индоламин-2,3-диоксигеназа 1 вносят раздельный тканеспецифический вклад в метаболизм кинуренинового пути у мышей, а также в метаболизм, вызванный воспалением. Biochim Biophys Acta. 2016 ноябрь; 1860 г. (11 11 Pt A): 2345–54.
    40. Мок М.Х., Фрикер А.С., Вейл А., Кью Дж.Электрофизиологическая характеристика действия кинуреновой кислоты на лиганд-зависимые ионные каналы. Нейрофармакология. 2009 Сен; 57 (3): 242–9.
    41. Луго-Уитрон Р., Угальде Муньис П., Пинеда Б., Педраса-Чаверри Дж., Риос С., Перес-де-ла-Крус В. Хинолиновая кислота: эндогенный нейротоксин с несколькими мишенями.Oxid Med Cell Longev. 2013; 2013: 104024.
    42. Бирнер А., Платцер М., Бенгессер С.А., Далкнер Н., Феллендорф Ф.Т., Кейснер Р. и др. Повышенное распад кинуренина в сторону его нейротоксической ветви при биполярном расстройстве. PLoS One. 2017 Февраль; 12 (2): e0172699.
    43. Мец Р., Смит С., Дахадуэй Дж. Б., Чандлер П., Бабан Б., Мерло Л. М. и др.IDO2 имеет решающее значение для IDO1-опосредованной регуляции Т-клеток и выполняет неизбыточную функцию при воспалении. Int Immunol. 2014 Июль; 26 (7): 357–67.
    44. Penberthy WT; W. T. Penberthy. Фармакологическое нацеливание на IDO-опосредованную толерантность для лечения аутоиммунных заболеваний. Curr Drug Metab.2007 Апрель; 8 (3): 245–66.
    45. Vujkovic-Cvijin I, Swainson LA, Chu SN, Ortiz AM, Santee CA, Petriello A, et al. Изобилие кишечных лактобацилл ассоциируется с ингибированием IDO1 и динамикой Th27 у макак, инфицированных SIV. Cell Rep., Ноябрь 2015 г .; 13 (8): 1589–97.
    46. Штрассер Б., Гейгер Д., Шауэр М., Гостнер Дж. М., Гаттерер Н., Буртшер М. и др.Добавки с пробиотиками положительно влияют на метаболизм триптофана и кинуренина и снижают частоту инфекций верхних дыхательных путей у тренированных спортсменов: рандомизированное двойное слепое плацебо-контролируемое исследование. Питательные вещества. 2016 ноя; 8 (11): 8.
    47. Джонсон К.В., Фостер К.Р. Почему микробиом влияет на поведение? Nat Rev Microbiol.2018 Октябрь; 16 (10): 647–55.
    48. Стефано Г.Б., Пилонис Н., Птачек Р., Рабочий Дж., Внукова М., Крим Р.М. Регуляторная ось кишечника, микробиома и мозга: отношение к нейродегенеративным и психиатрическим расстройствам. Cell Mol Neurobiol. 2018 август; 38 (6): 1197–206.
    49. Судо Н., Чида Й., Айба Й., Сонода Дж., Ояма Н., Ю XN и др.Послеродовая микробная колонизация программирует гипоталамо-гипофизарно-надпочечниковую систему на стрессовую реакцию у мышей. J Physiol. Июль 2004; 558 (Pt 1): 263–75.
    50. Кларк Дж., Гренхэм С., Скалли П., Фицджеральд П., Молони Р. Д., Шанахан Ф. и др. Ось микробиом-кишечник-мозг в раннем возрасте регулирует серотонинергическую систему гиппокампа зависимым от пола образом.Мол Психиатрия. 2013 июн; 18 (6): 666–73.
    51. Diaz Heijtz R, Wang S, Anuar F, Qian Y, Björkholm B, Samuelsson A, et al. Нормальная микробиота кишечника регулирует развитие и поведение мозга. Proc Natl Acad Sci USA. 2011 февраль; 108 (7): 3047–52.
    52. Neufeld KM, Kang N, Bienenstock J, Foster JA (2011) Снижение тревожного поведения и центральных нейрохимических изменений у мышей без микробов.Нейрогастроэнтерол Мотил. 23 марта 2011 г.: 255–64.
    53. Эванс С.Дж., Бассис С.М., Хайн Р., Ассари С., Флауэрс С.А., Келли М.Б. и др. Состав микробиома кишечника связан с биполярным расстройством и тяжестью заболевания. J Psychiatr Res. 2017 Апрель; 87: 23–9.
    54. Сокол H, Pigneur B, Watterlot L, Lakhdari O, Bermúdez-Humarán LG, Gratadoux JJ, et al.Faecalibacterium prausnitzii - это противовоспалительная комменсальная бактерия, идентифицированная анализом кишечной микробиоты пациентов с болезнью Крона. Proc Natl Acad Sci USA. Октябрь 2008 г., 105 (43): 16731–6.
    55. Сокол Х., Сексик П., Фюре Дж. П., Фирмесс О, Нион-Лармурье I, Божери Л. и др. Низкое количество Faecalibacterium prausnitzii в микробиоте колита.Воспаление кишечника. 2009 август; 15 (8): 1183–9.
    56. Wong VW, Tse CH, Lam TT, Wong GL, Chim AM, Chu WC и др. Молекулярная характеристика фекальной микробиоты у пациентов с неалкогольным стеатогепатитом - продольное исследование. PLoS One. 2013 Апрель; 8 (4): e62885.
    57. Айзава Э., Цудзи Х., Асахара Т., Такахаши Т., Тераиси Т., Ёсида С. и др.Возможная ассоциация Bifidobacterium и Lactobacillus в микробиоте кишечника пациентов с большим депрессивным расстройством. J влияет на Disord. 2016 сентябрь; 202: 254–7.
    58. Jiang H, Ling Z, Zhang Y, Mao H, Ma Z, Yin Y и др. Измененный состав фекальной микробиоты у пациентов с большим депрессивным расстройством.Иммунное поведение мозга. 2015 август; 48: 186–94.
    59. Мейсон Б., Кох А., Энкеворт Э.В., Триведи М. 676. Распределение кишечной микробиоты позволяет прогнозировать симптомы расстройства настроения и опосредовать диетические взаимодействия. Биол Психиатрия. 2017; 81 (10): S273–4.
    60. Пейнольд А., Мёркл С., Кашофер К., Халвакс Б., Далкнер Н., Бенгессер С. и др.На шаг впереди: изучение микробиоты кишечника у стационарных пациентов с биполярным расстройством во время депрессивного эпизода. Биполярное расстройство. 2019 Февраль; 21 (1): 40–9.
    61. Ятам Л.Н., Кеннеди С.Х., Парих С.В., Шаффер А., Бонд Д.Д., Фрей Б.Н. и др. Руководство Канадской сети по лечению настроения и тревожности (CANMAT) и Международного общества биполярных расстройств (ISBD) 2018 по ведению пациентов с биполярным расстройством.Биполярное расстройство. Март 2018; 20 (2): 97–170.
    62. Tohen M, Zarate CA Jr, Hennen J, Khalsa HM, Strakowski SM, Gebre-Medhin P, et al. Маклин-Гарвардское исследование мании первого эпизода: прогноз выздоровления и первого рецидива. Am J Psychiatry. 2003 декабрь; 160 (12): 2099–107.
    63. Селвин Ф.П., Ченг С.Л., Клаассен С.Д., Цуй Дж.Й.Регулирование ферментов, метаболизирующих лекарственные средства в печени, у мышей без зародышей с помощью конвенционализации и пробиотиков. Утилизация наркотиков. 2016 Февраль; 44 (2): 262–74.
    64. Kuntz TM, Gilbert JA. Введение микробиома в прецизионную медицину. Trends Pharmacol Sci. 2017 Январь; 38 (1): 81–91.
    65. Майер Л., Прутяну М., Кун М., Целлер Г., Тельцеров А., Андерсон Е. Е. и др.Обширное влияние неантибиотических препаратов на кишечные бактерии человека. Природа. Март 2018 г .; 555 (7698): 623–8.
    66. Ляхтенвуо М., Тансканен А., Тайпале Х., Хоти Ф., Ваттулайнен П., Виета Е. и др. Реальная эффективность фармакологического лечения для предотвращения повторной госпитализации в финской общенациональной когорте пациентов с биполярным расстройством.JAMA Psychiatry. 2018 Апрель; 75 (4): 347–55.
    67. Cussotto S, Strain CR, Fouhy F, Strain RG, Peterson VL, Clarke G, et al. Дифференциальное влияние психотропных препаратов на состав микробиома и функцию желудочно-кишечного тракта. Психофармакология (Берл). 2019 Май; 236 (5): 1671–85.
    68. Макэвой Дж. П., Мейер Дж. М., Гофф Д. К., Насралла Х.А., Дэвис С. М., Салливан Л. и др.Распространенность метаболического синдрома у пациентов с шизофренией: исходные результаты клинических испытаний антипсихотической эффективности вмешательства (CATIE) по шизофрении и сравнение с национальными оценками из NHANES III. Schizophr Res. 2005 декабрь; 80 (1): 19–32.
    69. Schneeberger M, Everard A., Gómez-Valadés AG, Matamoros S, Ramírez S, Delzenne NM, et al.Akkermansia muciniphila обратно коррелирует с началом воспаления, изменением метаболизма жировой ткани и метаболическими нарушениями во время ожирения у мышей. Научный доклад, ноябрь 2015 г .; 5 (1): 16643.
    70. Morgan AP, Crowley JJ, Nonneman RJ, Quackenbush CR, Miller CN, Ryan AK и др. Антипсихотический оланзапин взаимодействует с микробиомом кишечника, вызывая увеличение веса у мышей.PLoS One. 2014 декабрь; 9 (12): e115225.
    71. Дэйви К.Дж., О’Махони С.М., Шеллекенс Х., О’Салливан О., Биненсток Дж., Коттер П.Д. и др. Гендерно-зависимые последствия хронического оланзапина у крыс: влияние на массу тела, воспалительные, метаболические и микробиотические параметры. Психофармакология (Берл).2012 Май; 221 (1): 155–69.
    72. Дэйви К.Дж., Коттер П.Д., О’Салливан О., Криспи Ф., Динан Т.Г., Крайан Дж.Ф. и др. Антипсихотические препараты и микробиом кишечника: индуцированная оланзапином метаболическая дисфункция ослабляется введением антибиотика крысам. Перевод Психиатрия. 2013 Октябрь; 3 (10): e309.
    73. Бахр С.М., Тайлер BC, Вулдридж Н., Батчер Б.Д., Бернс Т.Л., Тиш Л.М. и др. Использование антипсихотиков второго поколения, рисперидона, и вторичная прибавка в весе связаны с изменением микробиоты кишечника у детей. Перевод Психиатрия. 2015 Октябрь; 5 (10): e652.
    74. Флауэрс С.А., Эванс С.Дж., Уорд К.М., Макиннис М.Г., Эллингрод В.Л.Взаимодействие между атипичными антипсихотиками и кишечным микробиомом в когорте биполярных заболеваний. Фармакотерапия. 2017 Март; 37 (3): 261–7.
    75. Флауэрс С.А., Бакстер Н.Т., Уорд К.М., Крааль А.З., Макиннис М.Г., Шмидт TM и др. Влияние атипичного антипсихотического лечения и добавления резистентного крахмала на состав кишечного микробиома в когорте пациентов с биполярным расстройством или шизофренией.Фармакотерапия. 2019 Февраль; 39 (2): 161–70.
    76. Cascade EF, Reites J, Kalali AH, Ghaemi N. Антидепрессанты при биполярном расстройстве. Психиатрия (Эдгмонт). 2007 Март; 4 (3): 56–8.
    77. Маседо Д., Филхо А.Дж., Соарес де Соуза С.Н., Кеведо Дж., Баричелло Т., Джуниор Х.В. и др.Антидепрессанты, противомикробные препараты или и то, и другое? Дисбактериоз кишечной микробиоты при депрессии и возможные последствия антимикробного действия антидепрессантов для эффективности антидепрессантов. J влияет на Disord. 2017 Янв; 208: 22–32.
    78. Аяз М., Субхан Ф., Ахмед Дж., Хан А.У., Уллах Ф., Уллах И. и др.Сертралин усиливает активность противомикробных агентов против патогенов, имеющих клиническое значение. J Biol Res (Салон). 2015 Апрель; 22 (1): 4.
    79. Кобан А.Ю., Танриверди Кайчи Ю., Келеш Улудаг С., Дурупинар Б. [Исследование антибактериальной активности сертралина]. Микробиёл Бул.Октябрь 2009 г.; 43 (4): 651–6.
    80. Крушевска Х., Зареба Т., Тиски С. Исследование антимикробной активности выбранных неантибиотических лекарственных препаратов. Acta Pol Pharm. 2012 ноябрь-декабрь; 69 (6): 1368–71.
    81. Роджерс М.А., Грин М.Т., Янг В.Б., Сент С., Ланга К.М., Као Дж.Й. и др.Депрессия, антидепрессанты и риск инфекции Clostridium difficile. BMC Med. 2013 Май; 11 (1): 121.
    82. Лю Ф., Хортон-Спаркс К., Халл В., Ли Р.В., Мартинес-Серденьо В. Модель аутизма на крысах с вальпроевой кислотой демонстрирует бактериальный дисбактериоз кишечника, аналогичный таковому при аутизме человека.Молочный аутизм. 2018 декабрь; 9 (1): 61.
    83. Стоукс Дж. М., Дэвис Дж. Х., Мангат К. С., Уильямсон Дж. Р., Браун Э. Д.. Открытие небольшой молекулы, которая подавляет биогенез бактериальных рибосом. eLife. 2014 сентябрь; 3: e03574.
    84. Цянь Y, Lv PC, Fang RQ, Song ZC, Zhu HL.Синтез, антимикробная активность ламотриджина и его производных аммония. J Chem Sci. 2009. 121 (4): 463–70.

    Автор Контакты

    Стефани А. Флауэрс, фармацевт, доктор философии

    Иллинойский университет в Чикаго

    Фармацевтический колледж, 833 S.Wood St.

    Чикаго, Иллинойс 60612 (США)

    Электронная почта [email protected]


    Подробности статьи / публикации

    Предварительный просмотр первой страницы

    Поступила: 12 июля 2018 г.
    Дата принятия: 31 октября 2019 г.
    Опубликована онлайн: 13 ноября 2019 г.
    Дата выпуска: февраль 2020 г.

    Количество страниц для печати: 7
    Количество рисунков: 0
    Количество столов: 0

    ISSN: 0302-282X (печатный)
    eISSN: 1423-0224 (онлайн)

    Для дополнительной информации: https: // www.karger.com/NPS


    Авторские права / Дозировка препарата / Заявление об ограничении ответственности

    Авторские права: Все права защищены. Никакая часть данной публикации не может быть переведена на другие языки, воспроизведена или использована в любой форме и любыми средствами, электронными или механическими, включая фотокопирование, запись, микрокопирование или с помощью какой-либо системы хранения и поиска информации, без письменного разрешения издателя. .
    Дозировка лекарств: авторы и издатель приложили все усилия, чтобы гарантировать, что выбор и дозировка лекарств, указанные в этом тексте, соответствуют текущим рекомендациям и практике на момент публикации.Однако с учетом продолжающихся исследований, изменений в правительственных постановлениях и постоянного потока информации, касающейся лекарственной терапии и реакций на них, читателю рекомендуется проверять листок-вкладыш для каждого препарата на предмет любых изменений показаний и дозировки, а также дополнительных предупреждений. и меры предосторожности. Это особенно важно, когда рекомендованным агентом является новое и / или редко применяемое лекарство.
    Отказ от ответственности: утверждения, мнения и данные, содержащиеся в этой публикации, принадлежат исключительно отдельным авторам и соавторам, а не издателям и редакторам.Появление в публикации рекламы и / или ссылок на продукты не является гарантией, одобрением или одобрением рекламируемых продуктов или услуг или их эффективности, качества или безопасности.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *