Str haemolyticus: STREPTOCOCCUS HAEMOLYTICUS BACTEREMIA: A STUDY OF ONE HUNDRED AND SIXTY-EIGHT CASES | JAMA Surgery

Содержание

Нормы для бактериологии

Исследуемый материал Допустимые м/о Возбудители гнойно-воспалительных заболеваний Степень  роста
Отделяемое из носа

Staphylococcus epidermidis

Streptococcus viridans

Staphylococcus aureus

Staphylococcus haemolyticus

Streptococcus pyogenes

Streptococcus pneumoniae

Pseudomonas aeruginosa

Escherichia coli

p. Enterobacetr

р. Klebsiella

р. Citrobacter

p. Proteus

p. Candida

p. Corynebacterium

p. Actinomyces

p. Neisseria

I- 102КОЕ

II – 103КОЕ

III – 104 КОЕ

IV- 105 — 106

КОЕ

I,II–контаминация или носительство

III, IV – этиологическая роль возбудителя

 Отделяемоеиззева

Staphylococcus epidermidis

Streptococcus viridans

Staphylococcus aureus

Staphylococcus haemolyticus

Streptococcus pyogenes

Streptococcus pneumoniae

Pseudomonas aeruginosa

Escherichia coli

p. Enterobacter

р. Klebsiella

р. Citrobacter

p. Proteus

p. Candida

p. Corynebacterium

p. Neisseria

I- 102КОЕ

II – 103КОЕ

III – 104 КОЕ

IV- 105

— 106 КОЕ

I,II – контаминация или носительство

III, IV – этиологическая роль возбудителя

 Мокрота

Staphylococcus epidermidis

Streptococcus viridans

Staphylococcus aureus

Staphylococcus haemolyticus

Streptococcus pyogenes

Streptococcus pneumoniae

Escherichia coli

p. Enterobacter

Pseudomonas aeruginosa

р.Klebsiella

р. Citrobacter

p. Proteus

p. Candida

p. Corynebacterium

p. Actinomyces

p. Neisseria

I- 102КОЕ/мл

II – 103КОЕ/мл

III – 104 КОЕ/мл

IV- 105 — 106 КОЕ/мл

I –контаминация

II, III, IV – этиологическая роль возбудителя

 Отделяемое из глаз

Staphylococcus epidermidis

Corynebacterium xerosis

Corynebacterium pseudodiphteriticum

(единичные колонии)

Staphylococcus aureus

Staphylococcus epidermidis

Neisseria gonorrhoeae

Corynebacteriumn diphteritiae

Streptococcus pyogenes

Streptococcus viridans

Staphylococcus haemolyticus

Pseudomonas aeruginosa

Escherichia coli

p. Enterobacter

р. Klebsiella

р. Citrobacter

p. Proteus

p. Candida

p. Aspergillus

Возбудители только воспалений коньюктивы

Haemophilusaegypticus

Moraxella lacunata

Branhamella catarrhalis

I- 102КОЕ

II – 103КОЕ

III – 104 КОЕ

IV- 105 — 106 КОЕ

I –контаминация

II, III, IV – этиологическая роль возбудителя

Отделяемое из ушей

Наружное ухо

Staphylococcus epidermidis

Corynebacterium pseudodiphteriticum

 

Staphylococcus aureus

Staphylococcus epidermidis

Streptococcus pyogenes

Streptococcus viridans

Staphylococcus haemolyticus

Escherichia coli

Прихроническойинфекции:

p. Enterobacter

р. Pseudomonas

р. Klebsiella

р. Citrobacter

p. Proteus

p. Candida

p. Corynebacterium

p. Actinomyces

p. Aspergillus

I- 102КОЕ

II – 103КОЕ

III – 104 КОЕ

IV- 105 — 106 КОЕ

I –контаминация

II, III, IV – этиологическая роль возбудителя

Отделяемое из ушей среднее и внутреннее ухо

 М/о отсутствуют

Staphylococcus epidermidis

Corynebacterium pseudodiphteriticum

Staphylococcus aureus

Staphylococcus epidermidis

Streptococcus pyogenes

Streptococcus viridans

Staphylococcus haemolyticus

Escherichia coli

Прихроническойинфекции:

p. Enterobacter

р. Pseudomonas

р. Klebsiella

р. Citrobacter

p. Proteus

p. Candida

p. Corynebacterium

p. Actinomyces

p. Aspergillus

I- 102КОЕ

II – 103КОЕ

III – 104 КОЕ

IV- 105 — 106 КОЕ

 Моча

Стерильна

После прохождения  через мочеиспускательній канал  может обнаруживаться в норме :Staphylococcusepidermidis

p. Enterococcus

Escherichia coli

p. Enterobacter

p. Enterococcus

Pseudomonas aeruginosa

p. Proteus

р.Klebsiella

р. Citrobacter

Staphylococcus aureus

Staphylococcus epidermidis (> II ст.р.)

Streptococcus pyogenes

p. Mycoplasma

p. Ureaplasma

p. Candida

 

I- 103КОЕ/мл

II –3 . 10

5 . 10КОЕ/мл

III – 10

4– 5 . 104КОЕ/мл

IV- 105 — 106КОЕ/мл

 

I –контаминация

II – исследование следует повторить

III, IV – этиологическая роль возбудителя

 

при низком удельном весе, рН< 5 ,

лейкоцитозе, плохом оттоке мочи

– может наблюдаться  низкая степень бактеириурии, при имеющимся заболевании, необходимо определить вид микроорганизмов

Pseudomonas aeruginosa

p. Proteus

р.Klebsiella

р. Citrobacter

Escherichiacoli- чаще всего вызывают уроинфекции

Монокультура – острый воспалительный процесс

Ассоциации – при хронической (часто низкая степень бактериурии)

 Уретра

Staphylococcusepidermidis

p. Enterococcus

сем. Enterobacteriaceae

Corynebacterium

Escherichia coli

p. Enterobacter

p. Enterococcus

Pseudomonas aeruginosa

p. Proteus

р.Klebsiella

р. Citrobacter

Staphylococcus aureus

Staphylococcus epidermidis (> II ст.р.)

Streptococcuspyogenes

p. Candida

 

На специальных элективных средах:

p. Mycoplasma

p. Ureaplasma

Патогенные м/о (в посеве не определяются):

Neisseria gonorrhoeae

Micobacterium tuberculosis

Treponema pallida

I- 102КОЕ

II – 103КОЕ

III – 104 КОЕ

IV- 105 — 106 КОЕ

 

I –контаминация

II – исследование следует повторить

III, IV – этиологическая роль возбудителя

 

 Кровь
 Стерильна

Сепсис и бактериимию могут вызвать все м/о патогенные и условно-патогенные:

Staphylococcus aureus

Staphylococcus epidermidis

Neisseria gonorrhoeae

Corynebacteriumn diphteritiae

Streptococcus pyogenes

Streptococcus viridans

Staphylococcus haemolyticus

Pseudomonas aeruginosa

Escherichia coli

p. Enterobacter

р.Klebsiella

р. Citrobacter

p. Proteus

p. Candida

Степень не определяется
Желчь  Стерильна

Escherichia coli

p. Enterobacter

р. Klebsiella

р. Citrobacter

p. Enterococcus

Clostridium perfringens

(Staphylococcusaureus– свидетельствует о печеночном или диафрагминальном абсцессе)

I- 102КОЕ

II – 103КОЕ

III – 104 КОЕ

IV- 105 — 106 КОЕ

 

I –контаминация

II – исследование следует повторить

III, IV – этиологическая роль возбудителя

 

Сперма  Стерильна

Escherichia coli

p. Enterobacter

р. Klebsiella

р. Citrobacter

p. Enterococcus

Clostridium perfringens

Staphylococcusaureus

p. Enterobacter

р. Klebsiella

р. Citrobacter

p. Proteus

p. Candida

I- 102КОЕ

II – 103КОЕ

III – 104 КОЕ

IV- 105 — 106 КОЕ

 

I –контаминация

II – исследование следует повторить

III, IV – этиологическая роль возбудителя

 

Женские половые органы

Влагалище: в норме

у новорожденных – молочнокислые бактерии, которые вытесняются Staphylococcusepidermidis до полового созревания

В менопаузеStaphylococcusepidermidis

В репродуктивном возрасте – Lactobacillus, Peptostreptococcus, Corynebacterium

( у многих здоровых женщин можно обнаружить Escherichiacoli

р.Streptococcus

Staphylococcusaureus

p. Mycoplasma

p. Ureaplasma

в низкой степени роста (I ст.р.) !!!!

Цервикальный канал: стерилен

Полость и придатки матки: стерильныВ слизисто-гнойной пробке влагалища в большом количестве присутсвуют молочнокислые бактерии ( в посеве не определяются)!!!!

Патогенные м/о (в посеве не определяются):

Neisseria gonorrhoeae

Micobacterium tuberculosis

Treponema pallida

Listeria monocytogenes

Trichomonasvaginalis

Условно-патогенныем/о (определяютсявпосеве):

Escherichia coli

p. Enterobacter

р. Klebsiella

р. Citrobacter

p. Enterococcus

p. Candida

р. Streptococcus

p. Staphylococcus

На специальных элективных средах:

p. Mycoplasma

p. Ureaplasma

Методом ПЦР, РИФ, ИФА

р. Chlamidia

Показатели баквагиноза:

(в посевах не определяются)

Gardnerellavaginalis

p. Leptothrix

 

I- 102КОЕ

II – 103КОЕ

III – 104 КОЕ

IV- 105 — 106 КОЕ

I, II – контаминация

III, IV – этиологическая роль возбудителя

Str haemolyticus в зеве

Стрептококки [1] (лат. Streptococcus ) — род шаровидных или овоидных аспорогенных (не образуют споры) грамположительных хемоорганотрофных факультативно-анаэробных бактерий из семейства Streptococcaceae. Паразиты животных и человека. Обитают в дыхательных и пищеварительных путях, особенно в полости рта, носа, в толстом кишечнике.

Содержание

Структура [ править | править код ]

Отношение суммы гуанина и цитозина к общему весу оснований в молекуле ДНК равен 33—42%. Типичные клетки менее 1 мкм в диаметре, располагаются попарно или цепочками, неподвижны, кроме штаммов группы D. Образуют капсулу, легко превращаются в L-форму. Питательные потребности сложные. Обычно растут на средах с добавлением крови, сыворотки крови, асцитической жидкости, углеводов. Температурный оптимум — 37°, pH 7,2—7,4. На плотных средах формируют мелкие плоские сероватые колонии, на жидких средах дают крошковатый пристеночный и придонный рост, на кровяном агаре — зоны альфа- или бетагемолиза. Встречаются и негемолитические штаммы. Ферментируют углеводы с образованием кислоты, расщепляют аминокислоты (аргинин, серин). Представители групп В и D продуцируют пигменты красного и жёлтого цвета. На питательных средах и в организме хозяина синтезируют внеклеточные стрептодорназу, стрептолизины, стрептокиназу, лейкоцидин, бактериоцины. Генетический обмен происходит трансформацией и трансдукцией, но не конъюгацией. Стрептококки погибают при пастеризации и действии рабочих растворов многих дезинфектантов, антисептиков, они чувствительны к пенициллину, тетрациклинам, аминогликозидам и др. препаратам. Устойчивость вырабатывается медленно. Однако для лечения инвазивной стрептококковой инфекции применение пенициллина неэффективно и даже может повлечь серьезные осложнения [2] .

Принята классификация рода на основании специфического полисахарида С и поверхностных антигенов белковой природы (по Р. Лендсфилд). По С-полисахариду выделяют серогруппы A, В, С, D … О. Экстракты С-полисахарида получают автоклавированием культуры при 1,1 атм 15 мин., обработкой её горячей соляной кислотой, азотной кислотой, формамидом, пепсином, трипсином. Серологическая специфичность связана с аминосахарами. У S. группы А, дающих матовые или слизистые колонии, на поверхности находится М-белок, который детерминирует типовую специфичность. В группе А по этому признаку выделяют 55 варов, определяемых с помощью реакции агглютинации или реакции преципитации с типоспецифическими сыворотками. М-белок обладает антифагоцитарной активностью, выраженными протективными свойствами. Вспомогательную роль в дифференциации играют также поверхностные Т- и R-антигены. Т-антиген термолабилен, устойчив к пепсину, трипсину и кислотам.

Группы стрептококков [ править | править код ]

Классификация стрептококков основана на типе гемолиза эритроцитов, наблюдаемом при росте на кровяном агаре: альфа-гемолитические стрептококки — вызывают неполный гемолиз с зеленоватым оттенком гемолитической зоны (так называемые зеленящие стрептококки), бета-гемолитические стрептококки — вызывают полный гемолиз и негемолитические стрептококки («гамма-гемолиз»).

В свою очередь, бета-гемолитические стрептококки делятся на группы A, B и т. д. до U в соответствии со строением карбогидрата C клеточной стенки (классификация Lancefield).

Медицински значимые стрептококки:

  • 1) Streptococcus pyogenes (прежнее название Streptococcus haemolyticus) — бета-гемолитические стрептококки группы А. Диаметр клеток — 0,6—1 мкм, многие штаммы образуют капсулу. Капсульные штаммы растут в виде слизистых колоний, при стоянии переходящих в матовые; бескапсульные штаммы формируют блестящие глянцевидные колонии. Не растут при 10 и 45°, в бульоне с 6,5% хлорида натрия, при рН 9,6; в молоке с 0,1% метиленового синего. Ферментируют глюкозу, лактозу, сахарозу, салицин, трегалозу, не ферментируют инулин, сорбит, глицерин, гиппурат натрия. Большинство штаммов продуцируют стрептолизины, стрептокиназу, стрептодорназу, некоторые — эритрогенный токсин. Обитают у человека в глотке в норме и могут вызывать различные заболевания;
  • 2) Streptococcus pneumoniae — объединяют в группу пневмококковых инфекций. Возбудитель представляет собой кокки с вытянутым полюсом, располагаются попарно или короткими цепочками, неподвижны, спор не формируют, при обитании в организме образуют капсулу, хемоорганотрофы, факультативные анаэробы. Паразит дыхательных путей человека. Встречается в норме при различных заболеваниях. Вызывает острые пневмонии и бронхит у детей и взрослых;
  • 3—4) Streptococcus faecalis, Streptococcus faecies — стрептококк группы D, которые обычно объединяются в группу энтерококков, вызывают септические процессы;
  • 5—8) Streptococcus sanguis, Streptococcus salivarius, Streptococcus mitis, Streptococcus mutans — гемолитические и негемолитические стрептококки различных серогрупп, продуцирующие полисахариды и принимающие участие в образовании зубных бляшек, предполагается их этиологическая роль при кариесе;
  • 9) Streptococcus lactis (переведен в род Lactococcus) — молочнокислый стрептококк, молочнокислая бактерия.

Нетаксономическая группа комменсантных малопатогенных стрептококковых бактерий Streptococcus vir >Viridis — «зелёный».

Среди 18 видов и 8 родственных групп бактерий, причисленных к важнейшим патогенам человека, особую роль играют стрептококки. По медицинской значимости они занимают второе место после стафилококков. Из числа стрептококков, патогенных для человека, с середины 80-х гг. ХХ столетия во многих странах мира наблюдается рост заболеваемости, обусловленной β-гемолитическими стрептококками группы А (БГСА, S.pyogenes).

β-гемолитический стрептококк группы А (пиогенный стрептококк, БГСА S.pyogenes) – грамположительный, неспорообразующий, неподвижный микроорганизм. Растёт на кровяном агаре, обладает выраженной гемолитической активностью, каталазанегативный, чувствителен к бацитрацину. Встречается повсеместно, часто колонизирует кожные покровы и слизистые оболочки человека. Главными путями передачи являются воздушно-капельный, контактный и пищевой. Патогенез заболеваний связан с продукцией токсинов: гемолизин, стрептолизин, стрептокиназы А и В, дезоксирибонуклеаза, гиалуронидаза. Основные нозоформы представлены поверхностными (ангины, фарингит, импетиго, рожа), инвазивными (некротизирующий фасциит, миозит, менингит, эндокардит, пневмония, послеродовой сепсис) и токсин-опосредованными инфекциями (скарлатина, синдром токсического шока). Со стрептококковой инфекцией связано также возникновение неврологических расстройств у детей, проявляющихся обсессивно-компульсивными расстройствами (PANDAS-синдром).

Streptococcus pyogenes сохраняет 100% чувствительность к β-лактамным антибиотикам (пенициллинам, цефалоспоринам, карбапенемам). Они остаются единственным классом антибиотиков, к которым у S.pyogenes не развилась резистентность. Актуальной проблемой является устойчивость к макролидам, которая в некоторых регионах мира превышает 30%. Многоцентровое исследование резистентности клинических штаммов S.pyogenes, проведённое в 2000-2001 гг., позволило изучить распространенность устойчивости, прежде всего к макролидам, в различных регионах России. Частота резистентности к эритромицину варьировала и достигала 11,4%, при этом не было обнаружено штаммов, устойчивых к телитромицину, представителю нового класса антибиотиков – кетолидов. Почти в 90% случаев резистентность к макролидам была обусловлена метилированием рибосом, в остальных случаях она была связана с активным выведением (эффлюксом) антибиотика из клетки.

Стрептококковый тонзиллофарингит

Стрептококковый тонзиллофарингит (ангина) – острое общее инфекционное заболевание с преимущественным поражением лимфоидного аппарата и слизистой оболочки глотки, вызванное БГСА. Под рецидивирующим стрептококковым тонзиллофарингитом следует понимать множественные эпизоды заболевания в течение нескольких месяцев с положительными результатами бактериологических и/или экспресс-методов диагностики БГСА, отрицательными результатами исследований между эпизодами заболевания, повышением титров противострептококковых антител после каждого случая болезни.

Этиология: среди бактериальных возбудителей острого тонзиллофарингита наибольшее значение имеет БГСА.

Эпидемиология. В США ежегодно диагностируется 1-1,4 млн. случаев тонзиллофарингита БГСА-этиологии. Передача осуществляется воздушно-капельным, контактным и пищевым путями. Источниками инфекции являются больные, реже – бессимптомные носители. Вероятность заражения увеличивается при высокой обсемененности и тесном контакте. БГСА может вызывать крупные вспышки тонзиллофарингита в организованных коллективах. Чаще болеют дети в возрасте 5-15 лет. Наибольшая заболеваемость – в зимне-весенний период.

Клиническая картина: Инкубационный период составляет от нескольких часов до 2-4 дней. Характерно острое начало с повышения температуры тела до 37,5-39°С, выражена общая интоксикация. Боль в горле бывает так сильно выражена, что у больного нарушается глотание. При осмотре выявляется покраснение нёбных дужек, язычка и задней стенки глотки. Миндалины гиперемированы, отёчны, часто с гнойным налётом желтовато-белого цвета. Налёт рыхлый, пористый, легко удаляется шпателем с поверхности миндалин без кровоточащего дефекта. У всех больных отмечается регионарный лимфаденит.

Кровь: лейкоцитоз, сдвиг лейкоцитарной формулы влево, увеличение СОЭ, появление С-реактивного белка.

Длительность периода разгара (без лечения) составляет 5-7 дней. В дальнейшем, при отсутствии осложнений, основные клинические проявления болезни быстро исчезают.

Осложнения. Особую опасность представляют осложнения стрептококкового тонзиллофарингита, которые делятся на:

  • ранние (гнойные), развивающиеся на 4-6-й день от начала заболевания,- отит, синусит, мастоидит, паратонзиллярный абсцесс, шейный лимфаденит, менингит, бактериемия, эндокардит, пневмония;
  • поздние (негнойные): постстрептококковый гломерулонефрит, токсический шок, развивающиеся в стадии реконвалесценции (на 8-10-й день от начала болезни) и острая ревматическая лихорадка, развивающаяся через 2-3 нед после купирования симптомов заболевания – опасные, часто приводящие к инвалидизации заболевания.

Диагностика. Чрезвычайно важно своевременно установить этиологию тонзиллофарингита, поскольку, за редким исключением, только ангина стрептококковой этиологии требует антибактериальной терапии. Диагностика включает микробиологическое исследование мазка с поверхности миндалин и/или задней стенки глотки. За рубежом широкое распространение получили методы экспресс-диагностики, основанные на прямом выявлении стрептококкового антигена в мазках с поверхности миндалин и/или задней стенки глотки. Современные тестовые системы позволяют получать результат через 15-20 мин с высокой специфичностью (95-100%), но меньшей, чем при культуральном исследовании, чувствительностью (60-95%), в связи с чем отрицательный результат экспресс-теста всегда должен подтверждаться культуральным исследованием.

Целью антибиотикотерапии острых стрептококковых ангин является эрадикация БГСА, что ведёт не только к ликвидации симптомов инфекции, но и предупреждает ранние и поздние осложнения, а также предотвращает распространение инфекции.

Выбор антибиотиков. Препаратами I ряда для лечения острого стрептококкового тонзиллита являются пенициллин (феноксиметилпенициллин), аминопенициллины и оральные цефалоспорины. У пациентов с доказанной аллергией на β-лактамные антибиотики следует применять макролиды, а при непереносимости последних – линкозамиды.

Носительство БГСА. В среднем около 20% детей школьного возраста являются носителями БГСА в весенне-зимнее время. Учитывая низкий риск развития гнойных и негнойных осложнений, а также незначительную роль в распространении БГСА, хронические носители, как правило, не нуждаются в антибактериальной терапии.

Острая ревматическая лихорадка

Острая ревматическая лихорадка (ОРЛ) может возникать как после тонзиллофарингита с типичной клинической картиной, так и после перенесённой бессимптомной или малосимптомной инфекции. ОРЛ возникает только после инфекций глотки, и никогда после инфекций кожи и мягких тканей. Предположительное объяснение этого феномена состоит в различии иммунного ответа на кожную и глоточную инфекцию и в отсутствии ревматогенного потенциала у штаммов, вызывающих кожные инфекции. Риск развития ОРЛ после нелеченного тонзиллофарингита составляет 1%. К ревматогенным М-серотипам стрептококка относятся 1, 3, 5, 6, 18, 19, 24.

В настоящее время в развитых странах острая ревматическая лихорадка встречается с частотой 0,5 на 100000 детей школьного возраста. В развивающихся странах заболеваемость составляет от 100 до 200 на 100000 детей школьного возраста, ежегодно регистрируется от 10 до 15 млн. новых случаев ОРЛ, которая является основной причиной смерти от сердечно-сосудистой патологии.

Следует отметить, что немотивированная задержка восстановления трудоспособности, слабость, нестойкий субфебрилитет, артралгии, сердцебиение и нерезко повышенная СОЭ, сохраняющиеся после перенесенной ангины, в сочетании с ростом титров противострептококковых антител (антистрептолизин О, антистрептокиназа, антистрептогиалуронидаза, анти-ДНКаза В) могут свидетельствовать о дебюте острой ревматической лихорадки.

В соответствии с рекомендациями ВОЗ для диагностики острой ревматической лихорадки в качестве международных применяются критерии Джонса, пересмотренные Американской кардиологической ассоциацией в 1992 г. (см. табл.). Наличие двух больших критериев или одного большого и двух малых в сочетании с данными, документированно подтверждающими предшествующую БГСА-инфекцию, свидетельствует о высокой вероятности ОРЛ. Однако ни один диагностический критерий не является строго специфичным для ОРЛ, поэтому трудности в раннем распознавании заболевания и дифференциальной диагностике с другими нозологиями сохраняются по-прежнему.

Критерии Джонса, применяемые для диагностики первой атаки ревматической лихорадки (по состоянию на 1992 г.)

Стрептококки – это патогенные микроорганизмы, которые находятся в организме каждого человека. Есть несколько разновидностей бактерии. Самым опасным считается бета гемолитический стрептококк группы А и его токсины.

Ребенок часто болеет?

Ваш ребенок постоянно болеет?
Неделю в садике (школе), две недели дома на больничном?

В этом виновато много факторов. От плохой экологии, до ослабления иммунитета ПРОТИВОВИРУСНЫМИ ПРЕПАРАТАМИ!
Да-да, вы не ослышались! Пичкая своего ребенка мощными синтетическими препаратами вы, порой, наносите больше вреда маленькому организму.

Чтобы в корне изменить ситуацию, необходимо не губить иммунитет, а ПОМОГАТЬ ЕМУ.

Некоторые его виды абсолютно безопасны, и постоянно находятся на слизистых оболочках горла, носоглотки, дыхательных путей, кишечника, мочеполовых органов. Условно-патогенные микроорганизмы активируются в благоприятных для себя условиях. Этому может способствовать сниженный иммунитет, раны на коже, другие инфекционные заболевания.

Гемолитический стрептококк группы А может вызывать заболевание любого органа, в котором он находится.

Пугаться наличия стрептококка у себя в организме не стоит, ведь соблюдение личной гигиены, крепкий иммунитет и своевременное лечение ран исключает негативное влияние микроорганизмов. Но, если пришлось столкнуться с бета гемолитическим стрептококком, следует знать в чем была причина, и какое лечение предпринять.

Этиология стрептококковой инфекции

Есть такие основные группы стрептококков:

  • альфа гемолитический стрептококк;
  • бета гемолитический;
  • негемолитический стрептококк.

Основной причиной практически всех стрептококковых инфекций являются бета-гемолитический микроорганизм.

Он может разрушать кровяные тельца, выделяя токсины в процессе своей жизнедеятельности. Этот яд способен негативно воздействовать практически на все органы. Об интоксикации будет свидетельствовать высокая температура, слабость, тошнота, боль.

Патогенные факторы стрептококка:

  • способности нарушать целостность клеток крови;
  • выделение токсинов – стрептолизина;
  • разрушение иммунных клеток;
  • способность омертвлять клетки;
  • наличие ферментов, которые способствуют распространению бактерий в организме.

В области проникновения стрептококка развивается воспаление. Человека беспокоит сильная боль, отечность, покраснение. Постепенно токсины разносятся по кровеносной системе, и появляются общие симптомы стрептококковой инфекции. Любое заболевание, вызванное этим микроорганизмом, будет сопровождаться слабостью, общим недомоганием, тошнотой. В тяжелых случаях может развиваться обезвоживание и нарушения сознания.

Почему иммунитет моего ребенка ослаблен?

Многим знакомы эти ситуации:

  • Как только начинается сезон простуд – ваш ребенок обязательно заболевает, а потом и вся семья.
  • Вроде бы покупаете дорогие препараты, но они действуют только пока их пьешь, а через неделю-две малыш заболевает по-новой.
  • Вы переживаете, что иммунитет вашего ребенка слабый, очень часто болезни берут верх над здоровьем.
  • Боитесь каждого чиха или покашливания.

Необходимо укреплять ИММУНИТЕТ ВАШЕГО РЕБЕНКА!

Эта бактерия является чужеродной, потому иммунитет начинает вырабатывать антитела, реагируя на стрептококк, как на сильнейший аллерген. В этом есть существенный минус, ведь такое реагирование может привести к аутоиммунным заболеваниям. Это грозит такими осложнениями, как ревматоидный артрит, эндокардит, миокардит, перикардит.

Передается стрептококк контактным, пищевым, половым и воздушно-капельным путем. Есть факторы, которые могут значительно повлиять на вероятность развития стрептококковой инфекции.

К таким факторам относятся:

  • эндокринные заболевания;
  • ВИЧ, аутоиммунная патология;
  • ОРВИ, анаэробные и вирусные инфекции;
  • хронические патологии желудочно-кишечного тракта;
  • язва двенадцатиперстной кишки, гастрит желудка.

Для стрептококка неважна погода и время года, он распространен повсеместно. Можно наблюдать возрастание инфекции в зимнее время, что обусловлено различными респираторными заболеваниями, которые способствуют распространению стрептококка.

Инфекция у взрослых

Наиболее частые заболевания у взрослых, вызванные стрептококком, это тонзиллит, фарингит, ангина. К более серьезным патологиям можно отнести отит, воспаление легких, дерматит. Рассмотрим подробнее самые распространенные стрептококковые инфекции.

Фарингит

Это заболевание начинается остро, проявляется специфическими выраженными симптомами.

Основные признаки фарингита:

  • сильная боль во время глотания;
  • повышение температуры тела до 38 градусов;
  • расстройство пищеварения;
  • увеличение и болезненность лимфатических узлов;
  • изменение голоса;
  • сухой кашель;
  • общее недомогание.

Это заболевание быстро диагностируется по таким признакам, как отечность слизистой глотки, покраснение и серый налет. Это заболевание всегда сопровождается насморком с обильным выделением слизи. Больному в обязательном порядке назначаются местные антисептики для полоскания горла. Лечение антибиотиками для внутреннего приема в данном случае не применяется. В группу риска попадают молодые и пожилые люди с ослабленным иммунитетом, которые контактируют с бактерионосителем.

Фарингит может иметь такие неприятные последствия:

  • гнойное воспаление уха;
  • синусит и лимфаденит;
  • артрит, остеомиелит, абсцесс.

Ангина

Острый стрептококковый тонзиллит или ангина – это самое распространенное заболевание, вызванное данной группой бактерий.

Заболеванию способствуют такие факторы:

  • слабая иммунная защита;
  • переохлаждение;
  • перенесение бактериальной инфекции;
  • проживание или работа в неблагоприятных условиях;
  • контакт с бактерионосителем, больным или его предметом.

Ангина проявляется сильной болью в горле, фебрильной температурой тела, увеличением небных миндалин, лимфаденитом, головной болью. На слизистой оболочке появляется желтоватый налет, иногда можно наблюдать гнойные пробки.

Стрептококковая ангина может иметь такие осложнения, как гнойные отит, флюс, и не гнойные заболевания – это токсический шок, эндокардит, перикардит, ревматизм.

Для лечения ангины также применяется местные антибактериальные препараты, в случае осложнений терапия дополняется антибиотиками для внутреннего приема.

Стрептококк у детей

Если взрослый организм в большинстве случаев отлично справляется со стрептококком, то для детей он представляет большую опасность, особенно для новорожденных, которые заразились от матери. Такие дети рождаются с уже высокой температурой, сыпью на некоторых участках кожи, синяками. У них затрудненное дыхание, воспаленная слизистая гортани, также могут быть кровянистые выделения изо рта. К сожалению, несмотря на высокие достижения перинатальной медицины, спасти зараженных детей удается не в каждом случае.

Стрептококковая инфекция у ребенка может быть двух видов:

  1. Первичная – когда развивается фарингит, ларингит, скарлатина или ангина.
  2. Вторичная – когда возникает сепсис, васкулит, эндокардит, ревматоидный артрит, гломерулонефрит.

Как и у взрослых, лидером по распространенности будет ангина и скарлатина. Отличием этих инфекций является то, что скарлатина дополняется кожной сыпью и лечить ее сложнее.

Скарлатина

Это высокозаразное заболевание, вызванное бета гемолитическим стрептококком группы А. Чаще всего дети заражаются от сверстников в школе, детском саду. Важно то, что заболевание развивается по причине не самого стрептококка, а его токсинов. При тяжелом течении скарлатины тело ребенка полностью покрывается сыпью и наблюдается затуманенное сознание.

Скарлатина имеет три формы:

  1. Легкая – заболевание продолжается да недели, симптомы выраженной интоксикации отсутствуют.
  2. Средняя – инфекция длится около 7 дней, организм отравляется токсинами, наблюдается большая площадь высыпания.
  3. Тяжелая – заболевание может затянуться на несколько недель и перейти в септическую или токсическую форму, что проявляется как некротическая ангина, в таком случае может потребоваться гемолиз.

Скарлатина имеет короткий инкубационный период, ее симптомы возникают резко, и продолжается около 10 дней.

Основные проявления скарлатины:

  • повышение температуры тела до 39 градусов, ломота в теле, озноб, сильнейшая боль при глотании;
  • сонливость, общая слабость, отсутствие аппетита;
  • тахикардия и учащенный пульс;
  • болезненность и сильное увеличение подчелюстных лимфоузлов, вплоть до того, что ребенок не может открыть рот;
  • выраженное покраснение кожных покровов и появление папул, сначала они появляются на животе и в области груди, затем на ногах;
  • налет на языке, под которым красные воспаленные сосочки, сам язык без налета напоминает малину;
  • в тяжелых случаях может быть бред, судороги, галлюцинации, потеря сознания.

Скарлатина у ребенка опасна такими осложнениями, как васкулит, хронический лимфаденит, миокардит, гломерулонефрит. Легкая и средняя форма заболевания лечится антибактериальными препаратами, в ходе терапии назначаются иммуностимуляторы для укрепления защитного механизма.

Заболевания при беременности

Во время беременности условно-патогенной стрептококк во влагалище может активироваться и привести к воспалительным процессам. Полностью избавиться от него невозможно, в организме здоровой женщины он присутствует постоянно. Так как в период беременности снижается иммунитет, возможно развитие стрептококковой инфекции.

Стрептококк у беременной может стать причиной таких патологий:

  • воспаление мочеполовых органов;
  • менингит, сепсис;
  • неврологические заболевания у ребенка.

При обнаружении гемолитического стрептококка у беременной назначаются антибактериальные суппозитории. Еще лучшим вариантом будет профилактика, то есть соблюдение личной гигиены, исключения стрессовых ситуаций, переохлаждения, хорошее питание и здоровый сон.

Осложнения бактериальной инфекции

К чему может привести стрептококковая инфекция:

  • аутоиммунные заболевания, тяжелая аллергия;
  • токсический шок, сепсис;
  • гломерулонефрит, ревматическая лихорадка;
  • сердечно-сосудистые патологии.

Острая и хроническая ангина может привести к ревматической лихорадке, но такое случается только в 3% случаев. Исключить такое последствие можно своевременной антибактериальной терапией. Больший процент, а именно 10% имеет гломерулонефрит, который может развиваться через несколько недель после перенесения стрептококковой инфекции без адекватного лечения. Это осложнение свойственно детям, взрослые переносят его намного легче без неприятных последствий.

Самым опасным осложнением считаются аутоиммунные заболевания соединительной ткани, суставов и сердца. Эндокардит может перейти в серьезный порок сердца, что заканчивается сердечной недостаточностью. Ревматоидный артрит – это хроническое неизлечимое заболевание, которое постепенно убивает человека. Но не стоит тревожиться, если диагностировали стрептококковую инфекцию, ведь ее выявление позволяет начать адекватное лечение. Неблагоприятный прогноз может ожидать тех, кто игнорирует явные признаки инфекции и отказывается от терапии.

Диагностика

Диагностика стрептококковой инфекции проводится с использованием общего анализа крови, мочи, носовой слизи, соскобов с кожи.

Сегодня применяются такие диагностические мероприятия:

  • мазок с поверхности тела;
  • анализ крови для засева в сахарном бульоне;
  • серологическая диагностика;
  • ИФА, экспресс-диагностика, реакция латекс агглютинации.

Важно дифференцировать стрептококк от стафилококка, ведь они вызывают одинаковые заболевания, но разной тяжести течения.

Стрептококковая инфекция — это… Что такое Стрептококковая инфекция?

группа инфекционных болезней, вызываемых β-гемолитическим стрептококком.

В эту группу входят Скарлатина, Рожа, возбудителем которых является только стрептококк; ангина, вызываемая стрептококком в 80—90% случаев; ревматизм, другие диффузные заболевания соединительной ткани, острый гломерулонефрит (см. Нефриты), при которых стрептококковая инфекция служит пусковым механизмом патологического процесса; местная и генерализованная гнойная инфекция — абсцесс, карбункул, лимфаденит, отит, синусит, пиодермии, пневмония, раневая инфекция, флегмона, фурункул, менингит остеомиелит, септикопиемия (см. Сепсис), эндокардит; а также токсикоинфекции пищевые, при которых стрептококк бывает одним из возможных возбудителей. Возбудитель инфекции — гемолитический стрептококк (Streptococcus haemolyticus). Имеет шаровидную или овальную форму, размер 0,6—1 мкм; образует цепочки, в питательных средах, содержащих кровь, вызывает гемолиз. В окружающей среде устойчив, в высохшем гное и крови сохраняется до нескольких месяцев. При благоприятных условиях может размножаться в некоторых пищевых продуктах, например мороженое, крем. Кипячение и дезинфицирующие средства быстро убивают микробы. По антигенной структуре различают 20 серогрупп гемолитического стрептококка, в патологии человека почти исключительная роль принадлежит серогруппе А, которая имеет более 80 сероваров. Вирулентность возбудителя обусловлена токсическими субстанциями, обладающими свойствами экзотоксина (из них наиболее важным является эритрогенный токсин Дика — токсин общего действия, токсин сыпи), а также эндотоксином и рядом ферментов — гаалуронидазой, стрептокиназой, РНК-азой, ДНК-азой, липопротеазой, фибринолизином и др. Источником возбудителя инфекции являются человек — больной или носитель. Носительство распространено среди всех возрастных групп. Особое значение имеет носительство гемолитического стрептококка среди персонала родильных домов и родильниц. Они частый источник инфекции новорожденных. Ведущий путь передачи возбудителя инфекции — воздушно-капельный. Возможен контактно-бытовой путь передачи через загрязненные предметы ухода за больными и руки. При наличии открытых очагов стрептококковой инфекции (например, панариций, ангина) у персонала, связанного с приготовлением и раздачей пищи, возможно ее загрязнение, что может явиться причиной вспышки пищевой токсикоинфекции. Заражение чаще всего происходит через слизистые оболочки носоглотки, возможно также проникновение через поврежденную кожу, а у новорожденных — и через пупочную ранку. Антимикробный иммунитет типоспецифичен и непрочен, поэтому возможны повторные заболевания различными клиническими формами С. и., кроме скарлатины, при которой обычно вырабатывается пожизненный антитоксический иммунитет. Патогенез С. и. определяется сочетанием инфекционного, токсического и аллергического синдромов. С инфекционным синдромом связывают развитие на месте внедрения возбудителя инфекции очага серозного, гнойного или некротического воспаления. Благодаря наличию факторов проницаемости возбудитель может преодолевать местные барьеры и проникать в регионарные лимфатические узлы, вызывая развитие лимфаденита. Наконец, возможно проникновение возбудителя инфекции в кровяное русло и возникновение гематогенных очагов С. и.: остеомиелита, эндокардита, менингита или септикопиемии с множественными пиемическими очагами в различных органах и тканях. Токсический синдром характеризуется лихорадкой, тахикардией, рвотой, головной болью, бредом. Он наиболее выражен при скарлатине, первичной роже, сепсисе. Аллергический синдром сопровождается развитием гиперчувствительности замедленного типа и проявляется при скарлатине поражением почек, сердца и суставов, при роже — гиперергической воспалительной реакцией, склонностью к рецидивированию. Специфическая сенсибилизация к стрептококку играет роль пускового механизма в патогенезе острого диффузного гломерулонефрита, ревматизма и других диффузных заболеваний соединительной ткани. Важное значение в развитии хронических (тонзиллит) и рецидивирующих (рожа) форм С. и. имеет способность возбудителя длительно сохраняться в организме, в частности в виде L-форм.

Клинические проявления при пищевой токсикоинфекции, вызванной стрептококком, обусловлены действием энтеротоксина, накопившегося в пищевом продукте в результате размножения в нем возбудителя.

Диагноз стрептококковой инфекции ставят на основании клинической картины, данных эпидемиологического анамнеза (контакт с больными и носителями). Он может быть подтвержден выделением культуры β-гемолитического стрептококка из слизи носоглотки, крови, цереброспинальной жидкости и гноя, полученного из различных очагов поражения. Для серологического подтверждения диагноза определяют титр антистрептолизина О, антигиалуронидазы, антифибринолизина и др.

Для лечения С. и. в качестве этиотропного средства обычно используют пенициллин в дозе от 30—50 тыс. до 200—500 тыс. ед. и выше на 1 кг массы тела в сутки. При легких локализованных формах можно ограничиться назначением препаратов пенициллина перорально, при более тяжелых формах его вводят внутримышечно или внутривенно, эндолимфатически. В случае непереносимости пенициллина применяют эритромицин, линкомицин, оксациллин. Методы патогенетической терапии определяются клинической формой болезни.

Прогноз зависит от клинической формы стрептококковой инфекции.

Профилактика направлена на основные звенья эпидемического процесса: на источник возбудителя инфекции, пути передачи возбудителя и восприимчивый организм. Мероприятия в отношении источника инфекции включают раннее выявление больных некоторыми формами С. и. (ангиной, скарлатиной, местной гнойной инфекцией) и их незамедлительную изоляцию в изоляторе детского учреждения, инфекционном стационаре либо в домашних условиях. Все лица, общавшиеся с больным, подлежат врачебному осмотру с целью выявления выраженных и стертых форм болезни. В детских дошкольных учреждениях, а также в первых 2 классах школы устанавливают медицинское наблюдение детьми, общавшимися с больным, сроком на 7 дней с момента изоляции больного. В помещении, где находится больной С. и., проводят текущую дезинфекцию (Дезинфекция). Лица, перенесшие С. и., допускаются к работе в детском дошкольном учреждении, родильном доме, больнице, а также к работе на пищеблоке после полного клинического выздоровления, но не ранее 22-го дня от начала болезни. Детям, перенесшим скарлатину или стрептококковую ангину, разрешается посещать дошкольное учреждение и первые 2 класса школы только через 12 дней после окончания срока изоляции. Из мероприятий, направленных на преодоление путей передачи С. и., решающее значение имеет строгое соблюдение санитарно-гигиенического режима в детских коллективах, особенно в лечебных учреждениях (борьба со скученностью, разобщение групп, использование разовых комплектов белья, стерилизация медицинского инструментария, использование эффективных средств обеззараживания рук (например 0,5—1% растворов хлорамина), предметов обихода, воздуха и др.). Для повышения неспецифической резистентности к С. и. необходимы общеукрепляющие процедуры (закаливание, полноценное питание, прием витаминов группы В, аскорбиновой кислоты и др.), санация очагов инфекции в ротоглотке, гигиенический уход за кожей (профилактика потертостей, ссадин, опрелостей и др.).

Динамика микрофлоры кишечника при экспериментальном токсокарозе собак Текст научной статьи по специальности «Ветеринарные науки»

№ 4 (12) 2008

ЗООТЕХНИЯ И ВЕТЕРИНАРИЯ

УДК 619.161.2

ДИНАМИКА МИКРОФЛОРЫ КИШЕЧНИКА ПРИ ЭКСПЕРИМЕНТАЛЬНОМ ТОКСОКАРОЗЕ СОБАК

DYNAMICS OF MICROFLORA OF INTESTINES IS INVESTIGATED AT EXPERIMENTAL TOXOCAROSE DOGS

C.A. Акимова

ФГОУ ВПО Волгоградская государственная сельскохозяйственная академия

S.A. Akimova

Volgograd state agricultural academy

Изучена динамика микрофлоры кишечника при экспериментальном токсокарозе собак. Для этого 6 агельминтным щенкам 3-месячного возраста однократно скормили 1800 экз. инвазионных яиц Toxocara canis. Из содержимого прямой кишки больных токсокарозом собак чаще изолировали патогенных стафилококков Staph, aureus, Staph, haemolyticus и Staph, epidermidis, Staph, albus, Staph, citreus, гемолитических стрептококков Str. haemolyticus, Str. inulinaceus, Str. viridans, Str. cinereus, E.coli ceporpyim 02, 06, 025, 063.

Dynamics of microflora of intestines is investigated at experimental toxocarose dogs for what 6 6 ahelminthis to puppies of 3-month’s age have unitary fed 1800 copies инвазионных eggs Toxocara canis. From contents of a direct gut sick toxocaroses dogs isolated pathogenic staphylococcus Staph, aureus, Staph, haemolyticus and Staph, epidermidis, Staph, albus, Staph, citreus, haemolytic streptococci Str. haemolyticus, Str. inulinaceus, Str. viridans, Str. cinereus, E. coli serovar 02,06,025,063 is more often.

Возбудитель токсокароза — Toxocara canis — в организме облигатного дефинитивного хозяина (собака и другие плотоядные) и факультативного хозяина (человек, особенно дети) совершает гепато-пульмональный путь миграции, что приводит к поражению паренхимы печени, легких, интоксикации и сенсибилизации организма хозяина [1, 2, 3]. В связи с этим мы решили изучить гематологические, некоторые биохимические показатели сыворотки крови, активность кишечных ферментов и микрофлору кишечника при экспериментальном токсокарозе. Для чего 6 агельминтным щенкам 3-месячного возраста однократно скормили 1800 экз. инвазионных яиц Toxocara canis (по 300 экз. на голову).

В содержимом прямой кишки 7 контрольных, агельминтных собак 3-10-месячного возраста общее число стафилококков колебалось в пределах 3,28±0,412 — 3,96±0,316 log/r КОЕ, стрептококков — 3,56±0,318 -3,66±0,294 log/r КОЕ, кишечных палочек — 7,56±0,196 — 8,31±0,356 log/r, протея — 0,11±0,014 — 0,12±0,016 log/r, клостридий — 0,10±0,016 -0,11±0,017 log/r, лактобацилл — 8,12±0,198 — 8,96±0,318 log/r,

бифидобактерий — 8,87±0,127 — 8,96±0,297 log/r, бактероидов — 4,06±0,218 — 4,68±0,512 log/r, грибов — 1,18±0,067 — 1,22±0,038 log/r (табл. 1).

***** тшслсиж*****

№ 4 (12) 2008

НИЖНЕВОЛЖСКОГО АГРОУНИВЕРСИТЕТСКОГО КОМПЛЕКСА

Из кишечника агельминтных собак 3-10-месячного возраста мы часто изолировали стафилококков Staphylococcus aureus (из них 40 % культур были патогенны для белых мышей), Staph, saprophyticus (не патогенны для мышей), Staph, haemolyticus (40 %), Staph, epidermidis (15 %), непатогенных стрептококков Streptococcus

faecalis, Str. cinereus, Str. faecium, Str. iodophilus, слабопатогенных Str. viridans, патогенных для белых мышей Str. haemolyticus, Str. inulinacaeus, Escherichia coli ceporpynn 06, 025, 0115, 063. У агельминтных щенков 3-месячного возраста 40 % стафилококков, 40 % стрептококков и 30 % E.coli были патогенны для белых мышей, у молодняка 5-6-месячного возраста — соответственно 30-30-30%, у животных 7-8-месячного возраста — 30-20-40 %, у собак 9-10-месячного возраста — 20-20-40 % вызывали гибель мышей (табл.1).

Таблица 1

Динамика микрофлоры содержимого прямой кишки у агельминтных, клинически здоровых собак 3-10-месячного возраста (log/r)

п=6

Группы микробов Возраст собак (месяцев)

1 2 3

1. Стафилококки 3,28±0,412 3,96±0,316 3,88±0,219

2. Стрептококки 3,56±0,318 3,66±0,294 3,58±0Д27

3. Кишечные палочки 8,31±0,356 7,67±0,218 7,56±0Д96

4. Протей 0,12±0,015 ОД 1±0,014 0Д2±0,016

5. Клостридии ОД 1±0,017 0,10±0,016 0Д1±0,013

6. Лактобациллы 8,96±0,318 8Д2±0Д98 8,68±0Д49

7. Бифидобактерии 8,87±0,127 8,96±0,297 8,88±0,318

8. Бактероиды 4,27±0,318 4,68±0,512 4,06±0,218

9. Общее число грибов 1,18±0,067 1,22±0,038 1Д 9±0,021

Таблица 2

Сводные данные патогенности бактерий, изолированных из содержимого прямой кишки агельминтных, клинически здоровых собак 3-10-месячного возраста

Возраст собак Изолировано и изучено культур Заражено белых мышей (голов) Пало белых мышей (голов) Число культур, вызвавших гибель мышей % культур, вызвавших гибель мышей

1 2 3 4 5 6

Стафилококки

1. Щенки 3-4-мес. возраста 10 20 8 4 40,0

2. Щенки 5-6-мес. возраста 10 20 6 3 30,0

3. Щенки 7-8-мес. возраста 10 20 6 3 30,0

4. Собаки 9-10-мес. возраста 10 20 4 2 20,0

Итого 40 80 24 12 30,0

Стрептококки

1 Щенки 3-4-мес. возраста 10 20 8 4 40,0

2Щенки 5-6-мес. возраста 10 20 4 3 30,0

3 Щенки 7-8-мес. возраста 10 20 6 2 20,0

4. Собаки 9-10-мес. возраста 10 20 6 2 20,0

Итого 40 80 24 11 27,5

№ 4 (12) 2008

У плотоядных, получивших однократно по 300 экз. инвазионных яиц Toxocara canis, на 90 сутки болезни в содержимом прямой кишки общее число стафилококков было в 1,6 раза, стрептококков — в 1,9 раза, кишечных палочек — в 1,4 раза, протея — в 19,6 раза, клостридий — в 21,8 раза, грибов — в 2,3 раза больше, но количество лактобацилл было в 1,4 раза, бифидобактерий — в 1,4 раза, бактероидов — в 1,8 раза меньше показателей контрольных, агельминтных плотоядных (табл. 1,2).

Из содержимого прямой кишки больных токсокарозом собак чаще изолировали патогенных стафилококков Staph. aureus, Staph. haemolyticus и Staph. epidermidis, Staph. albus, Staph. citreus, гемолитических стрептококков Str. haemolyticus, Str.inulinaceus, Str.viridans, Str.cinereus, E.coli серогрупп 02, 06, 025, 063.

Следует отметить, что у подопытных щенков 3-месячного возраста патогенные стафилококки составили 40 %, гемолитические стрептококки — 40 %, патогенные для белых мышей E.coli — 30 %, у молодняка 6-месячного возраста (спустя 90 дней инвазии) -соответственно 80-80-70 % На 90 сутки дегельминтизации фенкуром состав микрофлоры кишечника у переболевших токсокарозом собак значительно улучшился. Тем не менее в кишечнике переболевших плотоядных факультативная (стафилококки, стрептококки, кишечные палочки, клостридии, грибы) микрофлора все еще была несколько выше (Р<0,05), а индигенная микрофлора (лактобациллы, бифидобактерии, бактероиды) несколько ниже (Р<0,05) показателей контрольных, интактных собак.

Библиографический список

1. Веденеев, С.А. Основные паразитозы плотоядных Нижнего Поволжья в условиях Нижнего Поволжья (эпизоотологическое районирование, системы мер борьбы) / С.А. Веденеев // автореф… докт. вет. наук. — Нижний Новгород, 2005.

2. Паразитология и инвазионные болезни животных / М.Ш.Акбаев, А.А.Водянов, Н.Е.Косминков и др.; под ред. М.Ш. Акбаева. — М.: Колос, 2000.

3. Dvoroznakova E., Boroskova Z., Dubinsky P., Velebny S., Tomasovicova O., Machnicka В.// Proliferative response of T and В lymphocytes of two mouse strains treated for experimental larval toxocarosis // Helminthologia, 1997. — 34. — № 3.

Сборники научных конференций

1 Материалы научной студенческой конференции «Неделя студенческой науки» В сборнике отражены вопросы изучения рассудочной деятельности животных, визуальной диагностики, физиологических особенностей, а также репродуктивной функции в области мелкого животноводства. Особое внимание уделено вопросам онкологии и биохимии. Приведена ветеринарно-санитарная оценка приправ и морепродуктов. 26 ноября 2018 Ссылка на сборник
2 Материалы научной студенческой конференции «Неделя студенческой науки» В сборнике отражены базовые вопросы морфофункциональной анатомии органов и систем животных. Проанализировано генетическое и поведенческое разнообразие животных по породным и видовым критериям. Подробно представлены методы диагностики болезней животных. Приведены схемы лечения инвазионных болезней. Особое внимание уделено исследованию и увеличению продуктивных качеств, сравнительному анализу интерьерных и экстерьерных показателей в отечественной селекции. Рассмотрены вопросы биотехнологии пищевой промышленности, иммунологии и квантовой механики, а также применения культур клеток. 03 марта 2020 Ссылка на сборник
3 Материалы научной студенческой конференции «Неделя студенческой науки» В сборнике отражены вопросы фармакологической эффективности препаратов для лечения болезней репродуктивной системы животных, изучены новейшие морфофункциональные особенности соматической, висцеральной и интегрирующей систем органов у различных видов животных. Отражены проблемы генетической инженерии и клонирования среди продуктивных животных. Проведена товарная оценка молочной и рыбной продукции, а также косметических средств, реализуемых в сетевых зоомагазинах Российской Федерации. Представлены способы применения иммуномодуляции мезенхимальными стволовыми клетками. Разработаны методы экспресс-диагностики в ветеринарной практике. 07 апреля 2021 Ссылка на сборник

Британский союзник. 1945, 22 апреля (№ 16).

Пыступая в Палате Общин 28 сентября 1944 года, Премьер-Министр г-н Черчилль сообщил об откры­ тии профилактических средств против тропических заболеваний, против вшейи комаров. «Чудодейственным порошком ДДТ, сказал он,— который при проверке показал поразительные свой­ ства, будут отныне пользоваться в британских вой­ сках в Бирме, в американских и австралийских частях на Тихом океане и вообще на всех театрах войны. Он будет полезен всем союзникам ». ДДТ в настоящее время производится в Британии в больших количествах, но используется пока лишь в военных целях. Авторы настоящей статьи Г. А’КЭМП- БЕЛЛ главный химик компании «Геигт~ (Ман­ честер) и Т. Ф. УЭСТ, главный химик компании. «Стаффорд Аллен и сыновья> (Лондон), активно участвуют в научно-исследовательскои работе, свя­ занной с производством ДДТ. ДДТ— НОВОЕ СРЕДСТВО ОТ ПАРАЗИТОВ В 1874 году студент, гото­ вивший научную работу, получил в лаборатории веще­ ство парадихлортрихлорэтан. Это вещество казалось столь бес­ полезным с точки з.рения использо- вания его в химических реакциях, что к нему не возвращались до тех пор, пока в научно-иоследователь- ской лаборатории швейцарской фир­ мы «Дж. Р. Гейги» в Базеле не было открыто сильное действие это­ го вещества на насекомых. Неза­ долго до начала второй мировой войны вещества этого класса были запатентованы в качестве средств для истребления насекомых. В 1942 году компания «Геиги» сообщила Британской миссии в Берне о том, что она придает боль­ шое значение этим открытиям. Бри­ танская компания «Гейги», нахо­ дящаяся в Манчестере, сообщила о полезных свойствах парадихлортри- хлорэтана основным опытным стан­ циям, работавшим в области сель- ского хозяйства, а также Министер­ ству военного снабжения, которое обратилось к компании с запросом об информации. В это время различные органы Британского правительства работали над тем, чтобы найти частичную за­ мену «пиретрума» и «дерриса». Не­ смотря на напряженный труд жи­ телей британской колонии Кения, стремившихся расширить посевы далматской ромашки, «пиретрум» был дефицитным средством, которое ис­ пользовалось почти исключительно для борьбы с насекомыми, распро­ страняющими сыпной тиф (вши) и малярию (комары). Было опробовано множество син­ тетических органических веществ, но результаты в целом оказались неудовлетворительными. Первые же испытания нового ве­ щества оказались настолько много­ обещающими, что немедленно были соэданы научно-иселедоваггельские группы, в состав которых вошли специалисты— химики, выделенные гоеударствениыми исследователвеки- ми организациями, промышленными лабораториями и университетами, а также энтомологи. □ З адача этих групп заключалась в том, чтобы в короткий срок разработать во всей полноте про­ блему массового применения нового средства для истребления насеко­ мых.короткое время наладили и массовый выпуск порошка. Огромную ценность представлял опыт швейцарской компании, кото­ рая уже успела преодолеть много трудностей, связанных с производ­ ством ДДТ. По соображениям безопасности полная информация о производстве ДДТ не подлежит опубликованию. Можно сказать только, что выпуск продукции этого рода принял огром­ ный размах. Параллельная работа велась столь же быстрыми темпами и в Соеди­ ненных Штатах. Разумеется, все лица и организации, участвовавшие в этой работе, свободно обменива лиеь информацией друг с другом. Вещество ДДТ, которое можно получить конденсированием хлор­ бензола с хлоралом в присутствии серной кислоты, представляет собой твердое вещество белого цвета, об­ ладающее очень слабым фруктовым запахом. Оно нерастворимо в воде, но распадается в органических ра­ створителях. Так, например, ДДТ может быть использован в керосиновом растворе, однако ввиду его недостаточной си­ лы представляется вероятным, что в будущем для борьбы с мухами и комарами будет применяться смесь ДДТ и «пиретрума» в керосине. «Пиретрум» обеспечивает быстрое уничтожение насекомых, а ДДТ — стопроцентное их истребление. □ В сельском хозяйстве и коневод­ стве ДДТ обычно употребляется в форме порошка, состоящего из размолотого ДДТ и должной про­ порции инертного вещества типа талька или же в форме концентри­ рованной эмульсии, которую можно разбавлять водой перед употребле­ нием. По другому способу порошок ДДТ вышеописанного состава, сме­ шанный с подходящим увлажняю­ щим агентом, взбалтывается в воде перед разбрызгиванием. К тому времени, когда в 1942 го­ ду ДДТ вводился в употребление в Соединенном Королевстве, он ш иро­ ко уж е применялся в Швейцарии и давал эффективные результаты в борьбе против ж ук ов «Колорадо», земляных блошек, бабочки-капуст­ ницы, порейной моли, луковой мухи, малинового жука и ряда других вредителей. В других странах при­ дется однако проверить эти резуль­ таты. Предварительные испытания, про­ веденные в Британии, завершились мяогообещающвми р езультатами. Так, например, в одной серии опы­ тов средство, содержащее ДДТ, резко сократило распространение Яблонового долгоносика. Борьба с этим насекомым наиболее затрудни­ тельна. По мнению специалистов, впервые в Британии достигнуты та­ кие хорошие результаты без ущерба для самих яблонь. В сельском хозяйстве ДДТ несо­ мненно вскоре найдет себе широкое применение. В будущем одной из важнейших задач сельского хозяй­ ства явится защита посевов от на- секомых-вредителей. В Соединенных Штатах и .в Бри­ тании проведено опытное изучение воздействия ДДТ на различных вредителей. Если отличные резуль­ таты этих опытов подтвердятся, то, несомненно, ДДТ явится в будущем одним из наиболее распространен­ ных в сельском хозяйстве средств для истребления насекомых. Пчелы при посыпке порошком ДДТ и смачивании эмульсиями по­ гибают, однако соприкосновение с подсохшими пленками, которые остаются после опрыскивания, пови- димому, не причиняет вреда пчелам. В связи с этим рекомендуется не посыпать раскрывшиеся цветы и производить опрыскивание вечером или ранним утром, до появления пчел. Необходимо на данном этапе ра­ боты предостеречь против повсе­ местного употребления ДДТ, прежде чем пополнятся наши сведения о том, насколько токсично это веще­ ство для млекопитающих. Применение порошков, содержа­ щих ДДТ, не отражается на коже; однако растворы ДДТ в маслах и в органических растворителях вса­ сываются кожей и вызывают сим­ птомы отравления. □ А рмейские специалисты рекомен­ дуют работникам, которые по­ стоянно соприкасаются с сильными масляными или органическими раст­ ворами ДДТ, носить специальную одежду. Имелись также сообщения о том, что ДДТ, принятый внутрь, вызывает отравление, в особенности при наличии жиров. В настоящее время вопрос о токсичности ДДТ интенеивню разрабатывается в Бри­ тания и в Соединенных Штатах. По общему мнению, ДДТ, приме­ няемый в таких концентрациях, ка­ кие нужны для истребления насе­ комых, не является токсичным по отношению к животным. Что касается борьбы с вредите­ лями растений, то, судя по опубли­ кованным результатам и по послед­ ним наблюдениям авторов настоя­ щей статьи, ДДТ в эффективных концентрациях не обладает фитото­ ксическим действием и может быть использован без риска причинить ущерб листве. Изучение воздействия ДДТ на насекомых показало, что этот пре­ парат действует и контактным об­ разом и через пищеварительную си­ стему. либо от общего поражения нервной си­ стемы. Швейцарские исследователя уже на первых этапах своей работы, начатой ими в 1937 году, отметили особую эффективность препаратов ДДТ в борьбе с блохами, вшами и клопами, а также и тот факт, что поверхности, обработанные этими веществами, исключительно долго и эффективно сохраняют свое свойство уничтожать насекомых. Причины, заставившие Объединен­ ные Нации в первую очередь при­ менить в большом масштабе ДД1 в военных целях, очевидны. В мас­ совом масштабе это средство было впервые применено в Неаполе в конце 1943 года для борьбы с гро­ зившей тогда эпидемией тифа. В мировой печати уже сообща­ лось о том, как 1300 ООО человек гражданского населения подверглись обработке порошком ДДТ (10 про­ центов ДДТ с пирофилитом). оа три недели удалось ликвидировать вспышку тифа. В истории медицины это уникальное явление, — никогда ранее не удавалось ликвидировать очаг тифа так быстро в зимнее время. Как показали американские ис­ следователи, одежда, пропитанная раствором ДДТ, выдерживает от до 8 стирок и от 6 до 8 недель носки, не теряя заметно свои за­ щитные свойства. В настоящее время на европейском театре воен­ ных действий личному составу вы­ даются гимнастерки, пропитанные раствором ДДТ. Удивительная устойчивость дей­ ствия ДДТ дает основание ставить вопрос о возможности включить примеси ДДТ в краски и в другие поверхностные пленки. Изучение этого вопроса дало весьма обнаде­ живающие результаты. □ В одной из лабораторий листы фанеры, окрашенные различными красками, в состав которых входил ДДТ, соприкасались с сетками, вну­ три которых помещались личинки Iмух. ЛЕЧЕНИЕ ОСТРОГО АППЕНДИЦИТА ПЕНИЦИЛЛИНОМ . ______ ЛЛТЯ Д октор Мария Кализова, работаю­ щая в детском госпитале, опуб­ ликовала в «Бритиш Медииал Джорнал» случай, показывающий поразительное действие пенициллина при лечении острого аппендицита. Этот случай, сопровождавшийся перфо­ рацией, гангреной и общим перитонитом, при другом методе лечения давал весьма печальный прогноз. И с т о р и я б о л е з н и . Мальчик в воз­ расте 4 лет 11 месяцев был доставлен в госпиталь 16 августа 1944 года в 2 часа 20 минут дня.- 1,2 кубического сантиметра и ста­ филококкового антитоксина 1 кубиче­ ский сантиметр, сульфаперидин 3,0 куби­ ческих сантиметра, то есть по 1 грамму каждые 4 часа, а также транспульмин— 1 кубический сантиметр. Положение ре­ бенка было очень тяжелым: температура 37,2 Цельсия, пульс 164, рвота темнова­ той жидкостью, бред. В течение ночи был впрыснут 1 кубический сантиметр камфар­ ного масла. В течение следующего дня положение ребенка не улучшилось: темпе­ ратура 36,5 Цельсия, пульс 158, брел, рвота продолжалась. Седативные средства не имели успеха. * ☆ ☆ В 6 часов 15 минут дня приступили к лечению пенициллином, и сульфапери­ дин был оставлен. Пенициллин был при­ менен в количестве 15 000 единиц, введен­ ных в брюшную полость посредством кате­ тера через дренажную трубку, причем вво­ дился в разведении 2500 единиц на 1 куби­ ческий сантиметр. Катетер еьш зажат клеммой, чтобы удер­ живать пенициллин в брюшной полости. Это впрыскивание повторялось кажгые три часа, i;o перед каждым новым впры­ скиванием жидкость из брюшной полости удалялась через катетер при помощи шприца. Пробы для патологического исследования были взяты от каждой порции удаленной жидкости. Эта процедура проводилась, как сказано, каждые три часа в течение ближайших 48 часов. Всего таким образом было сделано 14 впрыскиваний и употреб­ лено 200 000 единиц пенициллина. Ребенок в течение первых 24 часов по­ правлялся плохо, хотя он был спокойнее: температура 36,9 Цельсия, пульс— 136. Данные исследования удаленной жидкости показывали, что рост стрептококков оста­ новился в то время, как грам-бациллы еще находились в жидкости. После первых 24 часов ребенок начал поразительно поправляться. Беспокойное состояние, рвота и бред исчезли, темпе­ ратура была 36,9 Цельсия, пульс 132. Он начал принимать жидкости и имел хорошие кишечные отправления. Н а третий и четвертый день после опе­ рации пенициллин употреблялся дважды в день — утром и вечером -— в форме орош е­ ния брюшной полости, причем применялось 20 000 единиц в том же самом разведении, как и прежде; жидкость не задерживалась в брюшной полости и катетер не зажимался клеммой; была введена более тонкая дре­ нажная трубка. Патологические исследо­ вания показывали отсутствие роста стреп­ тококков в жит кости. В конце четвертого дня дренажная труб ка была удаленя, выделений не было; рана была чиста и имела хороший вид: ребенок чувствовал себя вполне хорош о, принимал пищу и спал нормально. Дальнейшее тече­ ние шло без всяких осложнений. Вышеприведенный случай показывает что брюшная полость может быть стерили зована повторным выкачиванием эксудата и заменой его раст; ором пенициллина, причем явления интоксикации при этом исчезают. Пенициллин удалил инфекцию, сопротивляемость организма увеличилась и общее состояние больного улучшилось. Это находилось в поразительном контрасте с предшествовавшими ясно выраженными явлениями интоксикации: субнормальная температура, быстрый пульс, рвота и бред. Все эти явления давали основания ставить весьма печальный прогноз. 200 000 единиц пенициллина были введены в данном случае в брюш­ ную полость в течение первых 48 часов, а в сле­ дующие 48 были введены 80 000 единиц для оро­ шения. из личинок, погибают через два часа после соприкосновения с обра­ ботанной поверхностью. Таким об­ разом ДДТ, которым пропитаны образцы материала, действует еще быстрее, чем ДДТ, входящий в со­ став защитных красок. Вряд ли необходимо особо отме­ чать огромное санитарное значение красок и материалов, сохраняющих защитные свойства в течение дли­ тельного периода времени. Хотя все описанные выше экспе­ рименты производились с мухами, имеются все основания предпола­ гать, что эти краски будут с тем же эффектом действовать и против клопов и других насекомых. Охватив столь широкий круг во­ просов, связанных с ДДТ, мы тем не менее не дали, да и не могли дать полного представления о по­ тенциальных возможностях этого открытия, сравнимого по важности с открытием пенициллина. ВЫХОДИТой»н раз В МЕСЯЦ 10

Made with FlippingBook

RkJQdWJsaXNoZXIy MTUzNzYz

Молекулярное определение генов цитотоксинов и энтеротоксинов

Токсины (Базель). 2015 сен; 7 (9): 3688–3699.

Юкако Фудзинага, научный редактор

Умер 8 сентября 2013 г.

* Автор, которому следует направлять корреспонденцию; Электронная почта: [email protected]; Тел .: + 55-14-3880-0428.

Поступило 6 мая 2015 г .; Принята к печати 6. Июль 2015 г.

Авторские права © 2015 г. Авторы; лицензиат MDPI, Базель, Швейцария. Эта статья цитировалась в других статьях в PMC.

Abstract

Хотя условно-патогенные микроорганизмы, коагулазонегативные стафилококки (CoNS), включая Staphylococcus epidermidis и Staphylococcus haemolyticus , долгое время считались авирулентными организмами. Роль токсинов в развитии инфекций, вызванных CoNS, до сих пор остается спорной. Целью данного исследования было охарактеризовать присутствие генов энтеротоксина и цитотоксина в изолятах S. epidermidis и S. haemolyticus , полученных из культур крови.Гены цитотоксинов были обнаружены с помощью ПЦР с использованием новых видоспецифичных праймеров. Среди 85 изолятов S. epidermidis и 84 S. haemolyticus 95,3% и 79,8%, соответственно, несли по крайней мере один ген энтеротоксина. Наиболее частыми генами энтеротоксина были seg (53,3%), seg (64,5%) и sei (67,5%). Ген seg был положительно связан с S. epidermidis ( p = 0,02), и этот вид был более токсигенным, чем S.Гемолитик . Ген hla / yidD был обнаружен в 92,9% изолятов S. epidermidis и ген hla в 91,7% изолятов S. haemolyticus ; hlb был обнаружен в 92,9% изолятов S. epidermidis и hld в 95,3%. Нозокомиальные изоляты Staphylococcus epidermidis и S. haemolyticus проявляли высокий токсигенный потенциал, в основном содержащие гены неклассических энтеротоксинов seg и sei .Ранее не сообщаемое обнаружение hla / yidD и hlb в S. epidermidis и S. haemolyticus с использованием видоспецифичных праймеров показало, что эти гены гемолизина различаются между видами CoNS и что они очень часто встречаются в изолятах культур крови. .

Ключевые слова: Staphylococcus epidermidis , Staphylococcus haemolyticus , энтеротоксины, цитотоксины

1. Справочная информация

Коагулазонегативные стафилококки (CoNcusS), включая клинически значимые виды haemolylocus и Staphylocochylocos 18 хорошо зарекомендовали себя как важные внутрибольничные возбудители инвазивных инфекций, связанных с медицинскими изделиями [1].Энтеротоксины являются хорошо изученными факторами вирулентности в Staphylococcus aureus , а их гены и синтез описаны в CoNS [2,3], включая CoNS, вызывающие инфекции [4,5]. Энтеротоксины — это суперантигены, которые стимулируют иммунную систему вызывать усиленный ответ, вызывая высвобождение цитокинов, клональную экспансию и клональную делецию части этих лимфоцитов посредством апоптоза [6]. Высвобождение провоспалительных цитокинов отвечает за быстрое начало высокой температуры, утечку капилляров и полиорганную дисфункцию.Внезапность и величина выброса цитокинов определяют тяжесть и исход болезни пациента [7].

Цитотоксины или гемолизины являются важными молекулами, участвующими в патогенезе S. aureus , но их роль в инфекциях CoNS все еще неизвестна. α-гемолизин оказывает гемолитическое, дермонекротическое и нейротоксическое действие [8], а β-токсин обладает фосфорилазной активностью и высоким сродством к клеточной мембране различных типов клеток, вызывая нестабильность мембран [9]. δ-гемолизин вызывает лизис множества клеток млекопитающих, включая эритроциты и внутриклеточные структуры, такие как органеллы с оболочкой [8].Ген δ-токсина, hld , расположен в локусе RNAIII, транскрипте оперона P3, который действует как эффектор системы восприятия кворума agr [10]. Однако его конкретная роль в развитии стафилококковых инфекций четко не установлена. В S. aureus δ-гемолизин представляет собой полипептид, образованный 26 аминокислотами, тогда как в S. epidermidis он состоит из 25 аминокислот с высокой гомологией с δ-токсином S. aureus [11] .

Несколько сообщений описывают присутствие генов, кодирующих цитотоксин, и их экспрессию в CoNS [12]. Хотя есть сообщения о наличии генов hla и hld , кодирующих α- и δ-гемолизин, соответственно, у S. epidermidis [13], исследования с участием других видов CoNS, которые проявляют слабую или умеренную гемолитическую активность в Эритроциты человека и крупного рогатого скота, а также кровь овцы или кролика, особенно S. haemolyticus , немногочисленны [14]. Насколько нам известно, не существует метода, который мог бы эффективно обнаружить генетические детерминанты α- и β-токсинов в S.epidermidis и S. haemolyticus .

Ген α-гемолизина был описан только в одном штамме S. epidermidis ( S. epidermidis {«type»: «entrez-нуклеотид», «attrs»: {«text»: «W23144″, » term_id «:» 1299977 «}} W23144 (GenBank: {» type «:» entrez-нуклеотид «,» attrs «: {» text «:» ACJC01000124.1 «,» term_id «:» 224999876 «}} ACJC01000124.1 ) и затем обозначен как « yidD » Этот ген кодирует белок с 82 аминокислотами, мембранный белок, обладающий активностью α-гемолизина [15,16].Шестьдесят восемь из этих аминокислот идентичны гемолитическому домену белка, обнаруженного в штамме S. epidermidis (NCBI: {«type»: «entrez-protein», «attrs»: {«text»: «AIR83523) .1 «,» term_id «:» 6

236 «}} AIR83523.1), называемый« предполагаемый коэффициент эффективности вставки мембранного белка »[17].

Таким образом, целью настоящего исследования было охарактеризовать присутствие генов энтеротоксинов и генов, кодирующих цитотоксин hla , hlb и hld с использованием видоспецифичных праймеров в S.epidermidis и S. haemolyticus изолятов культуры крови.

2. Результаты

2.1. Обнаружение генов энтеротоксинов

Всего было изучено 169 изолятов, в том числе 85 S. epidermidis и 84 S. haemolyticus .

иллюстрирует обнаружение генов энтеротоксина в изолятах S. haemolyticus и S. epidermidis . Доля положительных изолятов была выше у последних видов, за исключением seb и seh (34% и 15% соответственно), которые чаще встречались у S.Гемолитик . Гены sed, и see. встречались редко (2% и 3% соответственно), тогда как гены sei , seg и sea были наиболее частыми генами у обоих видов. Обнаружение гена seg было достоверно связано с S. epidermidis ( p = 0,02).

Обнаружение генов энтеротоксинов sea sei в изолятах S. epidermidis и S. haemolyticus . * Значительно положительная ассоциация с S. epidermidis .

Гены sea и seb были одновременно обнаружены в 20% ( n = 34) изолятов, включая 17,6% изолятов S. epidermidis и 21,4% из S. haemolyticus , а seg. и sei одновременно присутствовали у 52,7% ( n = 89) (61,2% из S. epidermidis и 44% из S. haemolyticus ).Среди изученных штаммов 87,6% ( n = 148) несли по крайней мере один ген энтеротоксина, в том числе 95,3% ( n = 81) изолятов S. epidermidis и 79,8% ( n = 67) S. haemolyticus .

2.2. Молекулярное и фенотипическое определение цитотоксинов

Гены гемолизина hla / yidD , hlb и hld были обнаружены в S. epidermidis с использованием видоспецифичных праймеров.Праймеры hlb и hld из S. epidermidis не смогли идентифицировать гены β- и δ-токсинов в S. haemolyticus . Новые праймеры были разработаны для идентификации гена hla в S. haemolyticus . Однако праймеры для генов S. haemolyticus hlb и hld не могли быть сконструированы, поскольку эти гены еще не были описаны для этого вида.

Скорость обнаружения гла / годD была аналогичной в S.epidermidis и S. haemolyticus (92,9% и 91,7% соответственно). В S. epidermidis hlb были обнаружены в 92,9% изолятов и hld — в 95,3%. Гены hla и hlb одновременно присутствовали в 89,4% изолятов S. epidermidis . β-токсин был обнаружен в 81% изолятов S. haemolyticus , а δ-токсин — в 40,5%. Тридцать процентов изолятов S. haemolyticus продуцировали как β-, так и δ-токсин ().

Таблица 1

Обнаружение генов α-, β- и δ-цитотоксинов и их продукция.

(84)
Организмы ( n ) гл * глб hld α-токсин β-токсин δ-токсин
n % n % n % n % n % n %
S.Epidermidis (85) 79 92,9 79 92,9 81 95,3 24 28,2 25 29,4 77 91,7 70 83,3 68 81 34 40,5 92.3 79 92,9 81 95,3 94 55,6 93 55 34 40,5
9000pic2 показывает сравнение между генотипами и 17 генотипа. hlb и производство α- и β-токсинов. Результаты показали, что, в то время как 78% изолятов S. haemolyticus несли hla и продуцировали α-токсин, только 28% изолятов S. epidermidis несли hla / yidD и hlb гены и продуцировали соответствующие цитотоксины.Расхождения наблюдались в случае пяти изолятов S. haemolyticus , которые были отрицательными для hla , но показали фенотипическое производство, и одного изолята S. epidermidis , который был отрицательным для hlb и продуцента β- токсин.

Таблица 2

Сравнение частоты генов hla и hlb и фенотипической продукции α- и β-токсинов.

9017 9017 hla + * )
Staphylococcus haemolyticus Staphylococcus epidermidis
Гены Гены Гены
Гены
hla — * Всего Токсин hlb + hlb Всего
n (%) n (%) n (%) n (%) n (%) n (%) n (%) n (%)
α-Toxin + 65 (78) 5 (6) 70 (84) 24 (28) 0 24 (28) 9 0356 β-токсин + 24 (28) 1 (1) 25 (29)
α-токсин — 12 (14) 2 (2) 14 (16) 55 (65) 6 (7) 61 (72) β-токсин — 55 (65) 5 (6) 60 (71)
Всего 77 (92) 7 (8) 84 (100) 79 (93) 6 (7) 85 (100) Всего 79 (93) 6 ( 7) 85 (100)

Профиль токсинового гена и фенотипическая продукция токсина для каждого изолята показаны в дополнительной таблице S1.

3. Обсуждение

Staphylococcus epidermidis и S. haemolyticus — основные виды CoNS, колонизирующие нос человека [18], наиболее распространенные виды, выделенные из посевов крови [19] и часто связанные с катетер-ассоциированным кровотоком. инфекции [20]. Помимо того, что стафилококковые энтеротоксины являются основной причиной пищевых отравлений, они играют важную роль в патологических процессах, таких как сепсис, остеомиелит и респираторный дистресс-синдром [21].Однако энтеротоксигенный потенциал CoNS противоречив.

Настоящее исследование показало высокую частоту генов энтеротоксинов в изолятах культур крови: 95,3% изолятов S. epidermidis и 79,8% изолятов S. haemolyticus несут хотя бы один ген токсина. Наиболее частыми обнаруженными генами классического энтеротоксина были sea , seb и sec , а среди всех генов энтеротоксинов наиболее распространенными были seg и sei .Другое исследование [22] также показало более высокий процент sea , seb и sec в CoNS, выделенных из коровьего молока. Кроме того, сообщалось о продукции энтеротоксина А изолятами человеческого CoNS [23]. Описана продукция классических энтеротоксинов SEA, SEB и SEC клиническими изолятами S. epidermidis и SEC S. haemolyticus [5,24], при этом высокий процент изолятов, продуцирующих комбинацию двух или больше токсинов [25].Как и в настоящем исследовании, также сообщалось о наличии генов SEE, SEG, SEH и SEI и о продукции этих энтеротоксинов [26], но исследования, показывающие отсутствие или низкую частоту этих генов в CoNS, преобладают в литературе. . Эти различия между исследованиями могут быть связаны с систематической ошибкой в ​​используемом методе и в изученных изолятах, включая количество, природу и географическое происхождение штаммов. Нозокомиальные изоляты могут быть лучше оснащены факторами вирулентности, полученными путем облегченного переноса посредством селективного давления.

В настоящем исследовании 20% штаммов были положительными как для sea , так и для seb . Частое присутствие этих двух генов у одной и той же бактерии объясняется тем, что они занимают один и тот же хромосомный локус [27]. Кроме того, 61,2% из S. epidermidis и 44% из S. haemolyticus оказались положительными как для seg , так и для sei . Несколько исследований [28,29] показали систематическую ассоциацию между seg и sei и высокую частоту этих генов у S.aureus , что также может встречаться в CoNS. Ожидается одновременное присутствие генов seg и sei , поскольку эти два гена обнаружены в кластере egc , который также содержит гены, кодирующие другие стафилококковые энтеротоксины [30].

Staphylococcus epidermidis был указан как CoNS с наивысшим токсигенным потенциалом в некоторых исследованиях [25]. Фактически, этот вид показал более высокий уровень генов энтеротоксина по сравнению с S.haemolyticus (95,3% против ,79,8% соответственно). Остров патогенности, экспрессирующий несколько генов энтеротоксинов, был недавно описан в клиническом изоляте S. epidermidis [31].

Данных о наличии гемолизинов и генов гемолизина в CoNS все еще мало. Хотя 81% изолятов S. haemolyticus проявляют β-гемолитическую активность и 40% продуцируют δ-токсин, секвенирование генома не позволило идентифицировать гены, ответственные за гемолиз у этих видов; продемонстрирован только ген α-гемолизина.Праймеры гемолизина, разработанные для S. aureus [32] и S. epidermidis , а также праймеры hld , разработанные из последовательности hld из S. simulans (номер доступа GenBank {«type»: «entrez- нуклеотид «,» attrs «: {» text «:» AJ223775.1 «,» term_id «:» 3687333 «}} AJ223775.1; вперед: AAGGGGCAATACACATGRC; обратный: CCGAACGCTTCATTTCCGAT), не удалось обнаружить эти гены в S. haemolyticus . Huseby et al. [33] продемонстрировал видоспецифические различия в β-токсине S . schleiferi и S. epidermidis , белки которых показали 72% и 52% гомологию с β-токсином S. aureus соответственно. Эти различия между β-гемолизинами разных видов CoNS могут быть результатом бактериальной адаптации к широкому кругу потенциальных хозяев [34]. Поскольку праймеры hlb и hld для S. epidermidis не могли идентифицировать эти гены в S. haemolyticus , а гены hlb и hld еще не были описаны у последних видов, хотя они и являются произведенные, как продемонстрировано методом фенотипического обнаружения, могут существовать значительные различия в их последовательностях, что позволяет предположить, что эти токсины имеют различную структуру и, следовательно, разные функции у видов CoNS.

Насколько нам известно, это первое исследование по обнаружению гена hla с использованием специфических праймеров для S. epidermidis и S. haemolyticus . Ген, использованный для дизайна праймера штамма S. epidermidis {«type»: «entrez-nucleotide», «attrs»: {«text»: «W23144», «term_id»: «1299977»}} W23144 был обозначается в GenBank как «α-гемолизин» до июня 2013 года. В тот день авторы изменили обозначение этого гена на « yidD » и классифицировали его как мембранный белок.Согласно предыдущим исследованиям, некоторые члены семейства yidD были аннотированы как гемолизины, что явилось результатом неопубликованного наблюдения, опубликованного в GenBank {«type»: «entrez-nucleotide», «attrs»: {«text»: «L36462″, » term_id «:» 2537795 «}} L36462, что ген hlyA , который является гомологом yidD из Aeromonas hydrophila , обладает активностью α-гемолизина [15,16]. Некоторые базы данных показывают, что yidD является ортологом белков с гемолитической функцией SE1462 из S.epidermidis ATCC 12228 и SERP1356 из S. epidermidis RP62A (http://www.xbase.ac.uk/genome/buchnera-aphidicola-str-sg-schizaphis-graminum/NC_004061/BUsg015;yidD/super/orthologues) .

Ген, кодирующий α-токсин / yidD , был обнаружен в 92,9% изолятов S. epidermidis и ген hla в 91,7% изолятов S. haemolyticus , в то время как hlb был обнаружен с такой же частотой (92,9%) у S. epidermidis .С другой стороны, другое исследование [13] обнаружило hlb только в 20% из изолятов S. epidermidis и отсутствие hlb во всех штаммах. β-токсин описан в 75% случаев CoNS, а α-гемолиз — в 57% [35]. Натаро и др. [36] наблюдали 61% положительности для β-токсина в CoNS, в то время как в настоящем исследовании продукция β-гемолизина наблюдалась у 81% изолятов S. haemolyticus . Moraveji et al. [37] наблюдали вдвое большую частоту генов и продукции гемолизина в человеческих линиях по сравнению со штаммами животных.Важность hlb и β-токсина обусловлена ​​способностью этого белка способствовать ускользанию бактерий от иммунной системы хозяина и его участием в поглощении питательных веществ [33], обеспечивая выживание патогена.

Дивергенция в гене hld настолько велика среди видов, что не может быть амплифицирована в некоторых CoNS [12]. Это разнообразие демонстрируется тем фактом, что частичная идентичность гена этого токсина между S. aureus и S. epidermidis составляет всего 83% [12].То же самое может относиться к S. haemolyticus и может объяснить отсутствие амплификации этого гена праймерами S. epidermidis в настоящем исследовании. δ-гемолизин кодируется регуляторной РНКIII в S. aureus , связанной с системой agr [38], системой, описанной у нескольких видов стафилококков, включая S. epidermidis и S. haemolyticus [39,40] . В настоящем исследовании ген hld был обнаружен у 95,3% из S.epidermidis , а δ-гемолизин продуцировали 40,5% изолятов S. haemolyticus . Согласно Gemmel [41], δ-гемолизин чаще экспрессируется CoNS, изолированным от клинически значимых инфекций, по сравнению с неявными инфекциями человека.

Несмотря на высокую частоту гена hla , наблюдаемую в настоящем исследовании у S. epidermidis и S. haemolyticus , фенотипическая продукция токсина, кодируемого hla , кажется более частой у последних видов, с наибольшим гл, -положительный с.haemolyticus (85%), экспрессирующие α-токсин. Напротив, несмотря на высокую частоту hla / yidD и hlb в S. epidermidis , менее одной трети (30%) изолятов, несущих эти гены, также экспрессировали их. Отсутствие гена и присутствие токсина, наблюдаемые в пяти изолятах S. haemolyticus и в одном изоляте S. epidermidis , могут быть связаны с мутациями в последовательностях этих генов, такими как последовательности вставки, которые мешают амплификации. гена методом ПЦР.

Одним из ограничений настоящего исследования является тот факт, что распространенность токсигенных генов не эквивалентна распространенности экспрессии этих генов. Однако в этом исследовании экспрессия была продемонстрирована гемолизом на кровяном агаре. Необходимы дальнейшие исследования с использованием других методов для оценки экспрессии этих генов, таких как вестерн-блоттинг. Кроме того, секвенирование генома некоторых из этих положительных штаммов будет важным для идентификации этих генов в геномах S.epidermidis и S. haemolyticus .

4. Материалы и методы

4.1. Изоляты

Штаммы были выделены из посевов крови пациентов, поступивших в университетскую больницу Медицинской школы Ботукату (Hospital das Clínicas, Faculdade de Medicina de Botucatu (HC-FMB)), Государственный университет Паулиста (Universidade Estadual Paulista (UNESP)) , Botucatu Campus, между 2000 и 2011 годами. В исследование был включен только один изолят на пациента. Штаммы были выделены, как описано Koneman et al. [42].

4.2. Идентификация видов

Род Staphylococcus был идентифицирован, как описано Koneman et al. [42]. Staphylococcus epidermidis и S. haemolyticus были идентифицированы упрощенным методом, предложенным Cunha et al. [43]. Идентификация видов была генетически подтверждена с помощью ПЦР-амплификации области внутреннего транскрибируемого спейсера (ITS) 16S-23S, как описано Couto et al. [44] после экстракции ДНК с помощью набора Illustra (GE Healthcare, Little Chalfont, Buckinghamshire, UK).Следующие международные эталонные штаммы использовали в качестве контролей: S. epidermidis (ATCC 12228), S. epidermidis (ATCC 35983) и S. haemolyticus (ATCC 29970).

4.3. Обнаружение генов энтеротоксинов

ПЦР для обнаружения генов энтеротоксинов выполняли с использованием праймеров и параметров, описанных Johnson et al. [45] и Cunha et al. [4]. Международные эталонные штаммы были включены во все реакции как положительные ( S.aureus Американская коллекция типовых культур — ATCC 13565 ( sea ), ATCC 14458 ( seb ), ATCC 19095 ( sec ), ATCC 23235 ( sed ), ATCC 27664 ( см. ), ATCC 51811 ( seh ), S. aureus Food Research Institute — FRI 361 ( seg и sei )) и отрицательные ( S. xylosus ATCC 29971) контроли. Последовательности праймеров показаны в.

Таблица 3

Последовательность праймеров и размер ампликона.

Название Продукт Последовательность Ссылка Размер ампликона (bp)
море-1 Энтеротоксин A TTGGAAACGGTTAAAACGAA [29] 120
море-2 GAACCTTCCCATCAAAAACA
СБ-1 Энтеротоксин B TCGCATCAAACTGACAAACG [29] 478
СБ-2 GCAGGTACTCTATAAGTGCC
сек-1 Энтеротоксин C GACATAAAAGCTAGGAATTT [29] 257
сек-2 AAATCGGATTAACATTATCC
сед-1 Энтеротоксин D CTAGTTTGGTAATATCTCCT [29] 317
сед-2 TAATGCTATATCTTATAGGG
см-1 Энтеротоксин E CAAAGAAATGCTTTAAGCAATCTTAGGCCAC [29] 170
см-2 CTTACCGCCAAAGCTG
сег-1 Энтеротоксин G AATTATGTGAATGCTCAACCCGATC [36] 642
сег-2 AAACTTATATGGAACAAAAGGTACTAGTTC
sei-1 Энтеротоксин H CAATCACATCATATGCGAAAGCAG [36] 376
seh-2 CATCTACCCAAACATTAGCACC
sei-1 Энтеротоксин I CTCAAGGTGATATTGGTGTAGG [36] 576
sei-2 AAAAAACTTACAGGCAGTCCATCTC
гл / yidD_epid-1 α-гемолизин / жидД TTTCKCCACTTACACCMCC Это исследование 160
гл / yidD_epid-2 GGAACAGGATCAAAGCCACCT
hlb_epid-1 β-гемолизин TGGTGGCGTTGGTATTGTGA Это исследование 541
hlb_epid-2 ACCCCAAGATTTCACGGACC
hla_haem-1 α-гемолизин TGGGCCATAAACTTCAATCGC Это исследование 72
гла-гем-2 ACGCCACCTACATGCAGATTT
hld-epid-1 δ-гемолизин ATGGCAGCAGATATCATTTC [30] 444
hld-epid-2 CGTGAGCTTGGGAGAGAC

4.4. Обнаружение генов гемолизина

Ген δ-гемолизина, hld , был обнаружен с использованием праймеров и параметров, описанных Marconi et al. [46].

Ген hla / yidD был обнаружен в изолятах S. epidermidis с использованием праймеров, разработанных с помощью NCBI-PrimerBlast, 2008, и последовательностей штамма S. epidermidis {«type»: «entrez-нуклеотид», «attrs»: {«text»: «W23144», «term_id»: «1299977»}} W23144 (GenBank: {«type»: «entrez-нуклеотид», «attrs»: {«text»: «ACJC01000124.1 «,» term_id «:» 224999876 «}} ACJC01000124.1) (hla / yidD_epid). Ген hla был обнаружен в изолятах S. haemolyticus с использованием праймеров, разработанных с помощью PrimerBlast и последовательности штамма JCSC1435 (NCBI : {«type»: «entrez-нуклеотид», «attrs»: {«text»: «NC_007168.1», «term_id»: «70725001»}} NC_007168.1) (hla_haem). Праймеры для hlb ген в S. epidermidis были сконструированы с использованием PrimerBlast и последовательности S. epidermidis RP62A (NCBI: {«type»: «entrez-нуклеотид», «attrs»: {«text»: «NC_002976.3 «,» term_id «:» 57865352 «}} NC_002976.3) (hlb_epid). Праймеры для гена hlb в S. haemolyticus не могли быть сконструированы, поскольку этот ген не был описан у этого вида в База данных NCBI-GenBank. Реакционная смесь содержала 2,0 ед. Полимеразы Taq, 1 × буфер для ПЦР, содержащий 0,75 мМ MgCl 2 , 100 мкМ трифосфат дезоксирибонуклеотидов, 1 М каждого праймера и 150 нг нуклеиновой кислоты. Условия ПЦР были следующими: для гл , один шаг при 94 ° C в течение 4 минут; 35 циклов при 94 ° C в течение 1 минуты, 60 ° C в течение 1 минуты, 72 ° C в течение 1 минуты и 72 ° C в течение 5 минут; для hlb , один шаг при 94 ° C в течение 4 минут, 35 циклов при 94 ° C в течение 1 минуты, 60 ° C в течение 1 минуты, 72 ° C в течение 1.5 мин и 72 ° C в течение 6 мин. Эталонные штаммы были включены во все реакции: hla / yidD _epid: S. epidermidis ATCC 12228; hla _haem: S. haemolyticus ATCC 29970; hlb _epid: S. epidermidis ATCC 12228. Последовательности праймеров показаны на фиг.

4.5. Фенотипическая продукция β- и δ-цитотоксинов

Продукция α-токсина определялась на чашках с кровяным агаром, содержащим 5% кроличьей крови, инкубированных при 37 ° C в течение 24 часов.О положительном результате свидетельствовало образование зон гемолиза вокруг изолированных колоний.

Продукция β- и δ-токсинов в изолятах S. haemolyticus была обнаружена, как описано Hébert и Hancock [47]. β-гемолиз наблюдали по наличию зоны неполного гемолиза на чашке с агаром с бараньей кровью, инкубированной при 37 ° C в течение 24 ч, а затем в течение ночи при 4 ° C [48]. Присутствие δ-токсина подтверждалось наличием синергизма с β-гемолизином S. aureus ATCC 25923.Для этого изолят наносили штрихами перпендикулярно штамму S. aureus на чашку с агаром с овечьей кровью. Планшет инкубировали при 37 ° C в течение 24 ч, и продукцию δ-токсина наблюдали по образованию зоны гемолиза в форме стрелки [47].

4.6. Статистический анализ

Тест хи-квадрат использовался для проверки связи между переменными, принимая уровень значимости <0,05.

5. Выводы

Клинические изоляты S.epidermidis и S. haemolyticus проявляют высокий токсигенный потенциал, особенно продуцируя энтеротоксины G и I. Использование новых видоспецифичных праймеров для hla / yidD и hlb для S. epidermidis и для hla из S. haemolyticus выявили высокую частоту этих генов в нозокомиальных изолятах этих видов. Полученные данные демонстрируют важную роль этих генов цитотоксина в становлении этих видов и, возможно, в развитии инфекций, вызванных CoNS.

Благодарности

Эта работа была поддержана государственным финансовым агентством Сан-Паулу Research Foundation (FAPESP — Fundação de Amparo à Pesquisa do Estado de São Paulo; Grant 2011 / 15396-1) и Национальным советом по технологическому и научному развитию (CNPq— Conselho Nacional de Desenvolvimento Científico e Tecnológico; Grant 304729 / 2014-0).

Вклад авторов

Л.П .: задумал исследование, участвовал в его разработке, проводил эксперименты, анализировал данные и составлял рукопись.C.I.B .: участвовал в разработке концепции исследования и в лабораторных экспериментах. А.О .: участвовал в лабораторных экспериментах. P.Y.F.M .: участвовал в разработке праймеров. V.C.P .: участвовал в молекулярных экспериментах. M.L.R.S.C .: задумал исследование, участвовал в его разработке и координации, а также отредактировал рукопись. Все авторы прочитали и одобрили окончательную рукопись.

Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов.

Список литературы

1.Вуонг К., Отто М. Эпидермальные инфекции, вызванные стафилококком. Микробы заражают. 2002; 4: 481–489. DOI: 10.1016 / S1286-4579 (02) 01563-0. [PubMed] [CrossRef] [Google Scholar] 2. Ирлингер Ф. Оценка безопасности молочных микроорганизмов: Коагулазонегативные стафилококки. Int. J. Food Microbiol. 2008. 126: 302–310. DOI: 10.1016 / j.ijfoodmicro.2007.08.016. [PubMed] [CrossRef] [Google Scholar] 3. Подковик М., Быстронь Я., Баня Дж. Генотипы, устойчивость к антибиотикам и факторы вирулентности стафилококков из готовой к употреблению пищи.Пищевой патогенный микроорганизм. Дис. 2012; 9: 91–93. DOI: 10.1089 / fpd.2011.0962. [PubMed] [CrossRef] [Google Scholar] 4. Cunha M.L.R.S., Calsolari R.A.O., Araújo-Júnior J.P. Выявление генов токсина 1 энтеротоксина и синдрома токсического шока в Staphylococcus с акцентом на коагулазонегативные стафилококки. Microbiol. Иммунол. 2007; 51: 381–390. DOI: 10.1111 / j.1348-0421.2007.tb03925.x. [PubMed] [CrossRef] [Google Scholar] 5. Барретти П., Монтелли А.К., Баталья Дж. Э., Карамори Дж. К., Кунья М.Л.Р.С. Роль факторов вирулентности в исходе стафилококкового перитонита у пациентов с ХПНП.BMC Infect. Дис. 2009; 9: 212. DOI: 10.1186 / 1471-2334-9-212. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 6. Тейлор А.Л., Ллевелин М.Дж. Суперантиген-индуцированная пролиферация CD4 + CD25- Т-клеток человека сопровождается переключением на функциональный регуляторный фенотип. J. Immunol. 2010; 185: 6591–6598. DOI: 10.4049 / jimmunol.1002416. [PubMed] [CrossRef] [Google Scholar] 7. Frase J.D., Proft T. Бактериальный суперантиген и суперантиген-подобные белки. Иммунол. Ред. 2008; 225: 226–243. DOI: 10.1111 / j.1600-065X.2008.00681.x. [PubMed] [CrossRef] [Google Scholar] 9. Коэльо С.М.О., Рейносо Э., Перейра И.А., Соарес Л.С., Демо М., Богни К., Соуза М.М.С. Факторы вирулентности и устойчивость к противомикробным препаратам Staphylococcus aureus , выделенного от мастита крупного рогатого скота в Рио-де-Жанейро. Pesq. Вет. Бюстгальтеры. 2009. 29: 369–374. DOI: 10.1590 / S0100-736X200

00002. [CrossRef] [Google Scholar] 10. Пенг Х.Л., Новик Р.П., Крейсвирт Б., Корнблюм Дж., Шливерт П. Клонирование, характеристика и секвенирование дополнительного регулятора гена ( agr ) в Staphylococcus aureus .J. Bacteriol. 1988; 170: 4365–4372. [Бесплатная статья PMC] [PubMed] [Google Scholar] 11. Маккевитт А.И., Бьорнсон Г.Л., Маурахер К.А., Шайфеле Д.В. Аминокислотная последовательность дельтоподобного токсина из Staphylococcus epidermidis . Заразить. Иммун. 1990; 58: 1473–1475. [Бесплатная статья PMC] [PubMed] [Google Scholar] 12. Эвен С., Лерой С., Шарлье К., Закур Н.Б., Чакорнак Дж. П., Леберт И., Жамет Э., Десмонтс М. Х., Котон Э., Почет С. и др. Низкий уровень опасности для безопасности при коагулазонегативных стафилококках, выделенных из ферментированных пищевых продуктов.Int. J. Food Microbiol. 2010; 139: 87–95. DOI: 10.1016 / j.ijfoodmicro.2010.02.019. [PubMed] [CrossRef] [Google Scholar] 13. Оки М.С., Йолоба М.Л., Окелло М., Наджука Ф.С., Катабази Ф.А., Бванга Ф., Нантеза А., Катите Д.П. Распространенность детерминант вирулентности у Staphylococcus epidermidis от пациентов интенсивной терапии в Кампале, Уганда. J. Infect. Dev. Ctries. 2012; 6: 242–250. [PubMed] [Google Scholar] 14. Schleifer K.H., Kloos W.E. Выделение и характеристика стафилококков из кожи человека. Int.J. Syst. Бактериол. 1975; 25: 50–61. DOI: 10.1099 / 00207713-25-1-50. [CrossRef] [Google Scholar] 15. Радд К.Е., Хамфери-Смит И., Васингер В.С., Байрох А. Низкомолекулярные белки: проблема для постгеномных исследований. Электрофорез. 1998. 19: 536–544. DOI: 10.1002 / elps.11501. [PubMed] [CrossRef] [Google Scholar] 16. Ю. З., Лавен М., Клепш М., де Гиер Дж. У., Биттер В., ван Ульсен П., Люиринк Дж. Роль Escherichia coli YidD во внедрении мембранного белка. J. Bacteriol. 2011; 193: 5242–5251.DOI: 10.1128 / JB.05429-11. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 17. Давенпорт К.В., Далиго Х.Э., Миноуг Т.Д., Бишоп-Лилли К.А., Брумолл С.М., Брюс Д.К., Чейн П.С., Койн С.Р., Фрей К.Г., Гиббонс Х.С. и др. Полная сборка генома Staphylococcus epidermidis . Объявление о геноме. 2014; 2: e01059-14. DOI: 10.1128 / genomeA.01059-14. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 18. Коста С.Ф., Мичели М.Х., Анаисси Э.Дж. Слизистая оболочка или кожа как источник коагулазонегативной стафилококковой бактериемии? Lancet Infect.Дис. 2004. 4: 278–286. DOI: 10.1016 / S1473-3099 (04) 01003-5. [PubMed] [CrossRef] [Google Scholar] 19. Falcone M., Giannella M., Raponi G., Mancini C., Venditti M. Использование тейкопланина и появление Staphylococcus haemolyticus : есть ли связь? Clin. Microbiol. Заразить. 2006; 12: 96–97. DOI: 10.1111 / j.1469-0691.2005.01307.x. [PubMed] [CrossRef] [Google Scholar] 20. Mack D., Rohde H., Harris L.G., Davies A.P., Horstkotte M.A., Knobloch J.K. Формирование биопленок при инфекциях, связанных с медицинским устройством.Int. J. Artif. Органы. 2006. 29: 343–359. [PubMed] [Google Scholar] 21. Мишлен А.Ф., Карлос И.З. Взаимодействие стафилококковых экстеротоксинов с иммунной системой хозяина. Преподобный Ciênc. Ферма. 2003. 24: 83–95. [Google Scholar] 22. Де Фрейтас Гимарайнш Ф., Нобрега Д. J. Dairy Sci. 2013; 96: 2866–2872. DOI: 10.3168 / jds.2012-5864.[PubMed] [CrossRef] [Google Scholar] 24. Красс Б., Бергдолл М.С. Вовлечение коагулазонегативных стафилококков в синдром токсического шока. J. Clin. Microbiol. 1986; 23: 43–45. [Бесплатная статья PMC] [PubMed] [Google Scholar] 25. Cunha M.L.R.S., Rugolo L.M.S.S., Lopes C.A.M. Изучение факторов вирулентности коагулазонегативных стафилококков, выделенных от новорожденных. Mem. Inst. Освальдо Крус. 2006. 101: 661–668. DOI: 10.1590 / S0074-02762006000600014. [PubMed] [CrossRef] [Google Scholar] 26. Васконселос Н.Г., Перейра В.C., Araújo-Júnior J.P., Cunha M.L.R.S. Молекулярное определение энтеротоксинов E, G, H и I в Staphylococcus aureus и коагулазонегативных стафилококках, выделенных из клинических образцов новорожденных в Бразилии. J. App. Microbiol. 2011; 111: 749–762. DOI: 10.1111 / j.1365-2672.2011.05076.x. [PubMed] [CrossRef] [Google Scholar] 27. Джетт М., Ионин Б., Дас Р., Нил Р. Стафилококковые энтеротоксины. В: Сассман М., редактор. Молекулярная медицинская микробиология. Академическая пресса; Сан-Диего, Калифорния, США: 2001.С. 1089–1116. [Google Scholar] 28. Lammler C., Akineden O., Annemuller C., Wolter W., Zschock M. Молекулярный анализ факторов вирулентности Staphylococcus aureus , выделенных из субклинического мастита крупного рогатого скота; Материалы симпозиума по иммунологии молочной железы жвачных животных; Стреза, Италия. 11–14 июня 2002 г .; С. 226–330. [Google Scholar] 29. Akineden O., Annemuller C., Hassan A.A., Lammler C., Wolter W., Zschock M. Гены токсинов и другие характеристики изолятов Staphylococcus aureus из молока коров с маститом.Clin. Диаг. Лаборатория. Иммунол. 2001; 8: 959–964. DOI: 10.1128 / CDLI.8.5.959-964.2001. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 30. Rosec J.P., Gigaud O. Гены стафилококковых энтеротоксинов классического и нового типов, обнаруженные методом ПЦР во Франции. J. Food Microbiol. 2002; 77: 61–70. DOI: 10.1016 / S0168-1605 (02) 00044-2. [PubMed] [CrossRef] [Google Scholar] 31. Мадхусуданан Дж., Со К.С., Ремортел Б., Пак Дж. Ю., Хван С. Ю., Фокс Л. К., Пак И. Х., Деобальд К. Ф., Ван Д., Лю С. и др. Островок патогенности, несущий энтеротоксин, в Staphylococcus epidermidis .J. Bacteriol. 2011; 193: 1854–1862. DOI: 10.1128 / JB.00162-10. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 32. Жарро С., Мугель К., Тиулуза Дж., Лина Г., Мёнье Х., Форе Ф., Несме X., Этьен Дж., Ванденеш Ф. Взаимосвязи между генетическим фоном Staphylococcus aureus , факторами вирулентности, agr группы (аллели) и болезни человека. Заразить. Иммун. 2002; 70: 631–641. DOI: 10.1128 / IAI.70.2.631-641.2002. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 33.Хусеби М., Ши К., Браун К.К., Дигре Дж., Менгисту Ф., Сео К.С., Бохач Г.А., Шливерт П.М., Олендорф Д.Х., Эрхарт К.А. Структура и биологическая активность бета-токсина из Staphylococcus aureus . J. Bacteriol. 2007. 189: 8719–8726. DOI: 10.1128 / JB.00741-07. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 34. Дзевановска К., Эдвардс В.М., Дерингер Дж.Р., Бохач Г.А., Герра Д.Дж. Сравнение β-токсинов из Staphylococcus aureus и Staphylococcus intermediateus .Arch. Biochem. Биофиз. 1996. 335: 102–108. DOI: 10.1006 / abbi.1996.0486. [PubMed] [CrossRef] [Google Scholar] 35. Бедиди-Мадани Н., Гренланд Т., Ричард Ю. Производство экзопротеинов и слизи коагулазонегативными стафилококками, выделенными из козьего молока. Вет. Microbiol. 1998. 59: 139–145. DOI: 10.1016 / S0378-1135 (97) 00190-9. [PubMed] [CrossRef] [Google Scholar] 36. Натаро Дж. П., Коркоран Л., Зирин С., Свинк С., Тайчман Н., Гоин Дж., Харрис М. К. Проспективный анализ коагулазонегативной стафилококковой инфекции у госпитализированных младенцев.J. Pediatr. 1994; 125: 798–804. DOI: 10.1016 / S0022-3476 (06) 80186-1. [PubMed] [CrossRef] [Google Scholar] 37. Мораведжи З., Табатабаи М., Аски С.Х., Хошбахт Р. Характеристика гемолизинов штаммов Staphylococcus , выделенных от человека и крупного рогатого скота, Южный Иран. Иран. J. Vet. Res. 2014; 15: 326–330. [Бесплатная статья PMC] [PubMed] [Google Scholar] 38. Новик Р.П. Аутоиндукция и сигнальная трансдукция в регуляции вирулентности стафилококков. Мол. Microbiol. 2003. 48: 1429–1449. DOI: 10.1046 / j.1365-2958.2003.03526.x. [PubMed] [CrossRef] [Google Scholar] 39. Дорде-Фрисони Э., Дорчиес Г., Де А.К., Талон Р., Лерой С. Геномное разнообразие Staphylococcus xylosus . Прил. Environ. Microbiol. 2007. 73: 7199–7209. DOI: 10.1128 / AEM.01629-07. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 40. Вустер А., Бабу М.М. Сохранение и эволюционная динамика системы межклеточной коммуникации agr в разных фирмах. J. Bacteriol. 2008; 190: 743–746. DOI: 10.1128 / JB.01135-07. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 41. Джеммель К.Г. Коагулазонегативные стафилококки. J. Med. Микробный. 1986; 22: 285–295. DOI: 10.1099 / 00222615-22-4-285. [PubMed] [CrossRef] [Google Scholar] 42. Конеман Э.В., Аллен С.Д., Янда В.М., Шрекенбергер П.С., Винн В.С., младший Атлас цветов и учебник по диагностической микробиологии. 5-е изд. Липпинкотт; Филадельфия, Пенсильвания, США: 1997. [Google Scholar] 43. Cunha M.L.R.S., Sinzato Y.K., Silveira L.V.A. Сравнение методов выявления коагулазонегативных стафилококков.Mem. Inst. Освальдо Крус. 2004. 99: 855–860. DOI: 10.1590 / S0074-02762004000800012. [PubMed] [CrossRef] [Google Scholar] 44. Couto I., Pereira S., Miragaia M., Sanches I.S., Lencastre H. Идентификация клинических изолятов стафилококков от человека с помощью ПЦР с внутренним транскрибированным спейсером. J. Clin. Microbiol. 2001; 39: 3099–3103. DOI: 10.1128 / JCM.39.9.3099-3103.2001. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 45. Джонсон У.М., Тайлер С.Д., Эван Э.П., Эштон Ф.Э., Поллард Д.Р., Рози К.Р. Обнаружение генов энтеротоксинов, эксфолиативных токсинов и токсина 1 синдрома токсического шока в Staphylococcus aureus с помощью полимеразной цепной реакции.J. Clin. Microbiol. 1991; 29: 426–430. [Бесплатная статья PMC] [PubMed] [Google Scholar] 46. Маркони К., Кунья М.Л.Р.С., Араужо Дж. П., мл., Руголо Л.М.С.С. Стандартизация метода ПЦР для обнаружения дельта-токсина в Staphylococcus spp . J. Venom. Anim. Токсины, вкл. Троп. Дис. 2005. 11: 117–128. DOI: 10.1590 / S1678-005000200004. [CrossRef] [Google Scholar] 48. Фрир Дж. Х., Арбутнотт Дж. П. Токсины Staphylococcus aureus . Pharmacol. Ther. 1983; 19: 55–106. DOI: 10.1016 / 0163-7258 (82)
-0.[PubMed] [CrossRef] [Google Scholar]

Устойчивость к фузидовой кислоте, опосредованная fusB, у бычьих коагулазонегативных стафилококков | Журнал антимикробной химиотерапии

Аннотация

Цели : Целью этого исследования было определить возникновение устойчивости к фузидовой кислоте, опосредованной геном fusB , среди коагулазонегативных стафилококков (CoNS), выделенных от мастита крупного рогатого скота.

Методы : Всего 113 изолятов CoNS были проверены на чувствительность к фузидовой кислоте с использованием метода дисковой диффузии.Ген fusB был обнаружен с помощью ПЦР и последующего секвенирования ДНК. Локализацию fusB определяли гибридизацией.

Результаты : Ген fusB был обнаружен в 3 из 11 устойчивых к фузидовой кислоте бычьих изолятов CoNS. Организация нижележащего участка fusB на плазмиде размером 40 т.п.н. в изоляте Staphylococcus haemolyticus (288/96) была очень похожа на ранее описанную организацию fusB на плазмиде pUB101 из изолята Staphylococcus aureus человека. источник.Ген fusB был локализован на хромосоме в оставшихся двух изолятах.

Выводы : Устойчивость к фузидовой кислоте, опосредованная fusB , не является доминирующим механизмом устойчивости в устойчивых к фузидовой кислоте CoNS, изученных в этой работе. Сходство между организацией нижележащего участка fusB в S. haemolyticus (изолят 288/96) и на плазмиде pUB101 из изолята S. aureus человеческого происхождения указывает на общее предковое происхождение этих генов.

Введение

Фузидовая кислота — эффективное антистафилококковое средство, в основном используемое для местного лечения кожных инфекций. Фузидовая кислота подавляет синтез бактериальных белков, вмешиваясь в фактор элонгации, EF-G.1 EF-G является важным фактором у бактерий, участвующих в перемещении тРНК по рибосоме и, таким образом, в продвижении цикла трансляции на один кодон.

У стафилококков устойчивость к фузидовой кислоте в основном обусловлена ​​двумя механизмами.Один механизм основан на снижении сродства системы синтеза белка к фузидовой кислоте2. Это вызвано точечными мутациями в хромосомном гене, кодирующем EF-G ( fusA ). Точечные мутации происходят в основном в двух разных доменах гена fusA в Staphylococcus aureus .3,4 Другой механизм относится к пониженной проницаемости, которая, как предполагалось, связана с плазмидой5. был охарактеризован как транспозоноподобный элемент, кодирующий небольшой (25 кДа) цитоплазматический белок.6 Однако неизвестно, участвует ли этот белок в снижении проницаемости стафилококков, устойчивых к фузидовой кислоте.

Была изучена плазмида pUB101 устойчивости к фузидовой кислоте S. aureus и охарактеризован ген, названный «ген устойчивости к фузидовой кислоте». 7 Эта генетическая детерминанта, fusB , была впоследствии идентифицирована у устойчивых к фузидовой кислоте S. aureus , выделенные от людей с буллезным импетиго в Скандинавии.8 Ген fusB локализован в хромосоме всех исследованных изолятов.

Согласно норвежской программе мониторинга устойчивости к противомикробным препаратам у бактерий от человека (NORM) (веб-страница авторов), было обнаружено заметное увеличение частоты выделения устойчивых к фузидовой кислоте S. aureus , связанных с буллезным импетиго, среди детей. Норвежская программа мониторинга устойчивости к антибиотикам бактерий из кормов, продуктов питания и животных (NORM-VET) (веб-страница авторов) зарегистрировала относительно высокий процент устойчивых к фузидовой кислоте стафилококков, выделенных от животных.

В этом исследовании мы сообщаем о возникновении устойчивости к фузидовой кислоте, опосредованной геном fusB , среди коагулазонегативных стафилококков (CoNS), выделенных от мастита крупного рогатого скота. Мы определили генетическую организацию гена fusB на большой плазмиде в изоляте Staphylococcus haemolyticus .

Материалы и методы

Бактериальные изоляты и тестирование на чувствительность

Стафилококки, устойчивые к одному или нескольким противомикробным агентам пенициллину, тетрациклину, стрептомицину и комбинации сульфонамида и триметоприма, выделенные от мастита крупного рогатого скота в Национальном ветеринарном институте в 1996 году, хранили замороженными при температуре -80 ° C.Дисковый диффузионный тест с полуконфлюэнтным ростом на чашках с агаром Мюллера-Хинтона был использован в соответствии с инструкциями производителя (Neo-Sensitabs®, Rosco Diagnostica, Тааструп, Дания) для тестирования чувствительности к антимикробным агентам, перечисленным выше. Всего было собрано 1389 изолятов стафилококков (776 S. aureus и 613 CoNS). Из этой коллекции произвольно были отобраны 113 изолятов CoNS и проведен скрининг на устойчивость к фузидовой кислоте с помощью дискового теста диффузии, как описано.Зоны ингибирования, используемые для классификации штаммов как устойчивые или чувствительные (устойчивые, ≤31 мм; чувствительные, ≥32 мм), были рекомендованы Норвежской группой AFA (описаны в «Руководстве пользователя» NEO-SENSITABS®). Для определения МПК фузидовой кислоты использовали Etest (AB Biodisk, Solna, Швеция). Штаммы с МПК выше 0,5 мг / л были классифицированы как устойчивые (контрольные точки, рекомендованные норвежской группой AFA). Два чувствительных штамма ( S. aureus ATCC 29213 и S. aureus ATCC 25923) были включены в качестве контроля качества при проведении тестирования на чувствительность.Выработку β-лактамазы определяли с помощью метода «лист клевера» 9. Устойчивые к фузидовой кислоте виды CoNS были идентифицированы с помощью набора Staph-Zym (Rosco Diagnostica).

Молекулярные методы

ПЦР-амплификацию гена fusB проводили с использованием пары праймеров FB (iii) (5′-ATTCAATCGGAAACCTATAATGATA-3 ‘) и FB (iv) (5′-TTATATATTCCGATTTGATGCAAG-3’), как описано ранее.8 A Возможная генетическая связь между fusB и структурным геном ( blaZ ) оперона bla была исследована с использованием праймеров blaZ4F (5′-TTGATAAGTGAAACCGCC-3 ‘) (показано на рисунке 1) и праймеров fusB FB (iii) или FB (iv).Кроме того, праймер blaIR 5′-CTATGGCTGAATGGGAT-3 ‘(указанный на рисунке 1) и праймеры FB (iii) или FB (iv) fusB были использованы для амплификации возможной связи между геном fusB и репрессор оперона bla , blaI . Последовательности праймеров (blaZ4F и blaIR) были основаны на данных о нуклеотидных последовательностях, доступных под номерами доступа X52734 и X53818, соответственно.

Рисунок 1

Сравнение организации детерминанта fusB на pNVH96 в S.haemolyticus 288/96 (инвентарный номер AJ302698) и на плазмиде S. aureus pUB101 (инвентарный номер AY373761). Направление стрелок отражает направление транскрипции. Области гомологии между плазмидами выделены серой штриховкой. Недавнее исследование6 обозначило orf152 и orf170 как aj2 и aj3 соответственно.

Рисунок 1

Сравнение организации определителя fusB на pNVH96 в S.haemolyticus 288/96 (инвентарный номер AJ302698) и на плазмиде S. aureus pUB101 (инвентарный номер AY373761). Направление стрелок отражает направление транскрипции. Области гомологии между плазмидами выделены серой штриховкой. Недавнее исследование6 обозначило orf152 и orf170 как aj2 и aj3 соответственно.

Праймеры

для ПЦР для амплификации структурного гена ( blaZ ) оперона bla и инсерционной последовательности IS 257 основывались на данных о последовательностях, доступных под номерами доступа X52734 и X53951, соответственно.

Плазмидную ДНК очищали от изолятов CoNS с использованием набора miniprep (QIAGEN, Hilden, Германия). Клетки стафилококка (~ 10 10 ) лизировали перед очисткой плазмиды с использованием 100 мкг лизостафина (Sigma, St Louis, MO, USA). Саузерн-блоттинг и последующая гибридизация цельноклеточной ДНК, расщепленной Hin, dIII, расщепленной плазмиды Hin, dIII и непереваренной плазмидной ДНК, проводили с использованием стандартной методологии. Секвенирование ДНК проводили на генетическом анализаторе модели 3100-Avant (Applied Biosystems, Калифорния, США).Трансформацию плазмиды в свободный от плазмиды S. aureus RN4220 проводили с использованием протопластного метода Чанга и Коэна.10

Результаты и обсуждение

Одиннадцать (из 113) изолятов были классифицированы как устойчивые к фузидовой кислоте. МИК для этих изолятов представлены в таблице 1. Десять (из 11 устойчивых к фузидовой кислоте CoNS) были устойчивы к пенициллину G, тогда как устойчивость к тетрациклину и стрептомицину наблюдалась у шести изолятов каждого (таблица 1).

Таблица 1

Изоляты стафилококков с устойчивостью к фузидовой кислоте

08 REN R 14 epidermis S. / 96 061 PEN T , R , FUS R
Штамм . Фенотип устойчивости . МИК фузидовой кислоты (мг / л) . ген fusB .
S. epidermidis 006/96 PEN R , FUS R 12
S.epidermidis 433/96 PEN R , STR R , FUS R 6
S. epidermidis 1392/96 8
S. epidermidis 1708/96 PEN R , STR I , FUS R 8 +
PEN R , TET R , FUS R 4
S.warneri 1273/96 PEN R , STR R , FUS R 6
S. cohnii 1646/96 3
S. cohnii 1153/96 TET R , STR R , FUS R 1,5 — S. hominis 1505/96 PEN R , TET R , FUS R 8 +
S.хромогены 1220/96 PEN R , TET R , STR R , FUS R 6
S. haemolyticus 288/96 6 , TET R , STR R , FUS R 4 +
STR R , FUS R 08 REN ET ET R , FUS R 9153 900 S. chromogenes 1220/96
Напряжение . Фенотип устойчивости . МИК фузидовой кислоты (мг / л) . ген fusB .
S. epidermidis 006/96 PEN R , FUS R 12
S. epidermidis 6 433/96 6
S. epidermidis 1392/96 PEN R , FUS R 8 — .Epidermidis 1708/96 PEN R , STR I , FUS R 8 +
S. epidermidis 1422/96 4
S. warneri 1273/96 PEN R , STR R , FUS R 6 — 900 С.cohnii 1646/96 PEN R , TET R , FUS R 3
S. cohnii 1153/96 TET R 9000 , FUS R 1,5
S. hominis 1505/96 PEN R , TET R , FUS R 8 PEN R , TET R , STR R , FUS R 6
S.haemolyticus 288/96 PEN R , TET R , STR R , FUS R 4 +
Таблица 1

Изоляты стафилококка

стафилококка

Штамм . Фенотип устойчивости . МИК фузидовой кислоты (мг / л) . ген fusB . С.epidermidis 006/96 PEN R , FUS R 12 — S. epidermidis 433/96 PEN R , STR R , STR R 6 — S. epidermidis 1392/96 PEN R , FUS R 8 — EN 6 S. epidermidis R , STR I , FUS R 8 + S.epidermidis 1422/96 PEN R , TET R , FUS R 4 — S. , FUS R 6 — S. cohnii 1646/96 PEN R , TET R , FUS R 3 9153 9153 900 С.cohnii 1153/96 TET R , STR R , FUS R 1.5 — S. hominis 1505/96 PEN T , R , FUS R 8 + S. хромогены 1220/96 PEN R , TET R , STR R , FUS R 8 6- 8 9 С.haemolyticus 288/96 PEN R , TET R , STR R , FUS R 4 +

08 REN R 14 epidermis S. / 96 061 PEN T , R , FUS R
Штамм . Фенотип устойчивости . МИК фузидовой кислоты (мг / л) . ген fusB .
S. epidermidis 006/96 PEN R , FUS R 12
S.epidermidis 433/96 PEN R , STR R , FUS R 6
S. epidermidis 1392/96 8
S. epidermidis 1708/96 PEN R , STR I , FUS R 8 +
PEN R , TET R , FUS R 4
S.warneri 1273/96 PEN R , STR R , FUS R 6
S. cohnii 1646/96 3
S. cohnii 1153/96 TET R , STR R , FUS R 1,5 — S. hominis 1505/96 PEN R , TET R , FUS R 8 +
S.хромогены 1220/96 PEN R , TET R , STR R , FUS R 6
S. haemolyticus 288/96 6 , TET R , STR R , FUS R 4 +

Все 11 изолятов были проверены на fusB с помощью ПЦР-амплификации гена. Три из 11 устойчивых к фузидовой кислоте CoNS содержали ген fusB (Таблица 1).Генетическая основа устойчивости к фузидовой кислоте у остальных восьми изолятов еще предстоит определить.

Плазмидные профили изолятов, несущих fusB , Staphylococcus epidermidis 1708/96, S. haemolyticus 288/96 и Staphylococcus hominis 1505/96, оказались разными (результаты не показаны). Гибридизация показала, что fusB локализован на плазмиде размером ~ 40 т.п.н. в S. haemolyticus 288/96 и хромосомно расположен в двух других изолятах.В S. haemolyticus 288/96 ген fusB был локализован на фрагментах Hin dIII равного размера при расщеплении цельноклеточной ДНК и плазмидной ДНК.

ПЦР-амплификация выявила присутствие структурного гена ( blaZ ) оперона bla и IS 257 во всех трех изолятах. Тесная ассоциация между fusB и опероном bla была обнаружена в плазмиде S. aureus pUB101.7. Генетическая связь между blaZ и fusB была продемонстрирована в S.haemolyticus 288/96 [продукт ПЦР размером ~ 2050 п.н. был получен с комбинацией праймеров blaZ4F и FB (iv)]. Затем ампликон секвенировали. Данные последовательности показали, что продукт ПЦР содержал IS 257 , orf152 orf170 и ген fusB , как показано на рисунке 1. Тесной ассоциации между fusB и опероном bla в два других изолята.

Ранее нами был изучен изолят S.haemolyticus 288/96 и идентифицировали кластер генов устойчивости к пенициллину ( blaZ , blaR и blaI ) на плазмиде размером ~ 40 kb.11 С целью охарактеризовать фланкирующую область оперона bla , плазмиду был трансформирован в свободный от плазмиды S. aureus . Трансформант продуцировал β-лактамазу и был устойчивым к фузидовой кислоте с МПК 12 мг / л. Плазмида была обозначена как pNVH96, и была определена последовательность ДНК этой плазмиды размером ~ 13 т.п.н. (номер доступа AJ302698).

Сравнение последовательностей ДНК плазмид pNVH96 из S. haemolyticus и pUB101 из S. aureus показало, что область, содержащая детерминанту устойчивости к фузидовой кислоте (гены fusB , bla , IS 257 , orf1 52 и orf170 ) организованы аналогичным образом (рисунок 1). Однако orf152–170 на pNVH96 был идентифицирован как слияние orf152 и orf170 на pUB101.Размер плазмиды различается между pUB101 (21,845 т.п.н.) и pNVH96 (~ 40 т.п.н.).

Использование фузидиевой кислоты для молочного скота в Норвегии очень ограничено, в то время как пенициллин G является препаратом первого выбора для лечения мастита крупного рогатого скота. В этом исследовании 10 из 11 устойчивых к фузидовой кислоте CoNS были устойчивы к пенициллину G (Таблица 1). Давление отбора пенициллина может способствовать дальнейшему распространению устойчивости к фузидовой кислоте среди стафилококков.

Ген fusA является геном домашнего хозяйства, а в гене S.Предполагается, что специфические для aureus мутации fusA приводят к увеличению МПК фузидовой кислоты. До сих пор такие мутации не были нанесены на карту для различных видов CoNS. Значительный объем данных о последовательности fusA для различных видов CoNS должен быть предоставлен для анализа мутаций, возможно, участвующих в устойчивости к фузидовой кислоте.

Это первое сообщение о fusB у стафилококков, отличных от S. aureus . CoNS крупного рогатого скота, несущий fusB , может представлять собой резервуар генов устойчивости к фузидовой кислоте, которые могут передаваться другим стафилококкам, в том числе патогенным для человека и других животных.

Декларации прозрачности

Не подлежат декларированию.

Мы высоко ценим техническую помощь Ханне Таральдсен (Национальный ветеринарный институт).

Список литературы

1« и др.

Структура мутантного EF-G выявляет домен III и, возможно, сайт связывания фузидовой кислоты

,

J Mol Biol

,

2000

, vol.

303

(стр.

593

603

) 2.

Механизмы устойчивости к фузидовой кислоте у Staphylococcus aureus

,

J Gen Microbiol

,

1976

, vol.

96

(стр.

229

38

) 3« и др.

Биологическая стоимость и компенсаторная эволюция устойчивых к фузидовой кислоте Staphylococcus aureus

,

Mol Microbiol

,

2001

, vol.

40

(стр.

433

9

) 4« и др.

Молекулярный анализ устойчивости к фузидовой кислоте у Staphylococcus aureus

,

Mol Microbiol

,

2003

, vol.

47

(стр.

463

9

) 5,.

Связывание устойчивости к фузидовой кислоте с плазмидой пенициллиназы в Staphylococcus aureus

,

J Gen Microbiol

,

1972

, vol.

73

(стр.

501

8

) 6,.

Молекулярная основа опосредованной fusB устойчивости к фузидовой кислоте у Staphylococcus aureus

,

Mol Microbiol

,

2006

, vol.

59

(стр.

664

76

) 7« и др.

Генетическая характеристика детерминант устойчивости к фузидовой кислоте и кадмию плазмиды Staphylococcus aureus pUB101

,

J Antimicrob Chemother

,

2002

, vol.

50

(стр.

313

21

) 8,,, et al.

Устойчивый к фузидовой кислоте эпидемический штамм Staphylococcus aureus несет детерминанту fusB , тогда как мутации fusA преобладают в других устойчивых изолятах

,

Antimicrob Agents Chemother

,

2004

, vol.

48

(стр.

3594

7

) 9« и др.

Тестирование чувствительности бактерий и грибов. Отчет «Норвежской рабочей группы по антибиотикам»

,

Scand J Infect Dis Suppl

,

1997

, vol.

103

(стр.

1

36

) 10,.

Высокочастотная трансформация протопластов Bacillus subtilis плазмидной ДНК

,

Mol Gen Genet

,

1979

, vol.

168

(стр.

111

15

) 11,,.

Сравнение генов устойчивости к пенициллину у стафилококков крупного рогатого скота

,

Microb Drug Resist

,

2000

, vol.

6

(стр.

29

36

)

© Автор 2006.Опубликовано Oxford University Press от имени Британского общества антимикробной химиотерапии. Все права защищены. Для получения разрешений обращайтесь по электронной почте: [email protected]

.

Подострый бактериальный эндокардит, вызванный Str. haemolyticus Группа H

Подострый бактериальный эндокардит, вызванный Str. haemolyticus Группа H | Мета

British Medical Journal

R W FAIRBROTHER, KM LORD

Реферат

Реферат не указан.

Связанные концепции

Стрептококковые инфекции

Тенденции кормления

COVID-19

Коронавирусы включают большое семейство вирусов, вызывающих простуду, а также более серьезные заболевания, такие как продолжающаяся вспышка коронавируса. 2019 (COVID-19; формально известен как 2019-nCoV). Коронавирусы могут передаваться от животных человеку; симптомы включают жар, кашель, одышку и затрудненное дыхание; в более тяжелых случаях заражение может привести к летальному исходу.Этот канал охватывает недавние исследования COVID-19.

Бластомикоз

Бластомикоз Грибковые инфекции распространяются при вдыхании спор Blastomyces dermatitidis. Ознакомьтесь с последними исследованиями грибковых инфекций бластомикоза здесь.

Комплекс ядерных пор в ALS / FTD

Изменения в ядерно-цитоплазматическом транспорте, контролируемом комплексом ядерных пор, могут быть вовлечены в патомеханизм, лежащий в основе множественных нейродегенеративных заболеваний, включая боковой амиотрофический склероз и лобно-височную деменцию.Вот последние исследования комплекса ядерных пор при ALS и FTD.

Применение молекулярного штрих-кодирования

Концепция молекулярного штрих-кодирования заключается в том, что каждая исходная молекула ДНК или РНК прикрепляется к уникальному штрих-коду последовательности. Считывания последовательностей с разными штрих-кодами представляют разные исходные молекулы, в то время как считывания последовательностей с одинаковым штрих-кодом являются результатом дублирования ПЦР с одной исходной молекулы. Ознакомьтесь с последними исследованиями в области молекулярного штрих-кодирования здесь.

Синдром хронической усталости

Синдром хронической усталости — заболевание, характеризующееся необъяснимой инвалидизирующей усталостью; патология которого не до конца изучена.Узнайте о последних исследованиях синдрома хронической усталости здесь.

Эволюция плюрипотентности

Плюрипотентность относится к способности клетки развиваться в три первичных слоя зародышевых клеток эмбриона. Этот канал посвящен механизмам, лежащим в основе эволюции плюрипотентности. Вот последнее исследование.

Вариагация эффекта позиции

Вариагация эффекта позиции Вариация происходит, когда ген инактивирован из-за его расположения рядом с гетерохроматическими областями в хромосоме.Ознакомьтесь с последними исследованиями вариагации эффекта позиции здесь.

Агонисты рецепторов STING

Стимуляторы генов IFN (STING) представляют собой группу трансмембранных белков, которые участвуют в индукции интерферона I типа, важного для врожденного иммунного ответа. Стимуляция STING была активной областью исследований в лечении рака и инфекционных заболеваний. Вот последние исследования агонистов рецепторов STING.

Микробициды

Микробициды — это продукты, которые можно наносить на поверхности слизистой оболочки влагалища или прямой кишки с целью предотвращения или, по крайней мере, значительного снижения передачи инфекций, передаваемых половым путем.Вот последние исследования микробицидов.

Сопутствующие документы

Bollettino della Società italiana di biologia sperimentale

F SAVOIA

Zeitschrift für die gesamte innere Medizin und ihre Grenzgebiete

L BIND.

Zentralblatt für Bakteriologie, Parasitenkunde, Infektionskrankheiten und Hygiene. 1. Abt. Medizinisch-hygienische Bakteriologie, Virusforschung und Parasitologie.Оригинал

A FriederichsW Mannheim

Acta Médica Portuguesa

J AlmeidaA Vital-Morgado

/ статьи / подострый-бактериальный-эндокардит-вызванный-str / 14954177

(PDF) Staphylococcus haemolyticus — новая угроза на закате антибиотиков

Загружено с www.microbiologyresearch.org по

IP: 85.89.171.244

В понедельник, 14 декабря 2015 г. 16:14:05

Archer , Г.Л. и Климо, М.В. (1994).Антимикробная чувствительность

коагулазонегативных стафилококков. Антимикробные агенты Chemother 38,

2231–2237.

Арчиола, К. Р., Кампочча, Д. и Монтанаро, Л. (2002). Обнаружение

биопленкообразующих штаммов Staphylococcus epidermidis и S. aureus.

Эксперт Рев Мол Диагн 2, 478–484.

Обер, Г., Пассо, С., Лухт, Ф. и Дорче, Г. (1990). Отбор

устойчивых к ванкомицину и тейкопланину Staphylococcus haemolyticus

при лечении тейкопланином S.epidermidis инфекция.

J Antimicrob Chemother 25, 491–493.

Баннерман Т. Л., Вадьяк Д. Л. и Клоос В. Э. (1991). Восприимчивость

видов и подвидов Staphylococcus к тейкопланину. Antimicrob

Agents Chemother 35, 1919–1922.

Баррос, Э. М., Чеотто, Х., Бастос, М. К. Ф., Дос Сантос, К. Р. Н. &

Джамбиаджи-Демарваль, М. (2012). Staphylococcus haemolyticus как важный больничный патоген

и носитель генов устойчивости к метициллину

.J Clin Microbiol 50, 166–168.

Баррос, Э. М., Лемос, М., Соуто-Падро

´n, Т. и Джамбиаджи-де Марваль,

М. (2015). Фенотипическая и генотипическая характеристика образования биопленок

у Staphylococcus haemolyticus. Curr Microbiol 70, 829–834.

Беккер К., Хейльманн К. и Петерс Г. (2014). Коагулазо-отрицательные

стафилококки. Clin Microbiol Rev 27, 870–926.

Berglund, C. & So

¨derquist, B. (2008). Происхождение изолята Staphylococcus aureus, устойчивого к метициллин-

, в отделении для новорожденных в

Швеция — возможный горизонтальный перенос стафилококковой кассеты

хромосомный mec между метициллин-устойчивым Staphylococcus

haemloticocus.Clin Microbiol Infect 14,

1048–1056.

Бьяваско, Ф., Виньяроли, К. и Варальдо, П. Э. (2000). Гликопептид

Устойчивость

коагулазонегативных стафилококков. Eur J Clin Microbiol

Infect Dis 19, 403–417.

Билло-Кляйн, Д., Гутманн, Л., Брайант, Д., Белл, Д., Ван Хейеноорт, Дж.,

Гревал, Дж. И Шлес, Д. М. (1996). Синтез пептидогликана и структура

в Staphylococcus haemolyticus, экспрессирующая повышенные уровни устойчивости

к гликопептидным антибиотикам.JBacteriol 178, 4696–4703.

Blans, M. & Troelstra, A. (2001). Устойчивость к гликопептидам у

Staphylococcus haemolyticus во время лечения тейкопланином.

Infect Control Hosp Epidemiol 22, 263–264.

Бохниарц, М., Ваврон, В. и Щубял, М. (2013). Устойчивость к метициллину

коагулазонегативных стафилококков (ЦНС), выделенных из

мастита крупного рогатого скота. Pol J Vet Sci 16, 687–692.

Campanile, F., Bongiorno, D., Borbone, S., Фальконе, М., Джаннелла,

М., Вендитти, М. и Стефани, С. (2008). Активность даптомицина

in vitro против метициллин- и мультирезистентного Staphylococcus haemolyticus

инвазивных изолятов, несущих различные комплексы mec. Diagn Microbiol

Infect Dis 61, 227–231.

Кавана, Дж. П., Хьерде, Э., Холден, М. Т. Г., Калке, Т., Клингенберг,

С., Флегстад, Т., Паркхилл, Дж., Бентли, С. Д. и Соллид, Дж. У. Э. (2014).

Полногеномное секвенирование выявило клональную экспансию

мультирезистентного Staphylococcus haemolyticus в европейских больницах.

J Antimicrob Chemother 69, 2920–2927.

Cercenado, E., Garcı

´a-Leoni, ME, Dı

´az, MD, Sa

´nchez-Carrillo, C.,

Catala

´n, P., De Quiro

‘s, JC & Bouza, E. (1996). Появление

устойчивых к тейкопланину коагулазонегативных стафилококков. J Clin

Microbiol 34, 1765–1768.

Чемберс, Х. Ф. (1988). Метициллин-резистентные стафилококки. Clin

Microbiol Rev 1, 173–186.

Сидрал, Т. А., Карвалью, М. К., Фигейредо, А. М. С. и де Мело, М. К. Н.

(2015). [Epub перед печатью]. doi: 10.1111 / apm.12426 26227107

Появление метициллин-устойчивых коагулазонегативных стафилококков

, устойчивых к линезолиду с мутациями гена рРНК C2190T и G2603T

. APMIS.

Корс, Дж. И Уильямс, Р. Э. (1968). Антибиотикорезистентность коагулазы-

отрицательных стафилококков и микрококков. Дж. Клин Патол 21, 722–728.

Каннингем Р., Гурнелл М., Бейстон Р., Кокейн А. и Шелтон А.

(1997). Резистентность к тейкопланину у Staphylococcus haemolyticus,

развивается во время лечения. J Antimicrob Chemother 39, 438–439.

Дэниэл Б., Салим М., Насир Г. и Фида А. (2014). Значение

Staphylococcus haemolyticus при внутрибольничных инфекциях. J Pioneer

Med Sci 4, 119–126.

Degener, J. E., Heck, M. E. C., van Leeuwen, W.J., Heemskerk, C.,

Crielaard, A., Joosten, P. & Caesar, P. (1994). Нозокомиальная инфекция

Staphylococcus haemolyticus и методы типирования для эпидемиологического исследования

. J Clin Microbiol 32, 2260–2265.

Энг, Р. Х. К., Ван, К., Персон, А., Кин, Т. Э. и Армстронг, Д.

(1982). Идентификация видов коагулазонегативных стафилококков

изолятов из посевов крови. J Clin Microbiol 15, 439–442.

Энрайт, М.К., Робинсон, Д. А., Рэндл, Г., Фейл, Э. Дж., Грундманн, Н.

, и Спратт, Б. Г. (2002). История эволюции метициллин-

устойчивого золотистого стафилококка (MRSA). Proc Natl Acad Sci U S A

99, 7687–7692.

Fajardo Olivares, M., Hidalgo Orozco, R., Rodrı

´guez Garrido, S.,

Rodrı

´guez-Vidigal, FF, Vera Tome

´, A. & Robles Marcos, M.

(2011). Активность ванкомицина, ципрофлоксацина, даптомицина и линезолида

против коагулазонегативной стафилококковой бактериемии.Ред.

Esp Quimioter 24, 74–78.

Флахаут, С., Виноградов, Э., Келли, К. А., Бреннан, С., Хирамацу, К.

и Ли, Дж. К. (2008). Структурная и биологическая характеристика капсульного полисахарида

, продуцируемого Staphylococcus haemolyticus.

J Bacteriol 190, 1649–1657.

Флюит, А. К., Карпай, Н., Майор, Э. А., Бонтен, М. Дж. М. и Виллемс, Р. Дж.

Л. (2013). Общий резервуар последовательностей гена ccrB между коагулазой-

отрицательных стафилококков и метициллин-резистентным золотистым стафилококком.

J Antimicrob Chemother 68, 1707–1713.

Фредхейм, Э.Г.А., Клингенберг, К., Роде, Х., Франкенбергер, С.,

Гаустад, П., Флегстад, Т. и Соллид, Дж. Э. (2009). Формирование биопленки

с помощью Staphylococcus haemolyticus.J Clin Microbiol 47, 1172–1180.

Фроггатт, Дж. У., Джонстон, Дж. Л., Галетто, Д. У. и Арчер, Г. Л. (1989).

Устойчивость к противомикробным препаратам внутрибольничных изолятов Staphylococcus

haemolyticus. Антимикробные агенты Chemother 33, 460–466.

Геммелл, К. Г. и Доусон, Дж. Э. (1982). Идентификация коагулазы-

отрицательных стафилококков с помощью системы API staph. J Clin Microbiol

16, 874–877.

Goldstein, F. W., Coutrot, A., Sieffer, A. & Acar, J. F. (1990).

Процентное соотношение и распределение резистентных штаммов к тейкопланину и ванкомицину-

среди коагулазонегативных стафилококков. Antimicrob

Agents Chemother 34, 899–900.

Гупта, В., Гарг, С., Джайн, Р., Гарг, С. и Чандер, Дж. (2012). Линезолид

-резистентный гемолитический стафилококк: отчет о первом случае из Индии.

Asian Pac J Trop Med 5, 837–838.

Ханссен, А. М. и Эриксон Соллид, Дж. У. (2006). SCCmec у стафилококков:

гена в движении. FEMS Immunol Med Microbiol 46, 8–20.

Хирамацу К., Катаяма Ю., Юдзава Х. и Ито Т. (2002). Молекулярная

генетика метициллин-устойчивого золотистого стафилококка. Int J Med

Microbiol 292, 67–74.

Holden, MTG, Hsu, LY, Kurt, K., Weinert, LA, Mather, AE,

Harris, SR, Strommenger, B., Layer, F., Witte, W. и другие авторы

(2013 г. ). Геномный портрет возникновения, эволюции и глобального распространения

пандемии метициллин-устойчивого золотистого стафилококка.

Genome Res 23, 653–664.

Хоуп Р., Ливермор Д. М., Брик Г., Лилли М., Рейнольдс Р. и BSAC

Рабочие группы по надзору за сопротивлением (2008 г.).Не

тенденции восприимчивости среди стафилококков от бактериемии в Великобритании

и Ирландии, 2001–06. JAntimicrobChemother62 (Дополнение 2), ii65 – ii74.

Т. Чекай, М. Чишевский и Э. М. Шевчик

2066 Микробиология 161

% PDF-1.4 % 1031 0 объект > эндобдж xref 1031 81 0000000016 00000 н. 0000002398 00000 н. 0000002467 00000 н. 0000003123 00000 н. 0000003282 00000 н. 0000003432 00000 н. 0000003634 00000 н. 0000003772 00000 н. 0000003909 00000 н. 0000004047 00000 н. 0000004194 00000 н. 0000004535 00000 н. 0000004696 00000 н. 0000005038 00000 н. 0000005479 00000 н. 0000005807 00000 н. 0000006471 00000 н. 0000007359 00000 н. 0000007622 00000 н. 0000007708 00000 н. 0000010264 00000 п. 0000010561 00000 п. 0000010869 00000 п. 0000010966 00000 п. 0000014732 00000 п. 0000015082 00000 п. 0000015229 00000 п. 0000015396 00000 п. 0000015467 00000 п. 0000015539 00000 п. 0000015602 00000 п. 0000015949 00000 п. 0000016218 00000 п. 0000016456 00000 п. 0000016546 00000 п. 0000019022 00000 п. 0000019295 00000 п. 0000019454 00000 п. 0000020062 00000 н. 0000020218 00000 н. 0000020364 00000 п. 0000021155 00000 п. 0000021797 00000 п. 0000021944 00000 п. 0000028254 00000 п. 0000028833 00000 п. 0000029183 00000 п. 0000032592 00000 п. 0000032954 00000 п. 0000035592 00000 п. 0000035893 00000 п. 0000037384 00000 п. 0000038794 00000 п. 0000040060 00000 н. 0000041393 00000 п. 0000042891 00000 п. 0000043036 00000 п. 0000043139 00000 п. 0000044402 00000 п. 0000045978 00000 п. 0000047486 00000 п. 0000047827 00000 н. 0000047914 00000 п. 0000049229 00000 п. 0000049487 00000 п. 0000051200 00000 п. 0000051464 00000 п. 0000051552 00000 п. 0000051928 00000 п. 0000052152 00000 п. 0000052465 00000 п. 0000052681 00000 п. 0000052775 00000 п. 0000053324 00000 п. 0000053536 00000 п. 0000054046 00000 п. 0000054257 00000 п. 0000077847 00000 п. 0000096385 00000 п. 0000101576 00000 н. 0000001916 00000 н. трейлер ] / Назад 643864 >> startxref 0 %% EOF 1111 0 объект > поток hb»c«? AX8? 4b * a |} J \> hr9: E + UP) Ŋ \ گ ïJ36zH-Z9ͬfa% NuJ =}; g ^ W 0q {DTiNSŖAh @ u0 [* 8- C (% DX88

ДЕЙСТВИЕ ПТЕРОИЛГЛУТАМИНОВОЙ КИСЛОТЫ И ПРИРОДНЫХ ИСТОЧНИКОВ ФОЛИЕВОЙ КИСЛОТЫ НА ДИСКРАЗИИ КРОВИ, ВЫЗВАННЫЕ СУЛЬФОНАМИДНЫМИ ПРЕПАРАТАМИ | Кровь

Сульфаниламид, сульфатиазол и сульфадиазин вводились на уровне 1% в высокоочищенных диетах, и их влияние на рост, смертность и нарушения кровообращения по сравнению с сульфасуксидином.

Растворимые лекарства создают условия, аналогичные тем, которые производит сульфасуксидин. Подавление роста в значительной степени облегчается в случае сульфаниламида и в меньшей степени для сульфатиазола и сульфадиазина фолиевой кислотой. порошок экстракта печени и сухой дрожжевой экстракт, а также парааминобензойная кислота,

Дискразии крови, вызванные сульфаниламидом, сульфатиазолом и сульфадиазином, представляют собой тяжелую лейкопению, гранулоцитопению и легкую или тяжелую анемию. Их можно равномерно предотвратить или значительно уменьшить их тяжесть, если скармливать фолиевую кислоту, порошок экстракта печени или сухой дрожжевой экстракт.PABA оказывает меньшее влияние на количество скармливаемых кормов.

Порошок экстракта печени, по-видимому, оказывает благотворное влияние на рост и смертность, чего не показывают другие добавки. Как свободная, так и конъюгированная фолиевая кислота (в виде дрожжевого экстракта и порошкового экстракта печени 1:20) активны в борьбе с дискразиями.

Данные экспериментов in vitro с Str. haemolyticus (B Lancefield) указывает на то, что ни фолиевая кислота, ни порошок экстракта печени, ни сухой дрожжевой экстракт в соотношении к сульфонамиду, которые эффективны для предотвращения дискразий крови, не будут ингибировать или блокировать бактериостатическое действие сульфонамидных препаратов in vitro.

Предполагается, что действие фолиевой кислоты, порошка печени и дрожжевого экстракта полностью объясняется не устранением дефицита фолиевой кислоты, вызванным кишечным бактериостазом из-за лекарств, а повышенной потребностью животных в фолиевой кислоте в наличие определенных сульфаниламидов.

Мы признательны Гарольду Бускерку, Алисе Бергдал, Халли Фергюсон, Э. М. Стаперт, Ф. Ла Планте и Эвону Саджио за ценную помощь в проведении экспериментальной работы, о которой здесь сообщается.

.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *